Supported by National Institutes of Health (DK55679, and DK59888 to A.N.). Emory University&#160;Integrated Cellular Imaging Microscopy Core of the Winship Cancer&#160;Institute comprehensive cancer center grant, P30CA138292, and the Crohn's and Colitis Foundation of America Career Development award to C.T.C. and Fellowship Award to A.E.F.

Versuchen verwendeten C57BL / 6-Mäusen, 10 bis 12 Wochen alt sind. Alle Verfahren unter Verwendung von Tieren wurden überprüft und von der Emory University Institutional Animal Care und Verwenden Committee genehmigt und wurden nach den National Institutes of Health Kriterien durchgeführt. 1. Versuchsaufbau <ol><li> Einrichten des Kryostaten <ol><li> Äquilibrieren Kryostaten auf -20 ° C, einschließlich der Mikrotomklinge und Spannfutter (äußerst vorsichtig vorgehen, um die Klinge!). </li><li> Füllen Sie eine leere cryomold mit OCT (optimale Schnitt Temperatur-Verbindung) und ins Gleichgewicht zu -20 ° C (~ 30 min). Entfernen Sie die gefrorenen Oktober aus der Form und befestigen Sie es am Spannfutter mit flüssigem Oktober Setzen Sie den Block / Spannfutter im Mikrotom Arm und lassen Sie das OAT 10 min eingestellt. </li><li> Stellen Sie den Kryostaten bis 10 &amp; mgr; m pro Schnitt und Rasur des Office-Block, bis es flach ist. Rücken des Mikrotoms Arm weg von der Klinge um mehrere Zentimeter. An dieser Stelle nicht das Messer oder Spannfutter für den Rest der Erfahrung anzupassen weißBeispiel. </li></ol></li><li> Bereiten Sie die Rasierklingen: Bereiten Sie 2 Rasierklingen pro Probe. Unter Verwendung einer Metallfeile, dumpf die sharped Rand der Blätter. Dann entfernen Sie den Flansch aus Aluminium mit einer Pinzette. </li><li> Pre-Chillen ein Pyrex Gericht oder einer anderen flachen Oberfläche auf Trockeneis. </li><li> Bereiten Sie eine Dissektion Gericht mit 10-15 Dissektion Stifte. A 10 cm Gewebekulturschale mit 50% Silizium gefüllt wird ausreichen. 5 ml Hanks-Puffer bei RT. </li></ol> 2. Präparation der Distal Kolongewebe <ol><li> Platz Mäusen in einer abgedichteten Kammer und einschläfern Mäusen durch Isofluran-Inhalation und Genickbruch, dann sprühen 70% Ethanol auf den Bauch und Brustkorb 12. </li><li> Machen Sie einen kleinen Schnitt in der Haut des Bauches mit einer Schere und dann ein Einschnitt in die Bauchhöhle aus. Ähnliche Verfahren können hier 12 beschrieben gefunden werden. </li><li> Schneiden Sie den Dickdarm am Rande anal und necken neben der Gekröse, bis der Doppelpunkt ist frei. </li><li> Auszuschneiden einen distalen KolonSegment zwischen 0 und 6 cm vom Anus. Hier ist die Kryptentiefe ~ 150 &amp; mgr; m (siehe Abbildung 1B). Schneiden Sie den Doppelpunkt in Längsrichtung mit einer Schere und die fäkale Inhalt zu entfernen. </li><li> Pin das Gewebe auf die Dissektion Gericht mit der Schleimhautoberfläche nach oben zeigt. Dehnen die Verwendung Gewebedissektion Stifte auf einem Silizium-Gericht in Hanks-Puffer und ruhen lassen für 10 Minuten bei RT (1C). Dies entfernt Falten aus dem Gewebe und erlaubt die Muskelschichten zu entspannen. </li></ol> 3. Montieren Tissue auf dem Kryostat zum Schneiden <ol><li> Schieben einer Rasierklinge unter der gewünschten Gewebebereich und dann abgießen Hanks-Puffer. Einen weiteren hinzufügen Rasierklinge nach oben, so dass ein Sandwich. Schneiden Sie das Gewebesegment und die Stifte zu entfernen. Übertragen Sie die Rasierklinge / Gewebe-Sandwich auf Trockeneis. Lassen Sie das Gewebe einzufrieren (5-10 min, 1D). </li><li> Nehmen Sie den Rasierer / Gewebe Sandwich und lassen Sie ihn leicht, indem Sie einen Finger auf die Oberseite bl wärmenade (Schleimhautseite nach oben. Dieser richtet das Gewebe, so dass die basalen Muskelschichten werden zuerst geschnitten.). Trennen Sie die Sandwich-und schneiden um die Ränder des Gewebesegment. Schneiden Sie ein Gewebesegment rund, 0.5 cm x 1 cm. Randbereiche haben eine Tendenz zu kräuseln, wodurch die Serienschnitte vieler Gewebeschichten. Beachten Sie, dass Überschneiden ist besser als unter Schneiden, so irren auf der Seite der Vorsicht. </li><li> Damit das Gewebe erwärmt, bis das Eis auf der Oberseite des Gewebes zu schmelzen beginnt. An dieser Stelle schnell und sorgfältig drücken das Gewebe in OCT-Block in den Kryostaten. </li><li> Entfernen Sie das Blade, indem Sie einen Finger über die Probe. Die Wärmeübertragung ermöglicht es Ihnen, die Klinge, ohne das Gewebe zu stören zu entfernen. </li><li> Coat das Gewebe mit OAT und ins Gleichgewicht für 5 min. Zuschnitte bei 10 um (1E, F). Sichtprüfung der Abschnitte bis die Krypten zu sehen sind. Platz Abschnitte in ein 1,5 ml Röhrchen oder auf Objektträgern. </li><li> Für die Analyse von mRNA oder Protein, Ort ter Proben in Röhrchen mit 5 Krypta-Basis, 5 Übergangs und 5 Flächenabschnitte pro Röhrchen. Für die RNA-Sammlung 1 ml kommerziellen Isolation-Reagenz und Inkubation bei Raumtemperatur für 10 min. Zuführen RNA-Reinigung gemß den Herstelleranweisungen. Verwenden 5-10 ug Gesamt-RNA für die cDNA-Generation. </li><li> Zur Proteinreinigung, fügen Sie 0,5 ml kaltem RIPA Lysepuffer (plus Protease-Inhibitoren) je 5 Sektionen. Beschallen 3 mal in einer 70% igen Zyklus, auf Eis. <ol><li> Proben, die SDS-PAGE-Ladepuffer (Laemmli-Puffer) hinzufügen und Inkubation bei 100 ° C für 10 min. Betreff Proben SDS-PAGE und Transfer, dann in 5% Milch / PBS Block 2 Stunden. Western Blot-Analyse durchzuführen, gefolgt von einer Inkubation mit KLF4 Antikörper (1: 500) O / N bei 4 ° C. </li></ol></li></ol>

<ol>
	<li>Noah, T. K., Donahue, B., Shroyer, N. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intestinal+development+and+differentiation.">Intestinal development and differentiation.</a> Exp Cell Res. 317, 2702-2710 (2011).</li><li>Humphries, A., Wright, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colonic+crypt+organization+and+tumorigenesis.">Colonic crypt organization and tumorigenesis.</a> Nat Rev Cancer. 8, 415-424 (2008).</li><li>Weber, C. R., Turner, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inflammatory+bowel+disease:+is+it+really+just+another+break+in+the+wall.">Inflammatory bowel disease: is it really just another break in the wall.</a> Gut. 56, 6-8 (2007).</li><li>Bjerknes, M., Cheng, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methods+for+the+isolation+of+intact+epithelium+from+the+mouse+intestine.">Methods for the isolation of intact epithelium from the mouse intestine.</a> Anat Rec. 199, 565-574 (1981).</li><li>Sato, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+Lgr5+stem+cells+build+crypt-villus+structures+in+vitro+without+a+mesenchymal+niche.">Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche.</a> Nature. 459, 262-265 (2009).</li><li>Rand, M. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calcium+depletion+dissociates+and+activates+heterodimeric+notch+receptors.">Calcium depletion dissociates and activates heterodimeric notch receptors.</a> Mol Cell Biol. 20, 1825-1835 (2000).</li><li>Gjorevski, N., Boghaert, E., Nelson, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+Epithelial-Mesenchymal+Transition+by+Transmission+of+Mechanical+Stress+through+Epithelial+Tissues.">Regulation of Epithelial-Mesenchymal Transition by Transmission of Mechanical Stress through Epithelial Tissues.</a> Cancer Microenviron. 5, 29-38 (2012).</li><li>Lechner, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression+pattern+of+laser+microdissected+colonic+crypts+of+adenomas+with+low+grade+dysplasia.">Gene expression pattern of laser microdissected colonic crypts of adenomas with low grade dysplasia.</a> Gut. 52, 1148-1153 (2003).</li><li>Reizel, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colon+stem+cell+and+crypt+dynamics+exposed+by+cell+lineage+reconstruction.">Colon stem cell and crypt dynamics exposed by cell lineage reconstruction.</a> PLoS Genet. 7, e1002192 (2011).</li><li>Kosinski, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression+patterns+of+human+colon+tops+and+basal+crypts+and+BMP+antagonists+as+intestinal+stem+cell+niche+factors.">Gene expression patterns of human colon tops and basal crypts and BMP antagonists as intestinal stem cell niche factors.</a> Proc Natl Acad Sci U S A. 104, 15418-15423 (2007).</li><li>Tamura, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pit+pattern+and+three-dimensional+configuration+of+isolated+crypts+from+the+patients+with+colorectal+neoplasm.">Pit pattern and three-dimensional configuration of isolated crypts from the patients with colorectal neoplasm.</a> J Gastroenterol. 37, 798-806 (2002).</li><li>Geem, D., Medina-Contreras, O., Kim, W., Huang, C. S., Denning, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+dendritic+cells+and+macrophages+from+the+mouse+intestine.">Isolation and characterization of dendritic cells and macrophages from the mouse intestine.</a> Journal of visualized experiments : JoVE. , e4040 (2012).</li><li>Laukoetter, M. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=JAM-A+regulates+permeability+and+inflammation+in+the+intestine+in+vivo.">JAM-A regulates permeability and inflammation in the intestine in vivo.</a> J Exp Med. 204, 3067-3076 (2007).</li><li>Neumann, P. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gut+commensal+bacteria+and+regional+Wnt+gene+expression+in+the+proximal+versus+distal+colon.">Gut commensal bacteria and regional Wnt gene expression in the proximal versus distal colon.</a> Am J Pathol. 184, 592-599 (2014).</li><li>Capaldo, C. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proinflammatory+cytokine-induced+tight+junction+remodeling+through+dynamic+self-assembly+of+claudins.">Proinflammatory cytokine-induced tight junction remodeling through dynamic self-assembly of claudins.</a> Mol Biol Cell. 25, 2710-2719 (2014).</li><li>Wells, J. M., Spence, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=How+to+make+an+intestine.">How to make an intestine.</a> Development. 141, 752-760 (2014).</li></ol>

The authors have nothing to disclose

Die molekularen Mechanismen in Kolonepithelzellen Zellproliferation und -differenzierung beteiligt sind kaum verstanden. Dies schließt Lücken in unserem Verständnis der zellulären Signalumgebung des Stammzellkompartiments an der Basis der Krypten Kolonepithel. Es besteht auch ein zunehmendes Interesse an der Prozesse, die Enterozyten Differenzierung unterliegen. Zum Beispiel, ein besseres Verständnis der in vivo Differenzierung wird als Benchmark für Studien an der Herstellung von in vitro Primärdarmsysteme 16 ausgerichtet erforderlich. Das obige Verfahren beinhaltet mehrere Schritte, die besondere Maßnahmen erfordern. Erstens, das Entfernen der Ränder um die gefrorenen Gewebesegment (wie in Abschnitt 3.2 diskutiert) als die Geweberänder beim Präparieren und Einfrieren curl erforderlich. Die Nichtbeachtung dieser Kanten Ergebnisse zu bewegen ist eine Mischpopulation von Oberfläche und Krypta Basiszellen. Montage des Gewebes auf einem vorgekühlten, eingeebnet Oktober Block ist auch wichtig. Tseinem Protokoll kann zu anderen Bereichen des distalen Kolons durch Verändern der Anzahl von Abschnitten in jedem Pool angepasst werden. Zum Beispiel, wie in 1B gezeigt, variiert Mukosakryptenbereichs Länge zwischen 150-300 um. Daher wird, wenn die Untersuchung der Bereich zwischen 4 cm 6 cm vom Anus aus, die Anzahl der Abschnitte ist von 15 bis 30. Es ist wichtig erhöht werden, wird dieses Protokoll nicht für das proximale Colon vorgeschlagen (7 cm-9 cm) durch Falten ( plicae obliquae), die in das Lumen zu verlängern macht es unmöglich, getrennte Oberfläche und Krypta-Basiszellen durch Serienschnitt. Serienschnitt Techniken wurden verwendet, um Krypta-Basis zu studieren und Oberfläche epithelialen Zellpopulationen in den Menschen. Fügt jedoch unser Protokoll zusätzliche Schritte, die aufgrund der geringen Größe des Maus-Gewebe erforderlich sind. Wir schlagen vor, dass das obige Protokoll wird für die Untersuchung der Krypta-Basis und Oberfläche epithelialen Zellpopulation in genetisch tractable Maus-Systeme ermöglichen. Tatsächlich vereinigt Abschnitte Yield hochwertiges Protein und RNA geeigneten nachgeschalteten Analyse. Zukünftige Anwendungen könnte die Untersuchung von Zellsignalwege oder Chromatinimmunpräzipitation enthalten. Es sollte jedoch beachtet werden, dass, wie einige der vorstehend beschriebenen alternativen Verfahren, enthalten die resultierenden Abschnitte eine Mischung von epithelialen und interstitielle Lamina propria Zellen sein. Im Ergebnis ist die hier beschriebene Protokoll stellt eine schnelle, hohe Ausbeute Methode für die Analyse von molekularen Prozessen in räumlich unterschiedlichen Regionen des murinen Colon-Schleimhaut.

Die Colon-Epithel ist ein hoch regenerativer Gewebe, mit Wohnsitz Stammzellen Auffüllen der Gewebe alle paar Tage ein. Dieser Prozess der Regeneration erfordert die Aufrechterhaltung einer proliferativen Stammzellkompartiments. Im Laufe der Zeit können die neu erzeugten Tochterzellen verlieren ihre proliferative Potenzial und wandern zu der luminalen Oberfläche des Darms. Gleichzeitig mit der Migration zu unterscheiden Vorläuferzellen in reife Barriere bildenden Enterozyten oder Schleimhaut produzierenden Becherzellen. Ausfall dieses Differenzierungsprogramms wird angenommen, tragen zur Epithelbarriere beeinträchtigt, wie es in entzündliche Darmerkrankungen und Kolonkrebs 2,3 beobachtet. Studieren der obigen Prozesse werden Methoden zur Isolierung von Krypta-Basis- und Oberflächenzellpopulationen erforderlich. Mehrere Methoden existieren, die jeweils mit einzigartigen Vorteilen und Nachteilen. Aktuelle Verfahren für die Isolierung von intestinalen Epithelzellen schließen CHelating Mittel sowie mechanische Dissoziation, was in der Isolierung des gesamten Krypten Epithellappen oder Einzelzellen, abhängig von den experimentellen Bedingungen 4,5. Dies sind Hochzinsmethoden, noch Änderungen der interzellulären Signalübertragung haben unter diesen Bedingungen, die nicht der nativen Umgebung 6,7 darstellen können gemeldet. Laser Mikrodissektion ermöglicht die Sammlung von Raum unterschiedlichen Material, sondern erreicht mit niedrigem Molekular Ausbeute 8,9. In menschlichen Dickdarmgewebe, haben Serien horizontal Kryoschneiden Methoden entwickelt worden 10. Allerdings sind murine Schleimhautgewebe unerschwinglich klein für die direkte Verwendung dieser Technik. Beim Menschen Darm Krypta Längen (die ferne zwischen der Krypta-Basis und Oberflächenzellen) in den Dickdarm liegt zwischen ~ 100-1000 &amp; mgr; m 11. Bei Mäusen sind crypt Längen zwischen ~ 50-300 &amp; mgr; m (siehe Abbildung 1A). Die geringe Größe der murine Krypten stellt eine Herausforderung für die isolation dieser beiden Zellpopulationen in einem der vorhandenen Protokolle. Wir beschreiben nun eine kostengünstige, High-Yield-Verfahren zur Isolierung von Krypta-Basis und Oberfläche epithelialen Zellpopulation in murinen Dickdarmgewebe. Gewebe in dieser Weise geerntet kann dann durch eine Reihe von Standard-Downstream-Anwendungen, einschließlich Immunfluoreszenzfärbung, RT-PCR (Echtzeit-Polymerase-Kettenreaktion) oder Western-Blot analysiert werden.

<table><tbody><tr><td>Microtome</td><td>Leica Biosystems, Nussloch Germany</td><td>CM 1510-3</td><td></td></tr><tr><td>MyiQ real time PCR detector</td><td>BioRad</td><td></td><td></td></tr><tr><td>LSM 510&amp;nbsp;</td><td>Carl Zeiss</td><td></td><td>Confocal microscope</td></tr><tr><td>OCT</td><td>Tissue-Tek, Sakura Finetek, Torrance CA</td><td>4583</td><td></td></tr><tr><td>cryo-mold</td><td>Tissue-Tek, Sakura Finetek, Torrance CA</td><td>4557</td><td>25mmx20mmx5mm</td></tr><tr><td>High profile microtome blade</td><td>Leica Biosystems, Nussloch germany</td><td>818</td><td></td></tr><tr><td>GEM industrial blades</td><td>American Safety Razor Blades</td><td>62-0314</td><td></td></tr><tr><td>Sylgard silicon elastomere base</td><td>Dow Corning, Midland MI</td><td>3097358</td><td></td></tr><tr><td>27 1/2 g needle</td><td>Becton-Dickinson, Franklin Lakes, NJ</td><td>305109</td><td>pins for dissection</td></tr><tr><td>TRizol</td><td>Life Technologies</td><td>15596018</td><td></td></tr><tr><td>Rneasy</td><td>Qiagen</td><td>74104</td><td></td></tr><tr><td>DNAse</td><td>Qiagen</td><td>79254</td><td></td></tr><tr><td>Antibody ZO-1</td><td>Invitrogen&amp;nbsp;</td><td>187430</td><td></td></tr><tr><td>Antibody KLF4</td><td>Cell Signaling</td><td>4038S</td><td></td></tr><tr><td>Antibody mGAPDH</td><td>Sigma</td><td>G8795</td><td></td></tr><tr><td>Antibody Secondary Alexa conjugate</td><td>Invitrogen</td><td>A11034</td><td>488 anti-rabbit</td></tr><tr><td>Antibody Secondary HRP conjugate</td><td>Jackson</td><td>111/115-001-003</td><td>rabbit/mouse&amp;nbsp;</td></tr><tr><td>Topro-3</td><td>Invitrogen</td><td>T3605</td><td></td></tr><tr><td>HANKs balanced salt buffer</td><td>Life Technologies</td><td>14025092</td><td></td></tr><tr><td>RIPA lysis buffer</td><td></td><td></td><td>50mM Tris-HCl pH 7.4 150mM NaCl 1% NP40 0.25% Na-deoxycholate</td></tr><tr><td>primer TBP 3&#039;</td><td></td><td></td><td>GGAATTGTACCGCAGCTTCAAA</td></tr><tr><td>primer TBP 5&#039;</td><td></td><td></td><td>GATGACTGCAGCAAATCGCTT</td></tr><tr><td>primer KLF4 3&#039;</td><td></td><td></td><td>TGTGACTATGCAGGCTGTGGCAAA</td></tr><tr><td>primer KLF4 5&#039;</td><td></td><td></td><td>ACAGTGGTAAGGTTTCTCGCCTGT</td></tr></tbody></table>

cryosectioning method for microdissection of murine colonic mucosa

The colonic mucosal tissue provides a vital barrier to luminal antigens. This barrier is composed of a monolayer of simple columnar epithelial cells. The colonic epithelium is dynamically turned over and epithelial cells are generated in the stem cell containing crypts of Lieberk&#252;hn. Progenitor cells produced in the crypt-bases migrate toward the luminal surface, undergoing a process of cellular differentiation before being shed into the gut lumen. In order to study these processes at the molecular level, we have developed a simple method for the microdissection of two spatially distinct regions of the colonic mucosa; the proliferative crypt zone, and the differentiated surface epithelial cells. Our objective is to isolate specific crypt and surface epithelial cell populations from mouse colonic mucosa for the isolation of RNA and protein.

Dickdarmgewebeschnitte wurden für die histologische Beurteilung und H &amp; E Färbung 13 verarbeitet. Eine traditionelle Querschnittsansicht der Schleimhaut ist in 2A gesehen. Basal-Bereiche enthalten die Muscularis externa, vor allem der Kreis muscularis besteht. Ausgehend Richtung der Lumen ist die Muscularis mucosa verständlich neben dem Krypta-Basis Epithelzellen, sind Übergangszellen in der Mitte des Gewebes und schließlich Oberfläche Zellpopulationen konfrontiert das Darmlumen. Die hier beschriebene serielle Schnittverfahren unterhält eine Orientierung, so dass die Längs- und Rund muscularis zuerst angetroffen (2B), gefolgt von der Muscularis mucosa (2C). Beachten Sie die Darstellung der Nicht-Muskel interstitieller Zellen in der linken oberen Ecke des Bildes. Für die unten beschriebenen abwärts Analyse werden Muskelabschnitte verworfen. Die folgenden Abschnitte enthalten Epithelzellen und Zwischengewebe (Lamina propria), Mit Krypta-Basiszellen (2D). Bemerke die Abwesenheit eines zentralen Lumens in den meisten der Krypten, die dunkler erscheinen aufgrund der eng gepackten Kernen. Diese Schichten enthalten die proliferative Fach. Die Übergangs Zellen erscheinen als dicht gepackte Drüsen mit prominenten zentralen Lumen (2E). Schließlich Oberfläche Zellpopulationen eine unregelmäßige Struktur mit Bereichen des epithelialen Mono angesehen en face (2F). Serienschnitte, wie oben beschrieben, können auch für die Immunfluoreszenz Kennzeichnung und konfokale Mikroskopie verarbeitet werden (wie hier 14 beschrieben). 2G zeigt isolierten Krypten fixiert und in 100% Methanol permeabilisiert und anschließend für Kerne (blau) und der Zell-Zell-junction-Protein Zonula gefärbten occludens 1 (ZO-1, grün). In der traditionellen Schnitte Orientierung kann Krypta und Oberflächenzelle gleichzeitig angezeigt werden (Abbildung 2G </strong&gt;). Beachten Sie, dass die ZO-1 junctional Fleck Linien das Lumen des Darm Krypta. Diese Z0-1 Auskleidung des Lumens können auch in serieller Schnittproben von Übergangszellpopulationen zu erkennen ist, in der Mitte der kreisförmigen Drüsen (Figur 2G). Verbesserte ZO-1-Färbung wird in Oberflächenzellpopulationen (2I und J) zu sehen. Mehrere Differenzierungsfaktoren sind bekannt, in einem räumlich-zeitliche Art und Weise entlang der Krypta-zu-Oberfläche-Achse ausgedrückt werden. Dies schließt den Transkriptionsfaktor Kruppel artigen Faktor 4 (KLF4), die dafür bekannt ist, in der Oberflächenzellpopulationen angereichert werden. Mit herkömmlichen Schneideverfahren wird KLF4 in den Kernen der Lumen zugewandte Oberfläche Zellpopulationen (2k) gefunden. Wir haben daher vermutet, dass KLF4 mRNA würden vorwiegend in der Oberflächenzellpopulationen exprimiert werden. Um dies zu testen, wurden Serienschnitte gesammelt und in Oberflächenwasser, Übergangs- und Krypta-Basis Proben gruppiert. Subsequently, RNA wurde mit Trizol Standardextraktion geerntet, mit einer zusätzlichen Reinigung durch RNeasy Säule und DNAse-Behandlung. RNA wurde aus 5 gesammelt aufeinanderfolgende Abschnitte, die zwischen 5-10 ug Gesamt-RNA pro Probe ergab gesammelt. Diese Proben wurden dann auf semi-quantitative Echtzeit-PCR sowohl KLF4 und eines Referenzgens, TATA Box-Bindungsprotein 1 (TBP-1) (2L) 14 unterzogen. Wie in Figur 2L gezeigt ist, nach der Normalisierung zu TBP-1 wurden Oberflächenzellen bis zu 8-fache der KLF4 mRNA, die in Krypta-Zellen exprimiert wird, auszudrücken. In ähnlicher Weise wurden KLF4 Proteinspiegel festgestellt, dass räumliche Regelung entlang der Krypta-Flächenachse aufweisen. Serielle Schnitte wurden wie oben für 20 min bei 4 ° C beschrieben, und dann in Lysepuffer gepoolt. Dies ergab 200-250 ug Protein pro Probe. Proben wurden dann Analyse durch SDS-PAGE (2M) 15 unterzogen. Wie in Fig 2M gezeigt KLF4 protein Ebenen sind dramatisch in Oberflächenzellpopulationen höher. Die obigen Ergebnisse zeigen die Fähigkeit dieses Protokoll, um große Mengen von Oberflächen Krypta Epithelzellen aus dem murinen Kolonschleimhaut isolieren. <img alt="Abbildung 1" src="/files/ftp_upload/53112/53112fig1.jpg" /> Figur 1: (A) schematische Darstellung murine Colon-Mucosa und äußeren Muskelschichten. Unsere Methode zielt darauf ab, diskrete Oberflächenzelle und Krypta-Basiszellpopulationen durch serielle Kryoschneiden (jeweils 10 &amp; mgr; m) zu sammeln. Die äußeren Muskelschichten werden verworfen. (B) Crypt Höhe entlang der Länge des Dickdarms (Abstand zwischen Krypta-Basis und Deckschichten). Datenpunkte zeigen einzelne Krypta Messungen und Symbole zeigen biologischen Wiederholungen (n = 4). (C) Colon Segmente gesammelt, halbiert, und auf einen Silicium Sezieren Gericht festgesteckt. (D) Ein Gewebe segment etwa 3 cm vom Anus zwischen zu Rasierklingen gedrückt wird und das auf Trockeneis gefroren. (E) Das Gewebe wird dann auf eine vorge nivelliert Oktober Block montiert. (F) Kryoschnitte entnommen und visuell untersucht. <img alt="Figur 2" src="/files/ftp_upload/53112/53112fig2.jpg" /> Abb. 2: Repräsentative Daten (A) Dickdarmgewebe mit Hämatoxylin-Eosin gefärbt im Querschnitt, die die kreisförmige muscularis (cm), die Muscularis mucosa (mm), Krypta-Basiszellen, Übergangszellen und Oberflächenzellen. (B - C) Darmmuskelschichten. (D) Crypt-Basiszellen. Bemerke die Abwesenheit eines zentralen Lumens. (E) Transitional-Zellen. (F) Oberflächenzellen. (G) Immunfluoreszenzfärbung von isolierten Kolonkrypten. ZO-1 (grün) und Zellkerne (blau) sind im Querschnitt beobachtet. (HALLO) ZO-1 und Kernfärbung in Übergangs- und Oberflächenzellen. (J) vergrößerte Ansicht ZO-1-Färbung. (K) KLF4 (grün) in Oberflächenzellpopulationen angereichert. (L) Real-time PCR Beurteilung KLF4 mRNA-Spiegel zwischen den drei Kammern. (M) Western Blot-Analyse von Protein KLF4 Niveau in diesen Zellpopulationen.

Watch this Scientific Journal Video about Cryosectioning Method for Microdissection of Murine Colonic Mucosa at JoVE.com

Cryosectioning Method for Microdissection of Murine Colonic Mucosa

Here we describe a simple method for the isolation of spatially distinct murine colonic epithelial surface cells from the underlying crypt-base cells.

Kryoschneiden Verfahren zur Mikrodissektion von Murine Kolonschleimhaut

The colonic mucosal tissue provides a vital barrier to luminal antigens. This barrier is composed of a monolayer of simple columnar epithelial cells. The ...

cryosectioning-method-for-microdissection-of-murine-colonic-mucosa

Universidad de Cartagena UDEC

Research

JoVE Journal

Biology

17.3K Aufrufe.  Emory University, Atlanta, Georgia. Here we describe a simple method for the isolation of spatially distinct murine colonic epithelial surface cells from the underlying crypt-base cells.

Serie: Cryosectioning Method for Microdissection of Murine Colonic Mucosa

Isolating And Immunostaining Lymphocytes and Dendritic Cells from Murine Peyer's Patches

Peyer's patches (PPs) are integral components of the gut-associated lymphoid tissues (GALT) and play a central role in intestinal immunosurveillance and homeostasis. Particulate antigens and microbes in the intestinal lumen are continuously sampled by PP M cells in the follicle-associated epithelium (FAE) and transported to an underlying network of dendritic cells (DCs), macrophages, and lymphocytes. In this article, we describe protocols in which murine PPs are (i) dissociated into single cell suspensions and subjected to flow cytometry and (ii) prepared for cryosectioning and immunostaining. For flow cytometry, PPs are mechanically dissociated and then filtered through 70 &mu;m membranes to generate single cell suspensions free of epithelial cells and large debris. Starting with 20-25 PPs (from four mice), this quick and reproducible method yields a population of &gt;2.5 x 106 cells with &gt;90% cell viability. For cryosectioning, freshly isolated PPs are immersed in Optimal Cutting Temperature (OCT) medium, snap-frozen in liquid nitrogen, and then sectioned using a cryomicrotome. Tissue sections (5-12 &mu;m) are air-dried, fixed with acetone or methanol, and then subjected to immunolabeling.

There is an increasing interest in understanding the immunological functions of specific subpopulations of cells in Peyer's patches (PPs), the primary inductive sites of gut-associated lymphoid tissues. Here we outline parallel protocols for preparing PP single cell preparations for flow cytometric analysis and PP cryosections for immunostaining.

Isolierung und Immunfärbung Lymphozyten und dendritische Zellen aus Murine Peyer-Plaques

Peyer's  patches (PPs) are integral components of the gut-associated lymphoid tissues  (GALT) and play a central role in intestinal immunosurveillance and ...

Forschung

Immunologie und Infektion

Using Robotic Systems to Process and Embed Colonic Murine Samples for Histological Analyses

The understanding of human diseases has been greatly expanded thanks to the study of animal models. Nonetheless, histopathological evaluation of experimental models needs to be as rigorous as that applied for human samples. Indeed, drawing reliable and accurate conclusions is critically influenced by the quality of tissue section preparation. Here, we describe a protocol for histopathological analysis of murine tissues that implements several automated steps during the procedure, from the initial preparation to the paraffin embedding of the murine samples. The reduction of methodological variables through rigorous protocol standardization from automated procedures contributes to increased overall reliability of murine pathological analysis. Specifically, this protocol describes the utilization of automated processing and embedding robotic systems, routinely used for the tissue processing and paraffin embedding of human samples, to process murine specimens of intestinal inflammation. We conclude that the reliability of histopathological examination of murine tissues is significantly increased upon introduction of standardized and automated techniques.

Lack of standardization for murine tissue processing reduces the quality of murine histopathological analysis as compared to human specimens. Here, we present a protocol to perform histopathological examination of murine inflamed and uninflamed colonic tissues to show the feasibility of robotic systems routinely used for processing and embedding&#160;human samples.

Verwendung von Robotersystemen zu verarbeiten und Embed-Kolon Murine Proben für histologische Analysen

The understanding of human diseases has been greatly expanded thanks to the study of animal models. Nonetheless, histopathological evaluation of ...

Optimization of Laser-Capture Microdissection for the Isolation of Enteric Ganglia from Fresh-Frozen Human Tissue

The purpose of this method is to obtain high-integrity RNA samples from enteric ganglia collected from unfixed, freshly-resected human intestinal tissue using laser capture microdissection (LCM). We have identified five steps in the workflow that are crucial for obtaining RNA isolates from enteric ganglia with sufficiently high quality and quantity for RNA-seq. First, when preparing intestinal tissue, each sample must have all excess liquid removed by blotting prior to flattening the serosa as much as possible across the bottom of large base molds. Samples are then quickly frozen atop a slurry of dry ice and 2-methylbutane. Second, when sectioning the tissue, it is important to position cryomolds so that intestinal sections parallel the full plane of the myenteric plexus, thereby yielding the greatest surface area of enteric ganglia per slide. Third, during LCM, polyethylene napthalate (PEN)-membrane slides offer the greatest speed and flexibility in outlining the non-uniform shapes of enteric ganglia when collecting enteric ganglia. Fourth, for distinct visualization of enteric ganglia within sections, ethanol-compatible dyes, like Cresyl Violet, offer excellent preservation of RNA integrity relative to aqueous dyes. Finally, for the extraction of RNA from captured ganglia, we observed differences between commercial RNA extraction kits that yielded superior RNA quantity and quality, while eliminating DNA contamination. Optimization of these factors in the current protocol greatly accelerates the workflow and yields enteric ganglia samples with exceptional RNA quality and quantity.

The goal of this protocol is to obtain high-integrity RNA samples from enteric ganglia isolated from unfixed, freshly-resected human intestinal tissue using laser capture microdissection (LCM). This protocol involves preparing flash-frozen samples of human intestinal tissue, cryosectioning, ethanolic staining and dehydration, LCM, and RNA extraction.

Optimierung der Capture-Laser Mikrodissektion für die Isolierung der enterischen Ganglien aus menschlichem Gewebe Tiefkühlfrische

The purpose of this method is to obtain high-integrity RNA samples from enteric ganglia collected from unfixed, freshly-resected human intestinal tissue ...

Neurowissenschaften

Performing Colonoscopic-Guided Pinch Biopsies in Mice and Evaluating Subsequent Tissue Changes

Understanding the tissue and cellular changes that occur in the acute injury response as well as during the wound healing process is of paramount importance when studying diseases of the gastrointestinal (GI) tract. The murine colonic pinch biopsy model is a useful tool to define these processes. Additionally, the interplay between gut luminal content (e.g., microbes) and the colon can be studied. However, wound induction and the ability to track wound closure over time in a reliable manner can be challenging. Moreover, tissue preparation and orientation must be carried out in a standardized way to optimally interrogate histologic and molecular changes. Here, we present a detailed method describing biopsy-induced injury and the monitoring of wound closure through repeat colonoscopies. An approach is described that ensures consistent and reproducible measurements of wound size, the ability to collect the wound bed for molecular analyses as well as visualize the wound bed upon sectioning of tissues. The ability to successfully carry out these techniques allows for studies of the acute injury response, wound healing and luminal-host interactions within the colon.

Here, we provide a detailed description of the procedure to induce colonoscopic-guided pinch biopsies in mice and track wound closure in real time. Additionally, methods for the preparation of tissues for histological, immunohistochemical and molecular analyses of the wound bed are provided.

Durchführen von colonoscopic-Guided Pinch Biopsien bei Mäusen und Bewertung nachfolgender Gewebeveränderungen

Understanding the tissue and cellular changes that occur in the acute injury response as well as during the wound healing process is of paramount ...

Isolation of Primary Myofibroblasts from Mouse and Human Colon Tissue

The myofibroblast is a stromal cell of the gastrointestinal (GI) tract that has been gaining considerable attention for its critical role in many GI functions. While several myofibroblast cell lines are commercially available to study these cells in vitro, research results from a cell line exposed to experimental cell culture conditions have inherent limitations due to the overly reductionist nature of the work. Use of primary myofibroblasts offers a great advantage in terms of confirming experimental findings identified in a cell line. Isolation of primary myofibroblasts from an animal model allows for the study of myofibroblasts under conditions that more closely mimic the disease state being studied. Isolation of primary myofibroblasts from human colon tissue provides arguably the most relevant experimental data, since the cells come directly from patients with the underlying disease. We describe a well-established technique that can be utilized to isolate primary myofibroblasts from both mouse and human colon tissue. These isolated cells have been characterized to be alpha-smooth muscle actin and vimentin-positive, and desmin-negative, consistent with subepithelial intestinal myofibroblasts. Primary myofibroblast cells can be grown in cell culture and used for experimental purposes over a limited number of passages.

The myofibroblast is an influential stromal cell of the gastrointestinal tract that regulates important physiologic processes in both normal and disease states. We describe a technique that allows for the isolation of primary myofibroblasts from both mouse and human colon tissue, which can be utilized for in vitro experimentation.

Isolierung von Primär Myofibroblasten aus Maus und Mensch Colon Tissue

The myofibroblast is  a stromal cell of the gastrointestinal (GI) tract that has been gaining  considerable attention for its critical role in many GI ...

Biologie

Cryosectioning of Contiguous Regions of a Single Mouse Skeletal Muscle for Gene Expression and Histological Analyses

With this method, consecutive cryosections are collected to enable both microscopy applications for tissue histology and enrichment of RNA for gene expression using adjacent regions from a single mouse skeletal muscle. Typically, it is challenging to achieve adequate homogenization of small skeletal muscle samples because buffer volumes may be too low for efficient grinding applications, yet without sufficient mechanical disruption, the dense tissue architecture of muscle limits penetration of buffer reagents, ultimately causing low RNA yield. By following the protocol reported here, 30 &#956;m sections are collected and pooled allowing cryosectioning and subsequent needle homogenization to mechanically disrupt the muscle, increasing the surface area exposed for buffer penetration. The primary limitations of the technique are that it requires a cryostat, and it is relatively low throughput. However, high-quality RNA can be obtained from small samples of pooled muscle cryosections, making this method accessible for many different skeletal muscles and other tissues. Furthermore, this technique enables matched analyses (e.g., tissue histopathology and gene expression) from adjacent regions of a single skeletal muscle so that measurements can be directly compared across applications to reduce experimental uncertainty and to reduce replicative animal experiments necessary to source a small tissue for multiple applications.

Consecutive cryo-sections are collected to enable histological applications and enrichment of RNA for gene expression measurements using adjacent regions from a single mouse skeletal muscle. High-quality RNA is obtained from 20 - 30 mg of pooled cryosections and measurements are directly compared across applications.

Kryoschneiden von benachbarten Regionen eines einzelnen Maus Skelettmuskel für die Genexpression und histologische Analysen

With this method, consecutive cryosections are collected to enable both microscopy applications for tissue histology and enrichment of RNA for gene ...

Whole Cell Electrophysiology of Primary Cultured Murine Enterochromaffin Cells

Enterochromaffin (EC) cells in the gastrointestinal (GI) epithelium constitute the largest subpopulation of enteroendocrine cells. As specialized sensory cells, EC cells sense luminal stimuli and convert them into serotonin (5-hyroxytryptamine, 5-HT) release events. However, the electrophysiology of these cells is poorly understood because they are difficult to culture and to identify. The method presented in this paper outlines primary EC cell cultures optimized for single cell electrophysiology. This protocol utilizes a transgenic cyan fluorescent protein (CFP) reporter to identify mouse EC cells in mixed primary cultures, advancing the approach to obtaining high-quality recordings of whole cell electrophysiology in voltage- and current-clamp modes.

Enterochromaffin (EC) cells comprise a small subset of gastrointestinal epithelial cells. EC cells are electrically excitable and release serotonin, yet difficulties in culturing and identifying EC cells have limited physiological studies. The method presented here establishes a primary culture model amenable to examination of single EC cells by electrophysiology.

Ganze Zelle Elektrophysiologie des primären kultivierten murinen Enterochromaffinen Zellen

Enterochromaffin (EC) cells in the gastrointestinal (GI) epithelium constitute the largest subpopulation of enteroendocrine cells. As specialized sensory ...

Snap Freezing of Muscle Tissue for Sectioning: A Protocol to Obtain Ultrathin Sections of Rapidly Frozen Murine Muscle Tissue

Source: Bonetto, A. et al. <a href="https://jove.unicartagenaproxy.elogim.com/video/54893" target="_blank">The Colon-26 Carcinoma Tumor-bearing Mouse as a Model for the Study of Cancer Cachexia.</a> J. Vis. Exp. (2016)
This video describes the procedure for snap freezing muscle tissue and obtaining its thin sections. The technique can help study cancer-related cachexia in colon cancer mouse models.

Snap Freezing von Muskelgewebe für das Schneiden: Ein Protokoll zur Gewinnung ultradünner Schnitte von schnell eingefrorenem Mausmuskelgewebe

Source: Bonetto, A. et al. The Colon-26 Carcinoma Tumor-bearing Mouse as a Model for the Study of Cancer Cachexia. J. Vis. Exp. (2016)
This video ...

JoVE Encyclopedia of Experiments

Krebsforschung

Gastrointestinal Cancer

Animal model studies

Intestinal Crypts Isolation: A Method to Isolate Whole Crypts from Small Intestine of Murine Model

Source: Schewe, M. et al. <a href="https://jove.unicartagenaproxy.elogim.com/video/56329" target="_blank">The Organoid Reconstitution Assay (ORA) for the Functional Analysis of Intestinal Stem and Niche Cells.</a> J. Vis. Exp. (2017)
In this video, we demonstrate a technique to isolate whole crypts from a mouse&#8217;s small intestine. The isolated whole crypts can be used to propagate long-lived and self-renewing 3D organoids in vitro.

Isolierung von Darmkrypten: Eine Methode zur Isolierung ganzer Krypten aus dem Dünndarm des Mausmodells

Source: Schewe, M. et al. The Organoid Reconstitution Assay (ORA) for the Functional Analysis of Intestinal Stem and Niche Cells. J. Vis. Exp. (2017)
In ...

Frozen Mouse Brain Tissue Sectioning: A Procedure to Obtain Thin Frozen Tissue Sections from Frozen Murine Brain Tissue

Source: Comba, A. et al. <a href="https://jove.unicartagenaproxy.elogim.com/v/60939/laser-capture-microdissection-glioma-subregions-for-spatial-molecular">Laser Capture Microdissection of Glioma Subregions for Spatial and Molecular Characterization of Intratumoral Heterogeneity, Oncostreams, and Invasion.</a> J. Vis. Exp. (2020)
In this video, we demonstrate the sectioning of a frozen mouse brain tumor tissue using a cryostat. The frozen brain tissue sections so obtained are stored at low temperatures until further analysis.

Schnitt von gefrorenem Maushirngewebe: Ein Verfahren zur Gewinnung dünner gefrorener Gewebeschnitte aus gefrorenem Maushirngewebe

Source: Comba, A. et al. Laser Capture Microdissection of Glioma Subregions for Spatial and Molecular Characterization of Intratumoral Heterogeneity, ...