Supported by National Institutes of Health (DK55679, and DK59888 to A.N.). Emory University&#160;Integrated Cellular Imaging Microscopy Core of the Winship Cancer&#160;Institute comprehensive cancer center grant, P30CA138292, and the Crohn's and Colitis Foundation of America Career Development award to C.T.C. and Fellowship Award to A.E.F.

ניסויים בשימוש C57BL / 6 עכברים בין 10 ל 12 שבועות של גיל. כל נהלי שימוש בבעלי חיים היו נבדקו ואושרו על ידי ועדת אמורי האוניברסיטה המוסדית טיפול בבעלי חיים והשימוש ובוצעו על פי המכון הלאומי לבריאות בקריטריונים. 1. התקנה ניסיונית <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הגדרת cryostat <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לאזן cryostat ל -20 מעלות צלזיוס, כולל להב microtome ותרמילים (זהירות קיצונית סביב הלהב!). </li><li style=";text-align:right;direction:rtl"> מלא cryomold ריק עם אוקטובר (מתחם טמפרטורה אופטימלי חיתוך) ולאזן לC -20 ° (~ 30 דקות). הסר ב- OCT הקפואה מהתבנית ולתקן אותה על צ&#39;אק עם אוקטובר הנוזלי. מניחים את הגוש / צ&#39;אק בזרוע microtome ולאפשר ב- OCT להגדיר במשך 10 דקות. </li><li style=";text-align:right;direction:rtl"> הגדר את cryostat עד 10 מיקרומטר לכל סעיף ולגלח את בלוק אוקטובר עד שהוא שטוח. חזרה זרוע microtome מהלהב בכמה סנטימטרים. בשלב זה לא להתאים את הלהב או צ&#39;אק לשארית experiment. </li></ol></li><li style=";text-align:right;direction:rtl"> הכן את סכיני גילוח: הכן 2 סכיני גילוח לדגימה. באמצעות קובץ מתכת, משעמם קצה sharped של להבים. בשלב הבא, להסיר את אוגן האלומיניום עם מלקחיים. </li><li style=";text-align:right;direction:rtl"> טרום צמרמורת צלחת פיירקס או משטח שטוח אחר על קרח יבש. </li><li style=";text-align:right;direction:rtl"> הכן צלחת לנתיחה עם 10-15 סיכות לנתיחה. 50% צלחת תרבית רקמת 10 סנטימטרים מלאים בסיליקון יספיקו. הוסף 5 מיליליטר של חיץ הנקס ב RT. </li></ol> 2. Dissection של רקמות המעי הגס דיסטלי <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> מקום עכברים בתא אטום ועכברים להרדים משאיפת isoflurane ונקע בצוואר הרחם, ולאחר מכן לרסס אתנול 70% על 12 הבטן ובית החזה. </li><li style=";text-align:right;direction:rtl"> לעשות חתך קטן בעור של הבטן עם מספריים ולאחר מכן לבצע חתך על מנת לחשוף את חלל הצפק. ניתן למצוא נהלים דומים מתואר כאן 12. </li><li style=";text-align:right;direction:rtl"> חותך את המעי גס בסף האנאלי ולהפריד לפדר עד למעי הגס ללא תשלום. </li><li style=";text-align:right;direction:rtl"> בלו מעי גס דיסטליקטע שבין 0 ל- 6 סנטימטר מהטבעת. כאן, עומק קריפטה הוא ~ 150 מיקרומטר (ראה איור 1). לחתוך את המעי הגס longitudinally באמצעות מספריים ולהסיר את תוכן הצואה. </li><li style=";text-align:right;direction:rtl"> הצמד את הרקמה לצלחת לנתיחה עם המשטח הרירי פונה כלפי מעלה. למתוח את הסיכות לנתיחה רקמות באמצעות על צלחת סיליקון במאגר הנקס ולתת מנוחה במשך 10 דקות ב RT (איור 1 ג). זה מסיר קפלים מרקמות ומאפשר שכבות השרירים להירגע. </li></ol> 3. רקמות הר על cryostat עבור חתך <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> להחליק בסכין גילוח בחלק הרצוי של רקמה ואז לשפוך את חיץ הנקס. להוסיף סכין גילוח אחר לראש, מה שהופך את כריך. חותך את קטע הרקמה ולהסיר את הסיכות. העבר את כריך סכין גילוח / רקמה לקרח יבש. לאפשר לרקמות להקפיא (5-10 דקות, 1D איור). </li><li style=";text-align:right;direction:rtl"> להרים את סכין הגילוח / כריך רקמות ולאפשר לו להתחמם מעט על ידי הנחת אצבע על BL העליוןADE (צד רירית עד. זה מכוון את הרקמה, כך ששכבות שרירים בסיסיות הם מחולק ראשונה.). הפרד את הכריך ולחתוך מסביב לקצוות של מגזר הרקמה. לחתוך קטע רקמה כ, x 1 סנטימטר על 0.5 סנטימטר. יש אזורי קצה נטייה להתכרבל, גורם לחלקים הסידוריים להכיל שכבות רקמה רבות. שים לב שנגמר חיתוך טוב יותר מאשר בחיתוך, כך לטעות בצד של זהירות. </li><li style=";text-align:right;direction:rtl"> לאפשר לרקמות לחמם עד הקרח על גבי הרקמה מתחיל להפשיר. בשלב זה לחץ במהירות ובזהירות את הרקמה לתוך בלוק אוקטובר בcryostat. </li><li style=";text-align:right;direction:rtl"> הסר את הלהב על ידי הנחת אצבע על המדגם. העברת החום תאפשר לך להסיר את הלהב מבלי לשבש את הרקמה. </li><li style=";text-align:right;direction:rtl"> מעיל הרקמה עם אוקטובר ולאזן במשך 5 דקות. חותך סעיפים 10 מיקרומטר ב( איור 1E, F). ראייה לבדוק את החלקים עד מאורות נראים. סעיפי מקום בצינורות 1.5 מיליליטר או בשקופיות. </li><li style=";text-align:right;direction:rtl"> לניתוח של mRNA או חלבון, לא מקוםהוא דגימות בצינורות עם 5 קריפטה-בסיס, 5 מעבר, וסעיפי 5 לכל צינור פני השטח. לאוסף RNA להוסיף 1 מיליליטר מגיב בידוד מסחרי ולדגור על RT במשך 10 דקות. לבצע טיהור RNA על פי הוראות יצרן. השתמש 5-10 מיקרוגרם של רנ&quot;א הכל לדור cDNA. </li><li style=";text-align:right;direction:rtl"> לטיהור חלבונים, להוסיף 0.5 מיליליטר של Ripa הקר תמוגה חיץ (בתוספת מעכבי פרוטאז) לכל 5 חלקים. Sonicate 3 פעמים במחזור של 70%, על קרח. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> להוסיף דגימות למאגר SDS טעינת עמוד (חיץ Laemmli) ולדגור על 100 מעלות צלזיוס במשך 10 דקות. דגימות בכפוף לעמוד SDS והעברה, ואז לחסום ב5% חלב / PBS עבור שעה 2. ביצוע ניתוח מערבי כתם ואחריו דגירה עם נוגדני KLF4 (1: 500) O / N ב 4 מעלות צלזיוס. </li></ol></li></ol>

<ol>
	<li>Noah, T. K., Donahue, B., Shroyer, N. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intestinal+development+and+differentiation.">Intestinal development and differentiation.</a> Exp Cell Res. 317, 2702-2710 (2011).</li><li>Humphries, A., Wright, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colonic+crypt+organization+and+tumorigenesis.">Colonic crypt organization and tumorigenesis.</a> Nat Rev Cancer. 8, 415-424 (2008).</li><li>Weber, C. R., Turner, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inflammatory+bowel+disease:+is+it+really+just+another+break+in+the+wall.">Inflammatory bowel disease: is it really just another break in the wall.</a> Gut. 56, 6-8 (2007).</li><li>Bjerknes, M., Cheng, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methods+for+the+isolation+of+intact+epithelium+from+the+mouse+intestine.">Methods for the isolation of intact epithelium from the mouse intestine.</a> Anat Rec. 199, 565-574 (1981).</li><li>Sato, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+Lgr5+stem+cells+build+crypt-villus+structures+in+vitro+without+a+mesenchymal+niche.">Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche.</a> Nature. 459, 262-265 (2009).</li><li>Rand, M. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calcium+depletion+dissociates+and+activates+heterodimeric+notch+receptors.">Calcium depletion dissociates and activates heterodimeric notch receptors.</a> Mol Cell Biol. 20, 1825-1835 (2000).</li><li>Gjorevski, N., Boghaert, E., Nelson, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+Epithelial-Mesenchymal+Transition+by+Transmission+of+Mechanical+Stress+through+Epithelial+Tissues.">Regulation of Epithelial-Mesenchymal Transition by Transmission of Mechanical Stress through Epithelial Tissues.</a> Cancer Microenviron. 5, 29-38 (2012).</li><li>Lechner, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression+pattern+of+laser+microdissected+colonic+crypts+of+adenomas+with+low+grade+dysplasia.">Gene expression pattern of laser microdissected colonic crypts of adenomas with low grade dysplasia.</a> Gut. 52, 1148-1153 (2003).</li><li>Reizel, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colon+stem+cell+and+crypt+dynamics+exposed+by+cell+lineage+reconstruction.">Colon stem cell and crypt dynamics exposed by cell lineage reconstruction.</a> PLoS Genet. 7, e1002192 (2011).</li><li>Kosinski, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression+patterns+of+human+colon+tops+and+basal+crypts+and+BMP+antagonists+as+intestinal+stem+cell+niche+factors.">Gene expression patterns of human colon tops and basal crypts and BMP antagonists as intestinal stem cell niche factors.</a> Proc Natl Acad Sci U S A. 104, 15418-15423 (2007).</li><li>Tamura, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pit+pattern+and+three-dimensional+configuration+of+isolated+crypts+from+the+patients+with+colorectal+neoplasm.">Pit pattern and three-dimensional configuration of isolated crypts from the patients with colorectal neoplasm.</a> J Gastroenterol. 37, 798-806 (2002).</li><li>Geem, D., Medina-Contreras, O., Kim, W., Huang, C. S., Denning, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+dendritic+cells+and+macrophages+from+the+mouse+intestine.">Isolation and characterization of dendritic cells and macrophages from the mouse intestine.</a> Journal of visualized experiments : JoVE. , e4040 (2012).</li><li>Laukoetter, M. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=JAM-A+regulates+permeability+and+inflammation+in+the+intestine+in+vivo.">JAM-A regulates permeability and inflammation in the intestine in vivo.</a> J Exp Med. 204, 3067-3076 (2007).</li><li>Neumann, P. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gut+commensal+bacteria+and+regional+Wnt+gene+expression+in+the+proximal+versus+distal+colon.">Gut commensal bacteria and regional Wnt gene expression in the proximal versus distal colon.</a> Am J Pathol. 184, 592-599 (2014).</li><li>Capaldo, C. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proinflammatory+cytokine-induced+tight+junction+remodeling+through+dynamic+self-assembly+of+claudins.">Proinflammatory cytokine-induced tight junction remodeling through dynamic self-assembly of claudins.</a> Mol Biol Cell. 25, 2710-2719 (2014).</li><li>Wells, J. M., Spence, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=How+to+make+an+intestine.">How to make an intestine.</a> Development. 141, 752-760 (2014).</li></ol>

The authors have nothing to disclose

המנגנונים המולקולריים המעורבים בהפצה הגס אפיתל תאים והתמיינות הם הבינו היטב. זה כולל פערים בהבנה של סביבת האיתות התאית של התא בתאי גזע בבסיס מאורות אפיתל במעי הגס שלנו. יש גם עניין גובר בתהליכים שבבסיס בידול האנתרוציט. לדוגמא, עלה הבנה של הבידול בvivo נדרשת כאמת מידה למחקרים שמטרתם לייצר במבחנה מערכות מעיים עיקריות 16. ההליך שלעיל כולל מספר צעדים שדורשים תשומת לב נוספת. ראשית, הסרת הקצוות סביב קטע הרקמה הקפוא (כאמור בסעיף 3.2) נדרש כקצות רקמת התלתל במהלך נתיחה והקפאה. כישלון להעביר תוצאות קצוות אלה הוא אוכלוסייה מעורבת של תאי שטח ובסיס קריפטה. ההרכבה הרקמה באוקטובר לחסום מראש צונן, מפולס היא גם חיונית. Tהפרוטוקול שלו יכול להיות מותאם לאזורים אחרים של מעי גס דיסטלי על ידי שינוי מספר הסעיפים בכל בריכה. לדוגמא, כפי שמוצג באיור 1, אורך קריפטה רירית משתנה בין 150-300 מיקרומטר. לכן, כאשר לומדים את האזור שבין 4 ס&quot;מ 6 סנטימטר מפי הטבעת, מספר סעיפים צריך להיות מוגבר בין 15 ל 30. חשוב לציין, פרוטוקול זה לא מומלץ למעי הגס הפרוקסימלי (7 ס&quot;מ 9 סנטימטרים) בשל קפלים ( plicae obliquae) המשתרעת לתוך הלום שהופך אותו בלתי אפשרי לתאי שטח וקריפטה-בסיס נפרדים על ידי חתך סדרתי. טכניקות חתך סידוריים שימשו ללמוד קריפטה-בסיס ומשטח אוכלוסיות תאי אפיתל בבני אדם. עם זאת, הפרוטוקול שלנו מוסיף צעדים נוספים הנדרשים בשל גודלו הקטן של רקמה עכברית. אנו מציעים כי בפרוטוקול לעיל יאפשר לחקירת קריפטה-בסיס ואוכלוסיית תאי אפיתל פני השטח במערכות עכבר גנטי צייתנית. ואכן, חלקים נקוו yieחלבון LD באיכות גבוהה וניתוח במורד הזרם המתאים RNA. יישומים עתידיים יכולים לכלול המחקר של מסלולי איתות תא או immunoprecipitation הכרומטין. עם זאת, יש לציין כי, כמו כמה מהשיטות חלופיות שתוארו לעיל, וכתוצאה מכך החלקים מכילים תערובת של תאי אפיתל propria lamina וביניים. לסיכום, הפרוטוקול המתואר כאן מספק שיטה מהירה, תשואה גבוהה לניתוח תהליכים מולקולריים באזורים במרחב המובהקים של רירית המעי עכברית.

בטנת אפיתל במעי הגס היא רקמת משובי מאוד, עם תאי גזע תושב חידוש הרקמות כל כמה ימים 1. תהליך זה של התחדשות דורש התחזוקה של תא בתאי גזע שגשוג. במשך זמן, תאי בת פיק החדש יאבדו פוטנציאל השגשוג ונודדים לעבר פני השטח luminal של המעי. ביחד עם הגירה, ותאים להתמיין enterocytes יוצרי מחסום בוגר או תאי גביע ייצור ריר. כישלון של תכנית בידול זה חשב לתרום להתפשר מחסום האפיתל כגון נצפה במחלת מעי דלקתית וסרטן מעי גס 2,3. מחקר מפורט של התהליכים לעיל דורש מתודולוגיות לבידוד אוכלוסיות קריפטה-בסיס ותאי שטח. מספר שיטות קיימות, כל אחד עם יתרונות וחסרונות ייחודיים. שיטות קיימים לבידוד של תאי אפיתל במעי כוללות פרקסוכנים, מרומם רוח וניתוק מכאני, וכתוצאה מכך הבידוד של מאורות כל, גיליונות אפיתל, או תאים בודדים, תלויים ב4,5 תנאי ניסוי. אלה הם שיטות תשואה גבוהות, אך שינויים באיתות אינטר כבר דיווחו בתנאים אלה שלא יכולים לייצג את הסביבה המקומית 6,7. microdissection ללכוד לייזר מאפשר לאיסוף חומר שונה במרחב, אבל משיג תשואת 8,9 מולקולרי נמוכה. ברקמת מעי הגס אנושית, שיטות cryosectioning אופקיים סידוריים פותחו 10. עם זאת, רקמות הריריות עכברית הן להחריד קטנות לניכוס ישיר של טכניקה זו. בבני אדם, באורכי קריפטה מעיים (הרחוקים בין הכוך-הבסיס ותאי שטח) במעי הגס נע בין 100-1,000 ~ מיקרומטר 11. בעכברים, אורכי קריפטה הם בין 50-300 ~ מיקרומטר (ראו איור 1 א). הגודל הקטן של מאורות עכברי מציב אתגר לIsolation של שתי אוכלוסיות תאים אלה תוך שימוש בפרוטוקולים קיימים. עכשיו אנו מתארים בעלות נמוכה, שיטת תשואה גבוהה לבידוד של קריפטה-בסיס ומשטח אוכלוסיית תאי אפיתל במעי הגס רקמה עכברית. רקמה שנקטפו באופן זה עשויה אז להיות מנותח על ידי מספר היישומים במורד הזרם סטנדרטיים, כוללים מכתים immunofluorescence, RT-PCR (תגובת שרשרת זמן-פולימראז ריאל) או מערבי סופג.

<table><tbody><tr><td>Microtome</td><td>Leica Biosystems, Nussloch Germany</td><td>CM 1510-3</td><td></td></tr><tr><td>MyiQ real time PCR detector</td><td>BioRad</td><td></td><td></td></tr><tr><td>LSM 510&amp;nbsp;</td><td>Carl Zeiss</td><td></td><td>Confocal microscope</td></tr><tr><td>OCT</td><td>Tissue-Tek, Sakura Finetek, Torrance CA</td><td>4583</td><td></td></tr><tr><td>cryo-mold</td><td>Tissue-Tek, Sakura Finetek, Torrance CA</td><td>4557</td><td>25mmx20mmx5mm</td></tr><tr><td>High profile microtome blade</td><td>Leica Biosystems, Nussloch germany</td><td>818</td><td></td></tr><tr><td>GEM industrial blades</td><td>American Safety Razor Blades</td><td>62-0314</td><td></td></tr><tr><td>Sylgard silicon elastomere base</td><td>Dow Corning, Midland MI</td><td>3097358</td><td></td></tr><tr><td>27 1/2 g needle</td><td>Becton-Dickinson, Franklin Lakes, NJ</td><td>305109</td><td>pins for dissection</td></tr><tr><td>TRizol</td><td>Life Technologies</td><td>15596018</td><td></td></tr><tr><td>Rneasy</td><td>Qiagen</td><td>74104</td><td></td></tr><tr><td>DNAse</td><td>Qiagen</td><td>79254</td><td></td></tr><tr><td>Antibody ZO-1</td><td>Invitrogen&amp;nbsp;</td><td>187430</td><td></td></tr><tr><td>Antibody KLF4</td><td>Cell Signaling</td><td>4038S</td><td></td></tr><tr><td>Antibody mGAPDH</td><td>Sigma</td><td>G8795</td><td></td></tr><tr><td>Antibody Secondary Alexa conjugate</td><td>Invitrogen</td><td>A11034</td><td>488 anti-rabbit</td></tr><tr><td>Antibody Secondary HRP conjugate</td><td>Jackson</td><td>111/115-001-003</td><td>rabbit/mouse&amp;nbsp;</td></tr><tr><td>Topro-3</td><td>Invitrogen</td><td>T3605</td><td></td></tr><tr><td>HANKs balanced salt buffer</td><td>Life Technologies</td><td>14025092</td><td></td></tr><tr><td>RIPA lysis buffer</td><td></td><td></td><td>50mM Tris-HCl pH 7.4 150mM NaCl 1% NP40 0.25% Na-deoxycholate</td></tr><tr><td>primer TBP 3&#039;</td><td></td><td></td><td>GGAATTGTACCGCAGCTTCAAA</td></tr><tr><td>primer TBP 5&#039;</td><td></td><td></td><td>GATGACTGCAGCAAATCGCTT</td></tr><tr><td>primer KLF4 3&#039;</td><td></td><td></td><td>TGTGACTATGCAGGCTGTGGCAAA</td></tr><tr><td>primer KLF4 5&#039;</td><td></td><td></td><td>ACAGTGGTAAGGTTTCTCGCCTGT</td></tr></tbody></table>

cryosectioning method for microdissection of murine colonic mucosa

The colonic mucosal tissue provides a vital barrier to luminal antigens. This barrier is composed of a monolayer of simple columnar epithelial cells. The colonic epithelium is dynamically turned over and epithelial cells are generated in the stem cell containing crypts of Lieberk&#252;hn. Progenitor cells produced in the crypt-bases migrate toward the luminal surface, undergoing a process of cellular differentiation before being shed into the gut lumen. In order to study these processes at the molecular level, we have developed a simple method for the microdissection of two spatially distinct regions of the colonic mucosa; the proliferative crypt zone, and the differentiated surface epithelial cells. Our objective is to isolate specific crypt and surface epithelial cell populations from mouse colonic mucosa for the isolation of RNA and protein.

קטעי רקמת מעי הגס עובדו להערכה היסטולוגית ו- H &amp; E מכתים 13. צפה בחתך מסורתי של הרירית נראה באיור 2 א. אזורים בסל מכילים פנימית וחיצוני muscularis, מורכב בעיקר מmuscularis המעגלי. ימשיך לכיוון הלום, רירית muscularis ניכרה בסמוך לתאי האפיתל קריפטה-בסיס, תאי מעבר נמצאים באמצע של הרקמה, ובסופו אוכלוסיות תאי שטח, להתמודד לומן המעי. שיטת חתך הסידורי המתוארת כאן שומרת על נטייה כזו שmuscularis האורך והחוזר נתקל לראשונה (איור 2), ואחריו את רירית muscularis (איור 2 ג). שים לב למראה של תאי ביניים שאינם שריר בחלק השמאלי העליונה של התמונה. לניתוח במורד הזרם מתואר להלן, סעיפי שריר מבוטלים. הסעיפים הבאים מכילים תאי אפיתל ורקמת ביניים (propria lamina), החל בתאי קריפטה-הבסיס (איור 2 ד). שים לב להעדרו של לומן מרכזי ברוב מאורות, המופיעים כהה יותר בשל הגרעינים הצפופים. שכבות אלה מכילים תא השגשוג. תאי המעבר מופיעים כצפופים בלוטות עם לומן בולט מרכזי (2E איור). לבסוף, יש לי אוכלוסיות תאי שטח מבנה לא סדיר, עם אזורים של monolayer אפיתל נצפה en פנים (איור 2F). סעיפים סידוריים כפי שתואר לעיל עשויים גם להיות מעובד לתיוג immunofluorescence ומיקרוסקופיה confocal (כפי שמתוארים כאן 14). איור 2G תערוכות מאורות מבודדים הקבועים וpermeabilized במתנול 100% ולאחר מכן מוכתמים לגרעינים (כחול) וחלבון צומת תאי תאי Zonula Occludens 1 (הסתדרות ציונית-1, ירוקה). בכיוון חתך המסורתי, תא קריפטה ומשטח ניתן לצפות בו זמנית (איור 2G </stronז&gt;). שים לב שקווי כתם junctional ZO-1 לומן של קריפטה המעי הגס. בטנת Z0-1 זה של לומן גם ניתן לראות בדוגמאות מחולקים סידוריים של אוכלוסיות תאי מעבר, במרכז של הבלוטות עגולות (איור 2G). כתם ZO-1 משופר נראה באוכלוסיות תאי שטח (איור ט 2 וי). גורמי בידול כמה ידועים להתבטא באופנת spatiotemporal לאורך ציר קריפטה-קרקע. זה כולל את הגורם כמו-Kruppel גורם שעתוק 4 (KLF4), אשר ידוע להיות מועשרים באוכלוסיות תאי שטח. שימוש בשיטות מסורתיות חתך, KLF4 נמצא בגרעינים של לומן מול אוכלוסיות תאי שטח (איור 2K). לפיכך, אנו מעריכים כי KLF4 mRNA יתבטא בעיקר באוכלוסיות תאי שטח. כדי לבדוק זאת, סעיפים סידוריים נאספו וקובצו לדגימות פני השטח, וכוך-בסיס מעבר. Subsequently, RNA היה לקצור באמצעות מיצוי Trizol סטנדרטי, עם טיהור נוספת על ידי טור RNeasy וטיפול DNAse. RNA נאסף מסעיפים 5 רצופים ונקווה, שהניבו בין 5-10 מיקרוגרם של RNA הכולל לדגימה. דגימות אלה אז היו נתונים בזמן אמת חצי כמותית PCR לשני KLF4 וגן התייחסות, חלבון TATA תיבה מחייבת 1 (TBP-1) (איור 2L) 14. כפי שניתן לראות באיור 2L, לאחר הנורמליזציה לTBP-1, תאי שטח נמצאו להביע עד 8 ​​פעמים mRNA KLF4 שבאו לידי ביטוי בתאי קריפטה. כמו כן, רמות חלבון KLF4 נמצאו להציג רגולציה המרחבי לאורך ציר קריפטה-פני השטח. סעיפים סידוריים היו נקווים כמתואר לעיל ולאחר מכן מודגרות במאגר תמוגה במשך 20 דקות ב 4 מעלות צלזיוס. זה הניב בין 200-250 מיקרוגרם של חלבון לכל מדגם. דוגמאות אז היו נתונים ניתוח על ידי SDS-עמוד (איור 2M) 15. כפי שניתן לראות באיור 2M, עמ &#39;KLF4רמות rotein הן דרמטית גבוהות יותר באוכלוסיות תאי שטח. הממצאים לעיל מדגימים את היכולת של פרוטוקול זה לבודד את הכמויות גדולות של פני השטח ותאי אפיתל קריפטה מרירית המעי עכברית. <img alt="איור 1" src="/files/ftp_upload/53112/53112fig1.jpg" /> איור 1: (א) רירית מראה סכמטי עכברית מעי הגס ושכבות שרירים חיצוניות. השיטה שלנו שואפת לאסוף אוכלוסיות תאי תא השטח וקריפטה-בסיס דיסקרטיים על ידי cryosectioning הסידורי (10 מיקרומטר כל אחד). שכבות השרירים חיצוניות מבוטלים. גובה (B) קריפטה משתנה לאורכו של המעי הגס (מרחק בין שכבות קריפטה-בסיס ומשטח). נקודות הנתונים מצביעות על מדידות קריפטה בודדות וסימנים מצביעים על משכפל ביולוגי (n = 4). מגזרים (C) קולון נאספו, נחצה, והצמידו על צלחת סיליקון לנתח. רקמה (ד) segment כ 3 סנטימטר מהטבעת נלחץ בין לסכיני גילוח וקפוא בקרח יבש. רקמות (E) אז רכובים על בלוק אוקטובר-מפולס מראש. (F) cryosections יוסרו ובחינה חזותית. <img alt="איור 2" src="/files/ftp_upload/53112/53112fig2.jpg" /> איור 2:. נציגי נתונים () רקמת המעי הגס מוכתמת Hematoxylin-Eosin בחתך מראה את muscularis העגול (סנטימטר), רירית muscularis (מ&quot;מ), תאי קריפטה-בסיס, תאי מעבר, ותאי שטח. (ב - ג) שכבות שרירים מעי הגס. (ד) תאי קריפטה-בסיס. שים לב להעדרו של לומן מרכזי. (ה) תאים מעבר. (F) תאי שטח. הכתמה (G) Immunofluorescence של מאורות מעי הגס מבודדים. ZO-1 (ירוק) וגרעינים (כחולים) הם נצפו בחתך. (HI) ZO-1 וצביעה בגרעין תאי מעבר ומשטח. תצוגה מוגדלת של מכתים ZO-1 (J). (K) KLF4 (ירוק) מועשר באוכלוסיות תאי שטח. בזמן אמת הערכת PCR של רמות KLF4 mRNA בין שלושה התאים (L). ניתוח כתם מערבי של רמות חלבון KLF4 באוכלוסיות תאים אלה (M).

Watch this Scientific Journal Video about Cryosectioning Method for Microdissection of Murine Colonic Mucosa at JoVE.com

Cryosectioning Method for Microdissection of Murine Colonic Mucosa

Here we describe a simple method for the isolation of spatially distinct murine colonic epithelial surface cells from the underlying crypt-base cells.

Cryosectioning שיטה לMicrodissection של Murine גס רירית

The colonic mucosal tissue provides a vital barrier to luminal antigens. This barrier is composed of a monolayer of simple columnar epithelial cells. The ...

cryosectioning-method-for-microdissection-of-murine-colonic-mucosa

Universidad de Cartagena UDEC

Research

JoVE Journal

Biology

17.3K Views.  Emory University, Atlanta, Georgia. Here we describe a simple method for the isolation of spatially distinct murine colonic epithelial surface cells from the underlying crypt-base cells.

Video: Cryosectioning Method for Microdissection of Murine Colonic Mucosa

Isolating And Immunostaining Lymphocytes and Dendritic Cells from Murine Peyer's Patches

Peyer's patches (PPs) are integral components of the gut-associated lymphoid tissues (GALT) and play a central role in intestinal immunosurveillance and homeostasis. Particulate antigens and microbes in the intestinal lumen are continuously sampled by PP M cells in the follicle-associated epithelium (FAE) and transported to an underlying network of dendritic cells (DCs), macrophages, and lymphocytes. In this article, we describe protocols in which murine PPs are (i) dissociated into single cell suspensions and subjected to flow cytometry and (ii) prepared for cryosectioning and immunostaining. For flow cytometry, PPs are mechanically dissociated and then filtered through 70 &mu;m membranes to generate single cell suspensions free of epithelial cells and large debris. Starting with 20-25 PPs (from four mice), this quick and reproducible method yields a population of &gt;2.5 x 106 cells with &gt;90% cell viability. For cryosectioning, freshly isolated PPs are immersed in Optimal Cutting Temperature (OCT) medium, snap-frozen in liquid nitrogen, and then sectioned using a cryomicrotome. Tissue sections (5-12 &mu;m) are air-dried, fixed with acetone or methanol, and then subjected to immunolabeling.

There is an increasing interest in understanding the immunological functions of specific subpopulations of cells in Peyer's patches (PPs), the primary inductive sites of gut-associated lymphoid tissues. Here we outline parallel protocols for preparing PP single cell preparations for flow cytometric analysis and PP cryosections for immunostaining.

וגם בידוד Immunostaining ימפוציטים ותאי דנדריטים מהתיקונים של Peyer Murine

Peyer's  patches (PPs) are integral components of the gut-associated lymphoid tissues  (GALT) and play a central role in intestinal immunosurveillance and ...

Immunology and Infection

Using Robotic Systems to Process and Embed Colonic Murine Samples for Histological Analyses

The understanding of human diseases has been greatly expanded thanks to the study of animal models. Nonetheless, histopathological evaluation of experimental models needs to be as rigorous as that applied for human samples. Indeed, drawing reliable and accurate conclusions is critically influenced by the quality of tissue section preparation. Here, we describe a protocol for histopathological analysis of murine tissues that implements several automated steps during the procedure, from the initial preparation to the paraffin embedding of the murine samples. The reduction of methodological variables through rigorous protocol standardization from automated procedures contributes to increased overall reliability of murine pathological analysis. Specifically, this protocol describes the utilization of automated processing and embedding robotic systems, routinely used for the tissue processing and paraffin embedding of human samples, to process murine specimens of intestinal inflammation. We conclude that the reliability of histopathological examination of murine tissues is significantly increased upon introduction of standardized and automated techniques.

Lack of standardization for murine tissue processing reduces the quality of murine histopathological analysis as compared to human specimens. Here, we present a protocol to perform histopathological examination of murine inflamed and uninflamed colonic tissues to show the feasibility of robotic systems routinely used for processing and embedding&#160;human samples.

באמצעות מערכות רובוטיות כדי לעבד ולהטביע דגימות מאתר חוקן עבור ניתוחים היסטולוגית

The understanding of human diseases has been greatly expanded thanks to the study of animal models. Nonetheless, histopathological evaluation of ...

Optimization of Laser-Capture Microdissection for the Isolation of Enteric Ganglia from Fresh-Frozen Human Tissue

The purpose of this method is to obtain high-integrity RNA samples from enteric ganglia collected from unfixed, freshly-resected human intestinal tissue using laser capture microdissection (LCM). We have identified five steps in the workflow that are crucial for obtaining RNA isolates from enteric ganglia with sufficiently high quality and quantity for RNA-seq. First, when preparing intestinal tissue, each sample must have all excess liquid removed by blotting prior to flattening the serosa as much as possible across the bottom of large base molds. Samples are then quickly frozen atop a slurry of dry ice and 2-methylbutane. Second, when sectioning the tissue, it is important to position cryomolds so that intestinal sections parallel the full plane of the myenteric plexus, thereby yielding the greatest surface area of enteric ganglia per slide. Third, during LCM, polyethylene napthalate (PEN)-membrane slides offer the greatest speed and flexibility in outlining the non-uniform shapes of enteric ganglia when collecting enteric ganglia. Fourth, for distinct visualization of enteric ganglia within sections, ethanol-compatible dyes, like Cresyl Violet, offer excellent preservation of RNA integrity relative to aqueous dyes. Finally, for the extraction of RNA from captured ganglia, we observed differences between commercial RNA extraction kits that yielded superior RNA quantity and quality, while eliminating DNA contamination. Optimization of these factors in the current protocol greatly accelerates the workflow and yields enteric ganglia samples with exceptional RNA quality and quantity.

The goal of this protocol is to obtain high-integrity RNA samples from enteric ganglia isolated from unfixed, freshly-resected human intestinal tissue using laser capture microdissection (LCM). This protocol involves preparing flash-frozen samples of human intestinal tissue, cryosectioning, ethanolic staining and dehydration, LCM, and RNA extraction.

אופטימיזציה של לכידת לייזר Microdissection עבור בידודו של הגרעינים המעית מרקמות אנושיות מוקפאות

The purpose of this method is to obtain high-integrity RNA samples from enteric ganglia collected from unfixed, freshly-resected human intestinal tissue ...

Neuroscience

Performing Colonoscopic-Guided Pinch Biopsies in Mice and Evaluating Subsequent Tissue Changes

Understanding the tissue and cellular changes that occur in the acute injury response as well as during the wound healing process is of paramount importance when studying diseases of the gastrointestinal (GI) tract. The murine colonic pinch biopsy model is a useful tool to define these processes. Additionally, the interplay between gut luminal content (e.g., microbes) and the colon can be studied. However, wound induction and the ability to track wound closure over time in a reliable manner can be challenging. Moreover, tissue preparation and orientation must be carried out in a standardized way to optimally interrogate histologic and molecular changes. Here, we present a detailed method describing biopsy-induced injury and the monitoring of wound closure through repeat colonoscopies. An approach is described that ensures consistent and reproducible measurements of wound size, the ability to collect the wound bed for molecular analyses as well as visualize the wound bed upon sectioning of tissues. The ability to successfully carry out these techniques allows for studies of the acute injury response, wound healing and luminal-host interactions within the colon.

Here, we provide a detailed description of the procedure to induce colonoscopic-guided pinch biopsies in mice and track wound closure in real time. Additionally, methods for the preparation of tissues for histological, immunohistochemical and molecular analyses of the wound bed are provided.

ביצוע ביופסיות צביטה קולונוסקופיות מונחות בעכברים והערכת שינויים ברקמות הבאים

Understanding the tissue and cellular changes that occur in the acute injury response as well as during the wound healing process is of paramount ...

Isolation of Primary Myofibroblasts from Mouse and Human Colon Tissue

The myofibroblast is a stromal cell of the gastrointestinal (GI) tract that has been gaining considerable attention for its critical role in many GI functions. While several myofibroblast cell lines are commercially available to study these cells in vitro, research results from a cell line exposed to experimental cell culture conditions have inherent limitations due to the overly reductionist nature of the work. Use of primary myofibroblasts offers a great advantage in terms of confirming experimental findings identified in a cell line. Isolation of primary myofibroblasts from an animal model allows for the study of myofibroblasts under conditions that more closely mimic the disease state being studied. Isolation of primary myofibroblasts from human colon tissue provides arguably the most relevant experimental data, since the cells come directly from patients with the underlying disease. We describe a well-established technique that can be utilized to isolate primary myofibroblasts from both mouse and human colon tissue. These isolated cells have been characterized to be alpha-smooth muscle actin and vimentin-positive, and desmin-negative, consistent with subepithelial intestinal myofibroblasts. Primary myofibroblast cells can be grown in cell culture and used for experimental purposes over a limited number of passages.

The myofibroblast is an influential stromal cell of the gastrointestinal tract that regulates important physiologic processes in both normal and disease states. We describe a technique that allows for the isolation of primary myofibroblasts from both mouse and human colon tissue, which can be utilized for in vitro experimentation.

בידוד של ראשוני myofibroblasts מעכבר ורקמות מעי גס אנושיים

The myofibroblast is  a stromal cell of the gastrointestinal (GI) tract that has been gaining  considerable attention for its critical role in many GI ...

Cryosectioning of Contiguous Regions of a Single Mouse Skeletal Muscle for Gene Expression and Histological Analyses

With this method, consecutive cryosections are collected to enable both microscopy applications for tissue histology and enrichment of RNA for gene expression using adjacent regions from a single mouse skeletal muscle. Typically, it is challenging to achieve adequate homogenization of small skeletal muscle samples because buffer volumes may be too low for efficient grinding applications, yet without sufficient mechanical disruption, the dense tissue architecture of muscle limits penetration of buffer reagents, ultimately causing low RNA yield. By following the protocol reported here, 30 &#956;m sections are collected and pooled allowing cryosectioning and subsequent needle homogenization to mechanically disrupt the muscle, increasing the surface area exposed for buffer penetration. The primary limitations of the technique are that it requires a cryostat, and it is relatively low throughput. However, high-quality RNA can be obtained from small samples of pooled muscle cryosections, making this method accessible for many different skeletal muscles and other tissues. Furthermore, this technique enables matched analyses (e.g., tissue histopathology and gene expression) from adjacent regions of a single skeletal muscle so that measurements can be directly compared across applications to reduce experimental uncertainty and to reduce replicative animal experiments necessary to source a small tissue for multiple applications.

Consecutive cryo-sections are collected to enable histological applications and enrichment of RNA for gene expression measurements using adjacent regions from a single mouse skeletal muscle. High-quality RNA is obtained from 20 - 30 mg of pooled cryosections and measurements are directly compared across applications.

Cryosectioning של רציף אזורים של שרירי שלד עכבר אחת על ביטוי גנים ועל ניתוח היסטולוגית

With this method, consecutive cryosections are collected to enable both microscopy applications for tissue histology and enrichment of RNA for gene ...

Whole Cell Electrophysiology of Primary Cultured Murine Enterochromaffin Cells

Enterochromaffin (EC) cells in the gastrointestinal (GI) epithelium constitute the largest subpopulation of enteroendocrine cells. As specialized sensory cells, EC cells sense luminal stimuli and convert them into serotonin (5-hyroxytryptamine, 5-HT) release events. However, the electrophysiology of these cells is poorly understood because they are difficult to culture and to identify. The method presented in this paper outlines primary EC cell cultures optimized for single cell electrophysiology. This protocol utilizes a transgenic cyan fluorescent protein (CFP) reporter to identify mouse EC cells in mixed primary cultures, advancing the approach to obtaining high-quality recordings of whole cell electrophysiology in voltage- and current-clamp modes.

Enterochromaffin (EC) cells comprise a small subset of gastrointestinal epithelial cells. EC cells are electrically excitable and release serotonin, yet difficulties in culturing and identifying EC cells have limited physiological studies. The method presented here establishes a primary culture model amenable to examination of single EC cells by electrophysiology.

אלקטרופיזיולוגיה התא כולו של ראשי Enterochromaffin מאתר בתרבית תאים

Enterochromaffin (EC) cells in the gastrointestinal (GI) epithelium constitute the largest subpopulation of enteroendocrine cells. As specialized sensory ...

Snap Freezing of Muscle Tissue for Sectioning: A Protocol to Obtain Ultrathin Sections of Rapidly Frozen Murine Muscle Tissue

Source: Bonetto, A. et al. <a href="https://jove.unicartagenaproxy.elogim.com/video/54893" target="_blank">The Colon-26 Carcinoma Tumor-bearing Mouse as a Model for the Study of Cancer Cachexia.</a> J. Vis. Exp. (2016)
This video describes the procedure for snap freezing muscle tissue and obtaining its thin sections. The technique can help study cancer-related cachexia in colon cancer mouse models.

הקפאה מהירה של רקמת שריר לצורך חיתוך: פרוטוקול להשגת מקטעים דקים במיוחד של רקמת שריר מורין שהוקפאה במהירות

Source: Bonetto, A. et al. The Colon-26 Carcinoma Tumor-bearing Mouse as a Model for the Study of Cancer Cachexia. J. Vis. Exp. (2016)
This video ...

JoVE Encyclopedia of Experiments

Cancer Research

Gastrointestinal Cancer

Animal model studies

Intestinal Crypts Isolation: A Method to Isolate Whole Crypts from Small Intestine of Murine Model

Source: Schewe, M. et al. <a href="https://jove.unicartagenaproxy.elogim.com/video/56329" target="_blank">The Organoid Reconstitution Assay (ORA) for the Functional Analysis of Intestinal Stem and Niche Cells.</a> J. Vis. Exp. (2017)
In this video, we demonstrate a technique to isolate whole crypts from a mouse&#8217;s small intestine. The isolated whole crypts can be used to propagate long-lived and self-renewing 3D organoids in vitro.

בידוד קריפטים במעי: שיטה לבידוד קריפטות שלמות ממודל המעי הדק של מורין

Source: Schewe, M. et al. The Organoid Reconstitution Assay (ORA) for the Functional Analysis of Intestinal Stem and Niche Cells. J. Vis. Exp. (2017)
In ...

Frozen Mouse Brain Tissue Sectioning: A Procedure to Obtain Thin Frozen Tissue Sections from Frozen Murine Brain Tissue

Source: Comba, A. et al. <a href="https://jove.unicartagenaproxy.elogim.com/v/60939/laser-capture-microdissection-glioma-subregions-for-spatial-molecular">Laser Capture Microdissection of Glioma Subregions for Spatial and Molecular Characterization of Intratumoral Heterogeneity, Oncostreams, and Invasion.</a> J. Vis. Exp. (2020)
In this video, we demonstrate the sectioning of a frozen mouse brain tumor tissue using a cryostat. The frozen brain tissue sections so obtained are stored at low temperatures until further analysis.

חתך רקמת מוח של עכבר קפוא: הליך להשגת קטעי רקמה קפואה דקה מרקמת מוח מורין קפואה

Source: Comba, A. et al. Laser Capture Microdissection of Glioma Subregions for Spatial and Molecular Characterization of Intratumoral Heterogeneity, ...