Supported by National Institutes of Health (DK55679, and DK59888 to A.N.). Emory University&#160;Integrated Cellular Imaging Microscopy Core of the Winship Cancer&#160;Institute comprehensive cancer center grant, P30CA138292, and the Crohn's and Colitis Foundation of America Career Development award to C.T.C. and Fellowship Award to A.E.F.

Deneyler, yaşlan 10 ile 12 hafta arasında, C57BL / 6 fareleri kullanılmıştır. Hayvanları kullanan tüm prosedürleri gözden ve Emory Üniversitesi Kurumsal Hayvan Bakım ve Kullanım Kurulu tarafından onaylanmış ve Sağlık kriterlerine National Institutes göre gerçekleştirilmiştir bulundu. 1. Deney Düzeneği <ol><li> Cryostat Kurma <ol><li> Mikrotom bıçak ve mandreller dahil, -20 ° C&#39;ye Kriyostat dengelenmesi (bıçak etrafında aşırı dikkatli!). </li><li> Ekim boş bir cryomold (Optimal Kesme Sıcaklık bileşik) doldurun ve -20 ° C (~ 30 dk) dengelenmesi. Kalıptan dondurulmuş Ekim çıkarın ve sıvı OCT ile aynasının üzerinde sabitleyin. Mikrotom kolunda blok / mandreni yerleştirin ve Ekim 10 dakika için ayarlamanızı sağlar. </li><li> Bölüm başına 10 um Kriyostat ayarlayın ve düz olana kadar Ekim blok tıraş. Birkaç santimetre bıçaktan uzak mikrotom kolunu yedekleyin. Bu noktada exper kalanı için bıçak ya da Chuck ayarlamak yokşekli. </li></ol></li><li> Jilet hazırlayın: numune başına 2 Jilet hazırlayın. Metal dosyasını kullanarak, bıçakların sharped kenarı donuk. Sonra, forseps ile alüminyum flanşı çıkarın. </li><li> Kuru buz üzerinde bir Pyrex çanak veya diğer düz bir yüzeye önceden soğuk. </li><li> 10-15 diseksiyon pimleri ile diseksiyon çanak hazırlayın. Silikon ile dolu bir 10 cm&#39;lik bir doku kültürü kabı% 50 yeterli olacaktır. Oda sıcaklığında Hanks tamponu içinde 5 ml. </li></ol> Distal Kolon Doku 2. Diseksiyon <ol><li> Izofluran inhalasyonu ve servikal dislokasyon ile yerleştirin yalıtılmış bir bölmede fareler ve euthanize fareler, daha sonra karın ve göğüs 12 üzerine% 70 etanol sprey. </li><li> Makas ile karın derisinde küçük bir kesi yapmak ve daha sonra bir kesi periton boşluğuna maruz olun. Benzer işlemler burada 12 tarif bulunabilir. </li><li> Anal eşiğinde kalın bağırsak kesin ve kolon serbest kalıncaya kadar mezenter ayrı kızdırmak. </li><li> Distal kolon tüketimanüsten 0 ve 6 cm arasında kademeli. Burada, kript derinliği ~ 150 mikron (Şekil 1B bakınız). Makas kullanarak boyuna kolon açın ve dışkı içeriğini kaldırmak kesmek. </li><li> Mukoza yüzeyi yukarı bakacak şekilde diseksiyon çanak doku pin. Hanks tamponu bir silikon çanak doku kullanılarak diseksiyon işaretçilerine gerin ve RT (Şekil 1C) 10 dakika dinlendirin. Bu doku kıvrımlar kaldırır ve kas tabakaları dinlenmek için izin verir. </li></ol> Kesit için Kriyostat 3. Montaj Doku <ol><li> Dokuda istenilen bölümünde bir jileti kaydırın ve ardından Hanks tampon dökünüz. Bir sandviç yapma, üstüne başka bir jilet ekleyin. Doku segmenti kesin ve işaretçilerine çıkarın. Kuru buz jilet / doku sandviç aktarın. (5-10 dk, Şekil 1D) doku dondurmak için izin verin. </li><li> Jilet / doku sandviç Pick up ve üst bl üzerinde bir parmak koyarak hafifçe ısınmaya bırakınade (mukozal tarafı yukarı. Bu bazal kas tabakaları ilk kesitli böylece doku yönlendirir.). Sandviç ayırın ve doku segmentinin kenarlarda kesti. Bir doku bir bölümü yaklaşık olarak 0.5 cm x 1 cm kesilir. Kenar bölgeleri seri bölümleri birçok doku katmanları içeren neden kıvrılmaya bir eğilim vardır. Aşırı kesme altında kesim daha iyi olduğunu unutmayın, bu yüzden dikkatli bir tarafında err. </li><li> Doku üstünde buz erimeye başlayana kadar doku ısınmasını bekleyin. Bu noktada hızlı ve dikkatli kriyostat OCT bloğa doku basın. </li><li> Numune üzerinde parmağınızı koyarak bıçağını çıkarın. Isı transferi doku aksatmadan bıçağı çıkarmak için izin verecektir. </li><li> Ceket Ekim doku ve 5 dakika için dengelenmeye. 10 mikron (Şekil 1E, F) bölümleri kesin. Kriptler görülür kadar gözle bölümleri inceleyin. 1.5 ml tüpler içinde veya slaytlar yerleştirin bölümleri. </li><li> MRNA veya protein, bir yer t analizi için5 crypt-baz geçiş 5 ve tüp başına 5 yüzey bölümleri ile tüplerde o örnekleri. RNA toplanması için 1 ml ticari bir yalıtım reaktif ekleme ve 10 dakika için oda sıcaklığında inkübe edilir. Üreticinin talimatlarına uygun olarak, RNA saflaştırma gerçekleştirin. CDNA üretimi için toplam RNA 5-10 mikrogram kullanın. </li><li> Protein Saflaştırma için, soğuk RIPA 0.5 ml 5 bölümden başına tampon (artı proteaz inhibitörleri), liziz ekleyin. Buz üzerinde,% 70&#39;lik bir çevrim ile 3 kez sonikasyon. <ol><li> SDS-PAGE yükleme tamponu (Laemmli tamponu) numune ilave edin ve 10 dakika boyunca 100 ° C de inkübe edilir. SDS PAGE ve transfer tabi örnekleri, daha sonra 2 saat boyunca% 5 süt / PBS içinde bloke eder. (: 1: 500), 4 ° C&#39;de, O / N Klf4 antikorlar ile kuluçkalandı ve ardından Western blot analizini gerçekleştirir. </li></ol></li></ol>

<ol>
	<li>Noah, T. K., Donahue, B., Shroyer, N. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intestinal+development+and+differentiation.">Intestinal development and differentiation.</a> Exp Cell Res. 317, 2702-2710 (2011).</li><li>Humphries, A., Wright, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colonic+crypt+organization+and+tumorigenesis.">Colonic crypt organization and tumorigenesis.</a> Nat Rev Cancer. 8, 415-424 (2008).</li><li>Weber, C. R., Turner, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inflammatory+bowel+disease:+is+it+really+just+another+break+in+the+wall.">Inflammatory bowel disease: is it really just another break in the wall.</a> Gut. 56, 6-8 (2007).</li><li>Bjerknes, M., Cheng, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methods+for+the+isolation+of+intact+epithelium+from+the+mouse+intestine.">Methods for the isolation of intact epithelium from the mouse intestine.</a> Anat Rec. 199, 565-574 (1981).</li><li>Sato, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+Lgr5+stem+cells+build+crypt-villus+structures+in+vitro+without+a+mesenchymal+niche.">Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche.</a> Nature. 459, 262-265 (2009).</li><li>Rand, M. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calcium+depletion+dissociates+and+activates+heterodimeric+notch+receptors.">Calcium depletion dissociates and activates heterodimeric notch receptors.</a> Mol Cell Biol. 20, 1825-1835 (2000).</li><li>Gjorevski, N., Boghaert, E., Nelson, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+Epithelial-Mesenchymal+Transition+by+Transmission+of+Mechanical+Stress+through+Epithelial+Tissues.">Regulation of Epithelial-Mesenchymal Transition by Transmission of Mechanical Stress through Epithelial Tissues.</a> Cancer Microenviron. 5, 29-38 (2012).</li><li>Lechner, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression+pattern+of+laser+microdissected+colonic+crypts+of+adenomas+with+low+grade+dysplasia.">Gene expression pattern of laser microdissected colonic crypts of adenomas with low grade dysplasia.</a> Gut. 52, 1148-1153 (2003).</li><li>Reizel, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colon+stem+cell+and+crypt+dynamics+exposed+by+cell+lineage+reconstruction.">Colon stem cell and crypt dynamics exposed by cell lineage reconstruction.</a> PLoS Genet. 7, e1002192 (2011).</li><li>Kosinski, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression+patterns+of+human+colon+tops+and+basal+crypts+and+BMP+antagonists+as+intestinal+stem+cell+niche+factors.">Gene expression patterns of human colon tops and basal crypts and BMP antagonists as intestinal stem cell niche factors.</a> Proc Natl Acad Sci U S A. 104, 15418-15423 (2007).</li><li>Tamura, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pit+pattern+and+three-dimensional+configuration+of+isolated+crypts+from+the+patients+with+colorectal+neoplasm.">Pit pattern and three-dimensional configuration of isolated crypts from the patients with colorectal neoplasm.</a> J Gastroenterol. 37, 798-806 (2002).</li><li>Geem, D., Medina-Contreras, O., Kim, W., Huang, C. S., Denning, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+dendritic+cells+and+macrophages+from+the+mouse+intestine.">Isolation and characterization of dendritic cells and macrophages from the mouse intestine.</a> Journal of visualized experiments : JoVE. , e4040 (2012).</li><li>Laukoetter, M. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=JAM-A+regulates+permeability+and+inflammation+in+the+intestine+in+vivo.">JAM-A regulates permeability and inflammation in the intestine in vivo.</a> J Exp Med. 204, 3067-3076 (2007).</li><li>Neumann, P. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gut+commensal+bacteria+and+regional+Wnt+gene+expression+in+the+proximal+versus+distal+colon.">Gut commensal bacteria and regional Wnt gene expression in the proximal versus distal colon.</a> Am J Pathol. 184, 592-599 (2014).</li><li>Capaldo, C. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proinflammatory+cytokine-induced+tight+junction+remodeling+through+dynamic+self-assembly+of+claudins.">Proinflammatory cytokine-induced tight junction remodeling through dynamic self-assembly of claudins.</a> Mol Biol Cell. 25, 2710-2719 (2014).</li><li>Wells, J. M., Spence, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=How+to+make+an+intestine.">How to make an intestine.</a> Development. 141, 752-760 (2014).</li></ol>

The authors have nothing to disclose

Kolon epitel hücre çoğalması ve farklılaşması katılan moleküler mekanizmalar tam olarak anlaşılamamıştır. Bu kolon epitel kriptlerin dibinde kök hücre bölmesinin hücresel sinyal ortamında anlayışımızda boşlukları içerir. Enterosit farklılaşmasını altında yatan süreçlerin artan bir ilgi vardır. Örneğin, in vivo farklılaşma anlayışı in vitro primer intestinal sistemleri 16 üretmeyi amaçlayan çalışmalar için bir kriter olarak gerekli arttı. Yukarıdaki prosedür ekstra dikkat gerektiren çeşitli adımları içerir. Öncelikle, dondurulmuş doku segmentinde etrafında kenarları (bölüm 3.2&#39;de anlatıldığı gibi) kaldırarak diseksiyon ve donma sırasında kıvrılma doku kenarları olarak gereklidir. Bu kenarları sonuçları taşımak için başarısızlık yüzeyi ve kript baz hücrelerinin karışık nüfusu. Önceden soğutulmuş, tesviye Ekim blokta doku montaj da esastır. Tonun protokolü her bir havuz bölümlerin sayısını değiştirerek distal kolon diğer alanlarda adapte edilebilir. Şekil 1B &#39;de gösterildiği gibi Örneğin, mukozal kript uzunluğu 150-300 um arasında değişir. Anüsten 4 cm 6 cm arasında bölgeyi incelemek Bu nedenle, bölme sayısı Önemlisi 30&#39;a 15&#39;e yükselmiştir gerektiğini, bu protokol proksimal kolon için tavsiye edilmez (7 cm 9 cm) nedeniyle kıvrımları ile ( Seri kesit ile ayrı yüzeyi ve kript-baz hücrelerine imkansız hale lümenine uzanan plika obliquae). Seri kesit teknikleri kript-temel çalışma ve insanlarda epitel hücre popülasyonlarının yüzey kullanılmıştır. Ancak, bizim protokol nedeniyle fare doku küçük boyutu için gerekli olan ek adımlar ekler. Yukarıdaki protokol genetik uysal fare sistemlerinde kript tabanı ve yüzey epitel hücre popülasyonunun soruşturma sağlayacak öneriyorum. Gerçekten de, bir araya getirilmiş bölümler Yield yüksek kaliteli protein ve RNA uygun aşağı analizi. Gelecekteki uygulamalar, hücre sinyal yolları veya kromatin immunoprecipitation çalışma içerebilir. Bununla birlikte, yukarıda tarif edilen alternatif yöntemler birkaç gibi, elde edilen bölümler epitelial be interstitial lamina propriya hücrelerinin bir karışımını içeren, dikkat edilmelidir. Sonuç olarak, burada tarif edilen bir protokol murin kolon mukozası uzamsal olarak ayrı bölgelerde moleküler proseslerin analizi için hızlı, yüksek verimli bir yöntem temin etmektedir.

Kolon epitel ikamet kök hücreleri birkaç günde 1 doku Yenileyici ile son derece rejeneratif doku vardır. Rejenerasyon Bu işlem, bir proliferatif kök hücre bölmesinin bakım gerektirir. Zamanla, yeni üretilen kızı hücrelerinin çoğalma potansiyeli kaybeder ve bağırsak lümen yüzeyine doğru göç ederler. Göç ile tesadüf, progenitör hücrelerin olgun bariyer oluşturan enterositlerin veya mukoza üreten goblet hücrelerine farklılaşır. Bu farklılaşma programlarının başarısızlığı, iltihabik barsak hastalığı ve kolon kanseri 2,3 gözlenmiştir gibi epitelyal bariyer tehlikeye katkı düşünülmektedir. Yukarıdaki işlemlerin detaylı bir çalışma kript-taban ve yüzey hücre popülasyonlarının izole edilmesi için metodolojileri gerektirecektir. Birden yöntemler benzersiz avantajlar ve dezavantajları, her biri mevcuttur. Intestinal epitelyal hücrelerin izolasyonu için güncel yöntemler, CHDeney koşulları, 4,5 göre, tüm kriptlerin, epitelyal levhalar, ya da tek hücreleri, izolasyonu ile sonuçlanarak elating maddeler ve mekanik ayrışma. Bu yüksek verim yöntemlerdir, fakat hücreler arası sinyal değişiklik doğal ortamından 6,7 temsil edebilir, bu koşullar altında rapor edilmiştir. Lazer yakalama mikrodiseksiyon mekansal farklı malzemenin toplanması için izin verir, ancak düşük molekül verim 8,9 ulaşır. İnsan kalın bağırsak dokusunda olarak, seri, yatay krio-bölümleme yöntemleri 10 geliştirilmiştir. Bununla birlikte, faregiller mukozal dokular, bu tekniğin, doğrudan dağıtımı ile ilgili bir engelleyici küçüktür. İnsanlarda, kolonda (kript-taban ve yüzey hücreleri arasındaki uzak) bağırsak crypt uzunlukları um 100-1000 ~ arasında 11 değişir. Farelerde, kript boyları um 50-300 ~ arasındaki (Şekil 1A bakınız). fare kript küçük boyutlu isola bir meydan okuma sunuyorMevcut protokolleri kullanarak, bu iki hücre popülasyonlarının yon. Artık, düşük maliyetli, kript-baz izolasyonu için yüksek verimli bir yöntem tarif ve murin kolon dokusunda epitel hücre popülasyonu, yüzey. Bu şekilde hasat Doku daha sonra immünofloresan boyama, RT-PCR (Anlık-Polimeraz Zincir Reaksiyonu) ve western blotting de dahil olmak üzere, standart bir sonraki uygulamada, bir dizi analiz edilebilir.

<table><tbody><tr><td>Microtome</td><td>Leica Biosystems, Nussloch Germany</td><td>CM 1510-3</td><td></td></tr><tr><td>MyiQ real time PCR detector</td><td>BioRad</td><td></td><td></td></tr><tr><td>LSM 510&amp;nbsp;</td><td>Carl Zeiss</td><td></td><td>Confocal microscope</td></tr><tr><td>OCT</td><td>Tissue-Tek, Sakura Finetek, Torrance CA</td><td>4583</td><td></td></tr><tr><td>cryo-mold</td><td>Tissue-Tek, Sakura Finetek, Torrance CA</td><td>4557</td><td>25mmx20mmx5mm</td></tr><tr><td>High profile microtome blade</td><td>Leica Biosystems, Nussloch germany</td><td>818</td><td></td></tr><tr><td>GEM industrial blades</td><td>American Safety Razor Blades</td><td>62-0314</td><td></td></tr><tr><td>Sylgard silicon elastomere base</td><td>Dow Corning, Midland MI</td><td>3097358</td><td></td></tr><tr><td>27 1/2 g needle</td><td>Becton-Dickinson, Franklin Lakes, NJ</td><td>305109</td><td>pins for dissection</td></tr><tr><td>TRizol</td><td>Life Technologies</td><td>15596018</td><td></td></tr><tr><td>Rneasy</td><td>Qiagen</td><td>74104</td><td></td></tr><tr><td>DNAse</td><td>Qiagen</td><td>79254</td><td></td></tr><tr><td>Antibody ZO-1</td><td>Invitrogen&amp;nbsp;</td><td>187430</td><td></td></tr><tr><td>Antibody KLF4</td><td>Cell Signaling</td><td>4038S</td><td></td></tr><tr><td>Antibody mGAPDH</td><td>Sigma</td><td>G8795</td><td></td></tr><tr><td>Antibody Secondary Alexa conjugate</td><td>Invitrogen</td><td>A11034</td><td>488 anti-rabbit</td></tr><tr><td>Antibody Secondary HRP conjugate</td><td>Jackson</td><td>111/115-001-003</td><td>rabbit/mouse&amp;nbsp;</td></tr><tr><td>Topro-3</td><td>Invitrogen</td><td>T3605</td><td></td></tr><tr><td>HANKs balanced salt buffer</td><td>Life Technologies</td><td>14025092</td><td></td></tr><tr><td>RIPA lysis buffer</td><td></td><td></td><td>50mM Tris-HCl pH 7.4 150mM NaCl 1% NP40 0.25% Na-deoxycholate</td></tr><tr><td>primer TBP 3&#039;</td><td></td><td></td><td>GGAATTGTACCGCAGCTTCAAA</td></tr><tr><td>primer TBP 5&#039;</td><td></td><td></td><td>GATGACTGCAGCAAATCGCTT</td></tr><tr><td>primer KLF4 3&#039;</td><td></td><td></td><td>TGTGACTATGCAGGCTGTGGCAAA</td></tr><tr><td>primer KLF4 5&#039;</td><td></td><td></td><td>ACAGTGGTAAGGTTTCTCGCCTGT</td></tr></tbody></table>

cryosectioning method for microdissection of murine colonic mucosa

The colonic mucosal tissue provides a vital barrier to luminal antigens. This barrier is composed of a monolayer of simple columnar epithelial cells. The colonic epithelium is dynamically turned over and epithelial cells are generated in the stem cell containing crypts of Lieberk&#252;hn. Progenitor cells produced in the crypt-bases migrate toward the luminal surface, undergoing a process of cellular differentiation before being shed into the gut lumen. In order to study these processes at the molecular level, we have developed a simple method for the microdissection of two spatially distinct regions of the colonic mucosa; the proliferative crypt zone, and the differentiated surface epithelial cells. Our objective is to isolate specific crypt and surface epithelial cell populations from mouse colonic mucosa for the isolation of RNA and protein.

Kolon doku kesitleri histolojik değerlendirme ve H &amp; E 13 boyamak için işlenmiştir. Mukoza geleneksel kesit görünüşüdür Şekil 2A&#39;da görülmektedir. Bazal alanlar ağırlıklı olarak dairesel muskularis oluşan muskularis eksterna, içerirler. Lümene doğru ilerleyerek, muscularis mukoza kript baz epitel hücreleri bitişik belirgindir, ara hücreleri doku ortasında, ve son olarak, yüzey hücre popülasyonları bağırsak lümenini karşı karşıyadır. Burada tarif edilen seri kesit yöntemi muscularis mukoza (Şekil 2C) ve ardından boyuna ve dairesel muscularis ilk (Şekil 2B) karşılaşılan şekilde bir yönlendirme korur. Görüntünün sol üst dışı kas interstisyel hücrelerin görünümünü unutmayın. Aşağı analiz aşağıda açıklanan için, kas bölümleri atılır. sonraki bölümlerde epitel hücreleri ve interstisyel doku içerirler (lamina propria), Kript baz hücreleri (Şekil 2D) ile başlanarak. Nedeniyle yakından paketlenmiş çekirdeklere koyu görünür kriptalarının, çoğunda merkezi lümenin olmadığına dikkat edin. Bu tabakalar, proliferatif bir bölme ihtiva etmektedir. geçiş hücreler sıkı belirgin santral lümen (Şekil 2E) ile bezlerini dolu görünür. Son olarak, yüzey hücre popülasyonları yüzü (Şekil 2F) tr inceledi epitel tek tabaka alanları ile, düzensiz bir yapıya sahiptir. (Burada 14 tarif edildiği gibi), yukarıda tarif edildiği gibi seri bölümler, aynı zamanda immüno-floresan etiketlemesini ve konfokal mikroskopi için işlemden geçirilebilir. Şekil 2G çekirdekleri (mavi) ve hücre-hücre birleşme kısmı proteini zonula için boyanmış, daha sonra sabit ve% 100 metanol geçirgenleştirildi ve izole crypts gösterir occludens 1 (ZO-1, yeşil). Geleneksel kesit yönde, crypt ve yüzey hücre (Şekil 2G aynı anda izlenebilir </strong&gt;). Not ZO-1 junctional leke hatları olduğunu kolon crypt lümen. Lümenin Bu Z0-1 kaplama, aynı zamanda, dairesel bezleri (Şekil 2G) merkezinde, bir geçiş hücre popülasyonlarının seri kesit örneklerde görülebilir. Gelişmiş ZO-1 leke yüzey hücre popülasyonlarının (Şekil 2I ve J) görülür. Çeşitli farklılaşma faktörleri kript-yüzey ekseni boyunca uzaysal bir şekilde ifade edilebilir olduğu bilinmektedir. Bu yüzey hücre popülasyonları açısından zenginleştirilmiş olduğu bilinen transkripsiyon faktörü Kruppel benzeri faktör 4 (Klf4) içerir. Geleneksel kesit yöntemleri kullanarak, Klf4 yüzeyi hücre popülasyonlarının (Şekil 2K) bakan lümeninin çekirdeğinde bulunan. Bu nedenle, Klf4 mRNA&#39;nm temelde, yüzey hücresi popülasyonunda ifade edilir speküle etmişlerdir. Bunu test etmek için, seri kesitler toplanmış ve yüzey, geçiş ve kript-baz örneklerinin gruba ayrıldı. Subsequediğer yönden başkaları baskın, RNA, RNeasy kolonu ve DNAz muamelesi ile ek saflaştırma, standart Trizol ekstraksiyonu kullanılarak hasat edilmiştir. RNA örnek başına toplam RNA ug 5-10 arasındaki vermiştir 5 toplanmış ardışık kısmı, toplandı. Bu numuneler daha sonra Klf4 ve bir referans gen, TATA kutusu, bağlayıcı protein 1 (TBP-1) (Şekil 2 L) 14 hem de yarı-kantitatif gerçek zamanlı PCR tabi tutuldu. Şekil 2L gösterildiği gibi, TBP-1 normale döndükten sonra, yüzey hücreleri kript hücrelerde ifade edilir 8 kat Klf4 mRNA kadar ifade etmek için bulunmuştur. Benzer şekilde, Klf4 protein seviyeleri kript yüzeyi eksen boyunca mekansal düzenleme arzettiği bulunmuştur. 4 ° C&#39;de 20 dakika süreyle liziz tamponu içinde, yukarıda tarif edilen ve daha sonra kuluçkaya yatırılır olarak seri bölümler havuzlandı. Bu örnek başına protein 200-250 mikrogram arasında vermiştir. Numuneler daha sonra, SDS-PAGE (Şekil 2 M) 15 analizler tabi tutulmuştur. Şekil 2M gösterildiği gibi, Klf4 srotein seviyeleri önemli ölçüde yüzey hücre popülasyonlarının daha yüksektir. Yukarıdaki bulgular kemirgen kolon mukozasından yüzey ve kript epitel hücrelerinin büyük miktarda izole etmek, bu protokolün yeteneğini göstermek. <img alt="Şekil 1" src="/files/ftp_upload/53112/53112fig1.jpg" /> Şekil 1: (A) şematik gösteren fare kolon mukozası ve dış kas tabakaları. Bizim yöntemi seri cryosectioning (10 um her) tarafından ayrı yüzey hücre ve kript-baz hücre popülasyonlarının toplamayı hedefliyor. Dış kas tabakaları atılır. (B) kript yüksekliği kolon (kript-baz ve yüzey tabakalara arasındaki mesafe) uzunluğu boyunca değişir. Veri noktaları bireysel kript ölçümleri ve semboller biyolojik çoğaltır bildiren (n = 4). (C) Kolon bölümleri, toplanan ikiye, ve bir silikon diseksiyon çanak üzerine tutturulmuş. Se (d) bir dokuanüsten 3 cm kadar traş makinesi bıçaklara arasında sıkıştırılmış ve kuru buz üzerinde dondurulmuştur BÖLÜMLERE GÖRE R. (E) Doku daha sonra önceden tesviye Ekim blok üzerine monte edilir. (F) Cryosections kaldırıldı ve görsel denetlenir. <img alt="Şekil 2," src="/files/ftp_upload/53112/53112fig2.jpg" /> Şekil 2:. Örnek veriler dairesel muscularis (cm) gösteren enine kesitte hematoksilin-eosin ile boyandı (A), kalın bağırsak dokusunda, muscularis mukoza (mm), kript-nokta hücreleri, geçici hücre ve yüzey hücreleri. (B - C) kolon kas tabakası. (D) Crypt-baz hücreleri. Merkezi bir lümen olmadığına dikkat edin. (E) Geçiş hücreleri. (F) Yüzey hücreleri. İzole kolon kript (G) İmmünfloresan boyama. ZO-1 (yeşil) ve çekirdek (mavi) kesit olarak görülmektedir. (HI) ZO-1 ve geçiş ve yüzey hücrelerinde nükleer boyanma. (J) ZO-1 boyama büyütülmüş görünümü. (K) Klf4 (yeşil) yüzey hücre popülasyonlarında zenginleştirilmiştir. (L) üç bölmeleri arasında Klf4 mRNA seviyelerinin real-time PCR değerlendirmesi. (E) bu hücre popülasyonunda Klf4 proteini düzeylerinin Western blot analizleri.

Watch this Scientific Journal Video about Cryosectioning Method for Microdissection of Murine Colonic Mucosa at JoVE.com

Cryosectioning Method for Microdissection of Murine Colonic Mucosa

Here we describe a simple method for the isolation of spatially distinct murine colonic epithelial surface cells from the underlying crypt-base cells.

Fare Kolon Mukozanın Mikrodisseksiyon için Cryosectioning Yöntemi

The colonic mucosal tissue provides a vital barrier to luminal antigens. This barrier is composed of a monolayer of simple columnar epithelial cells. The ...

cryosectioning-method-for-microdissection-of-murine-colonic-mucosa

Universidad de Cartagena UDEC

Research

JoVE Journal

Biology

17.3K Görüntüleme.  Emory University, Atlanta, Georgia. Here we describe a simple method for the isolation of spatially distinct murine colonic epithelial surface cells from the underlying crypt-base cells.

Video: Cryosectioning Method for Microdissection of Murine Colonic Mucosa

Isolating And Immunostaining Lymphocytes and Dendritic Cells from Murine Peyer's Patches

Peyer's patches (PPs) are integral components of the gut-associated lymphoid tissues (GALT) and play a central role in intestinal immunosurveillance and homeostasis. Particulate antigens and microbes in the intestinal lumen are continuously sampled by PP M cells in the follicle-associated epithelium (FAE) and transported to an underlying network of dendritic cells (DCs), macrophages, and lymphocytes. In this article, we describe protocols in which murine PPs are (i) dissociated into single cell suspensions and subjected to flow cytometry and (ii) prepared for cryosectioning and immunostaining. For flow cytometry, PPs are mechanically dissociated and then filtered through 70 &mu;m membranes to generate single cell suspensions free of epithelial cells and large debris. Starting with 20-25 PPs (from four mice), this quick and reproducible method yields a population of &gt;2.5 x 106 cells with &gt;90% cell viability. For cryosectioning, freshly isolated PPs are immersed in Optimal Cutting Temperature (OCT) medium, snap-frozen in liquid nitrogen, and then sectioned using a cryomicrotome. Tissue sections (5-12 &mu;m) are air-dried, fixed with acetone or methanol, and then subjected to immunolabeling.

There is an increasing interest in understanding the immunological functions of specific subpopulations of cells in Peyer's patches (PPs), the primary inductive sites of gut-associated lymphoid tissues. Here we outline parallel protocols for preparing PP single cell preparations for flow cytometric analysis and PP cryosections for immunostaining.

Lenfositler ve mürin Peyer en Yamalar itibaren Dendritik Hücreler İzolasyon Ve immün

Peyer's  patches (PPs) are integral components of the gut-associated lymphoid tissues  (GALT) and play a central role in intestinal immunosurveillance and ...

İmmünoloji ve Enfeksiyon

Using Robotic Systems to Process and Embed Colonic Murine Samples for Histological Analyses

The understanding of human diseases has been greatly expanded thanks to the study of animal models. Nonetheless, histopathological evaluation of experimental models needs to be as rigorous as that applied for human samples. Indeed, drawing reliable and accurate conclusions is critically influenced by the quality of tissue section preparation. Here, we describe a protocol for histopathological analysis of murine tissues that implements several automated steps during the procedure, from the initial preparation to the paraffin embedding of the murine samples. The reduction of methodological variables through rigorous protocol standardization from automated procedures contributes to increased overall reliability of murine pathological analysis. Specifically, this protocol describes the utilization of automated processing and embedding robotic systems, routinely used for the tissue processing and paraffin embedding of human samples, to process murine specimens of intestinal inflammation. We conclude that the reliability of histopathological examination of murine tissues is significantly increased upon introduction of standardized and automated techniques.

Lack of standardization for murine tissue processing reduces the quality of murine histopathological analysis as compared to human specimens. Here, we present a protocol to perform histopathological examination of murine inflamed and uninflamed colonic tissues to show the feasibility of robotic systems routinely used for processing and embedding&#160;human samples.

Robot sistemleri kullanarak işlemek ve histolojik analizler için kolon fare örnekleri katıştır

The understanding of human diseases has been greatly expanded thanks to the study of animal models. Nonetheless, histopathological evaluation of ...

Optimization of Laser-Capture Microdissection for the Isolation of Enteric Ganglia from Fresh-Frozen Human Tissue

The purpose of this method is to obtain high-integrity RNA samples from enteric ganglia collected from unfixed, freshly-resected human intestinal tissue using laser capture microdissection (LCM). We have identified five steps in the workflow that are crucial for obtaining RNA isolates from enteric ganglia with sufficiently high quality and quantity for RNA-seq. First, when preparing intestinal tissue, each sample must have all excess liquid removed by blotting prior to flattening the serosa as much as possible across the bottom of large base molds. Samples are then quickly frozen atop a slurry of dry ice and 2-methylbutane. Second, when sectioning the tissue, it is important to position cryomolds so that intestinal sections parallel the full plane of the myenteric plexus, thereby yielding the greatest surface area of enteric ganglia per slide. Third, during LCM, polyethylene napthalate (PEN)-membrane slides offer the greatest speed and flexibility in outlining the non-uniform shapes of enteric ganglia when collecting enteric ganglia. Fourth, for distinct visualization of enteric ganglia within sections, ethanol-compatible dyes, like Cresyl Violet, offer excellent preservation of RNA integrity relative to aqueous dyes. Finally, for the extraction of RNA from captured ganglia, we observed differences between commercial RNA extraction kits that yielded superior RNA quantity and quality, while eliminating DNA contamination. Optimization of these factors in the current protocol greatly accelerates the workflow and yields enteric ganglia samples with exceptional RNA quality and quantity.

The goal of this protocol is to obtain high-integrity RNA samples from enteric ganglia isolated from unfixed, freshly-resected human intestinal tissue using laser capture microdissection (LCM). This protocol involves preparing flash-frozen samples of human intestinal tissue, cryosectioning, ethanolic staining and dehydration, LCM, and RNA extraction.

Lazer-yakalama mikrodiseksiyon optimizasyonu gelen insan dokusu taze donmuş enterik gangliyon yalıtım için

The purpose of this method is to obtain high-integrity RNA samples from enteric ganglia collected from unfixed, freshly-resected human intestinal tissue ...

Nörobilim

Performing Colonoscopic-Guided Pinch Biopsies in Mice and Evaluating Subsequent Tissue Changes

Understanding the tissue and cellular changes that occur in the acute injury response as well as during the wound healing process is of paramount importance when studying diseases of the gastrointestinal (GI) tract. The murine colonic pinch biopsy model is a useful tool to define these processes. Additionally, the interplay between gut luminal content (e.g., microbes) and the colon can be studied. However, wound induction and the ability to track wound closure over time in a reliable manner can be challenging. Moreover, tissue preparation and orientation must be carried out in a standardized way to optimally interrogate histologic and molecular changes. Here, we present a detailed method describing biopsy-induced injury and the monitoring of wound closure through repeat colonoscopies. An approach is described that ensures consistent and reproducible measurements of wound size, the ability to collect the wound bed for molecular analyses as well as visualize the wound bed upon sectioning of tissues. The ability to successfully carry out these techniques allows for studies of the acute injury response, wound healing and luminal-host interactions within the colon.

Here, we provide a detailed description of the procedure to induce colonoscopic-guided pinch biopsies in mice and track wound closure in real time. Additionally, methods for the preparation of tissues for histological, immunohistochemical and molecular analyses of the wound bed are provided.

Farelerde Kolonoskopik Güdümlü Çimdik Biyopsilerinin Yapılması ve Sonraki Doku Değişikliklerinin Değerlendirilmesi

Understanding the tissue and cellular changes that occur in the acute injury response as well as during the wound healing process is of paramount ...

Isolation of Primary Myofibroblasts from Mouse and Human Colon Tissue

The myofibroblast is a stromal cell of the gastrointestinal (GI) tract that has been gaining considerable attention for its critical role in many GI functions. While several myofibroblast cell lines are commercially available to study these cells in vitro, research results from a cell line exposed to experimental cell culture conditions have inherent limitations due to the overly reductionist nature of the work. Use of primary myofibroblasts offers a great advantage in terms of confirming experimental findings identified in a cell line. Isolation of primary myofibroblasts from an animal model allows for the study of myofibroblasts under conditions that more closely mimic the disease state being studied. Isolation of primary myofibroblasts from human colon tissue provides arguably the most relevant experimental data, since the cells come directly from patients with the underlying disease. We describe a well-established technique that can be utilized to isolate primary myofibroblasts from both mouse and human colon tissue. These isolated cells have been characterized to be alpha-smooth muscle actin and vimentin-positive, and desmin-negative, consistent with subepithelial intestinal myofibroblasts. Primary myofibroblast cells can be grown in cell culture and used for experimental purposes over a limited number of passages.

The myofibroblast is an influential stromal cell of the gastrointestinal tract that regulates important physiologic processes in both normal and disease states. We describe a technique that allows for the isolation of primary myofibroblasts from both mouse and human colon tissue, which can be utilized for in vitro experimentation.

Fare ve İnsan Kolon Doku Primer miyofibroblastlar İzolasyonu

The myofibroblast is  a stromal cell of the gastrointestinal (GI) tract that has been gaining  considerable attention for its critical role in many GI ...

Biyoloji

Cryosectioning of Contiguous Regions of a Single Mouse Skeletal Muscle for Gene Expression and Histological Analyses

With this method, consecutive cryosections are collected to enable both microscopy applications for tissue histology and enrichment of RNA for gene expression using adjacent regions from a single mouse skeletal muscle. Typically, it is challenging to achieve adequate homogenization of small skeletal muscle samples because buffer volumes may be too low for efficient grinding applications, yet without sufficient mechanical disruption, the dense tissue architecture of muscle limits penetration of buffer reagents, ultimately causing low RNA yield. By following the protocol reported here, 30 &#956;m sections are collected and pooled allowing cryosectioning and subsequent needle homogenization to mechanically disrupt the muscle, increasing the surface area exposed for buffer penetration. The primary limitations of the technique are that it requires a cryostat, and it is relatively low throughput. However, high-quality RNA can be obtained from small samples of pooled muscle cryosections, making this method accessible for many different skeletal muscles and other tissues. Furthermore, this technique enables matched analyses (e.g., tissue histopathology and gene expression) from adjacent regions of a single skeletal muscle so that measurements can be directly compared across applications to reduce experimental uncertainty and to reduce replicative animal experiments necessary to source a small tissue for multiple applications.

Consecutive cryo-sections are collected to enable histological applications and enrichment of RNA for gene expression measurements using adjacent regions from a single mouse skeletal muscle. High-quality RNA is obtained from 20 - 30 mg of pooled cryosections and measurements are directly compared across applications.

Gen İfade ve histolojik Analizler Tek Fare İskelet Kası bitişik Bölgeler Cryosectioning

With this method, consecutive cryosections are collected to enable both microscopy applications for tissue histology and enrichment of RNA for gene ...

Whole Cell Electrophysiology of Primary Cultured Murine Enterochromaffin Cells

Enterochromaffin (EC) cells in the gastrointestinal (GI) epithelium constitute the largest subpopulation of enteroendocrine cells. As specialized sensory cells, EC cells sense luminal stimuli and convert them into serotonin (5-hyroxytryptamine, 5-HT) release events. However, the electrophysiology of these cells is poorly understood because they are difficult to culture and to identify. The method presented in this paper outlines primary EC cell cultures optimized for single cell electrophysiology. This protocol utilizes a transgenic cyan fluorescent protein (CFP) reporter to identify mouse EC cells in mixed primary cultures, advancing the approach to obtaining high-quality recordings of whole cell electrophysiology in voltage- and current-clamp modes.

Enterochromaffin (EC) cells comprise a small subset of gastrointestinal epithelial cells. EC cells are electrically excitable and release serotonin, yet difficulties in culturing and identifying EC cells have limited physiological studies. The method presented here establishes a primary culture model amenable to examination of single EC cells by electrophysiology.

Tüm cep telefonu Elektrofizyoloji birincil kültürlü fare Enterochromaffin hücre

Enterochromaffin (EC) cells in the gastrointestinal (GI) epithelium constitute the largest subpopulation of enteroendocrine cells. As specialized sensory ...

Snap Freezing of Muscle Tissue for Sectioning: A Protocol to Obtain Ultrathin Sections of Rapidly Frozen Murine Muscle Tissue

Source: Bonetto, A. et al. <a href="https://jove.unicartagenaproxy.elogim.com/video/54893" target="_blank">The Colon-26 Carcinoma Tumor-bearing Mouse as a Model for the Study of Cancer Cachexia.</a> J. Vis. Exp. (2016)
This video describes the procedure for snap freezing muscle tissue and obtaining its thin sections. The technique can help study cancer-related cachexia in colon cancer mouse models.

Kesit için kas dokusunun hızlı dondurulması: hızla donmuş murin kas dokusunun ultra ince kesitlerini elde etmek için bir protokol

Source: Bonetto, A. et al. The Colon-26 Carcinoma Tumor-bearing Mouse as a Model for the Study of Cancer Cachexia. J. Vis. Exp. (2016)
This video ...

JoVE Encyclopedia of Experiments

Kanser Araştırmaları

Gastrointestinal Kanser

Hayvan modeli çalışmaları

Intestinal Crypts Isolation: A Method to Isolate Whole Crypts from Small Intestine of Murine Model

Source: Schewe, M. et al. <a href="https://jove.unicartagenaproxy.elogim.com/video/56329" target="_blank">The Organoid Reconstitution Assay (ORA) for the Functional Analysis of Intestinal Stem and Niche Cells.</a> J. Vis. Exp. (2017)
In this video, we demonstrate a technique to isolate whole crypts from a mouse&#8217;s small intestine. The isolated whole crypts can be used to propagate long-lived and self-renewing 3D organoids in vitro.

Bağırsak Kriptleri İzolasyonu: Murin Modelinin İnce Bağırsağından Tüm Kriptleri İzole Etmek İçin Bir Yöntem

Source: Schewe, M. et al. The Organoid Reconstitution Assay (ORA) for the Functional Analysis of Intestinal Stem and Niche Cells. J. Vis. Exp. (2017)
In ...

Frozen Mouse Brain Tissue Sectioning: A Procedure to Obtain Thin Frozen Tissue Sections from Frozen Murine Brain Tissue

Source: Comba, A. et al. <a href="https://jove.unicartagenaproxy.elogim.com/v/60939/laser-capture-microdissection-glioma-subregions-for-spatial-molecular">Laser Capture Microdissection of Glioma Subregions for Spatial and Molecular Characterization of Intratumoral Heterogeneity, Oncostreams, and Invasion.</a> J. Vis. Exp. (2020)
In this video, we demonstrate the sectioning of a frozen mouse brain tumor tissue using a cryostat. The frozen brain tissue sections so obtained are stored at low temperatures until further analysis.

Donmuş Fare Beyin Dokusu Kesiti: Donmuş Murin Beyin Dokusundan İnce Donmuş Doku Kesitleri Elde Etme Prosedürü

Source: Comba, A. et al. Laser Capture Microdissection of Glioma Subregions for Spatial and Molecular Characterization of Intratumoral Heterogeneity, ...