Biz eleştirel yazının okunması için James Waters, Gable Wadsworth&#39;u ve Bo Broadwater teşekkür ederim. Biz de yararlı yorumlar sağlamak için dört anonim yorumcular teşekkür ederim. Biz Georgia Teknoloji Enstitüsü, Bilimsel Arakesitte Burroughs Wellcome Fonu Kariyer Ödülü ve Yaşam Sistemleri NSF Fizik gelen öğrenci araştırma ağı hibe mali destek kabul.

1. DsDNA Numune Hazırlama <ol><li> 10-mer dizisini tekrarlayarak küresel kavisli DNA&#39;lar tasarlayın. Örneğin, 5&#39;-GTGCCAGCAACAGATAGC - (TTTATCATCCTTTATCATCC X) 7 - TTTCATTCGAGCTCGTTGTTG-3 &#39;, bir 186-bp X kavisli rastgele bir ilave baz DNA ve tekrar 10-mer dizisini kuşatan sekans adaptör dizileri olmasıdır. Not:. Bu örnekte Kaplan ve arkadaşları tarafından, büyük ölçekli nükleozom doluluk çalışmaya dayanarak nükleozom oluşumuna karşı tercihler iki 10-mer 15 seçilmiştir. DsDNA sarmal tekrar 10 bp yakın olduğu için, 10-mer sarmal eksen herhangi bir net saptırma dairesel bir yay (Şekil 3A) gibi bir şekil üretilmesi için birikecektir. Sarmal süresi 10.5 bp yakın olduğundan, ekstra bir baz olabildiğince düzlemsel olarak kavisli yapısını korumak için her iki tekrarlar sonra eklenir. 200 bp daha kısa Bu diziler Companie sipariş edilebilirs sunan gen sentezi hizmet. Bu daha sonraki aşamalar için ortak bir adaptör dizisiyle birlikte, bu sekansları yan yüzey için uygundur. Bu prosedür Şekil 3B&#39;de şematize edilmiştir. </li><li> Primer 1 (GTGCCAGCAACAGATAGC) ve Primer 2 (/ 5Cy3/TAAATTCCTACAACAACGAGCTCGAATG) ile PCR yapın. Not: Primer 2 5 &#39;ucunda FRET verici Cy3 ile etiketlenir. Tipik bir PCR protokol tarifi ve bisiklet Tablolar 1 ve 2&#39;de sunulmuştur. </li><li> Primer 3 (/ 5BioTEG/GAAACATAG/iCy5/GAATTTACCGTGCCAGCAACAGATAGC) ve Primer 4 (CAACAACGAGCTCGAATG) ile PCR gerçekleştirin. NOT: Primer 3 5 &#39;ucunda omurga ve biyotin bağlayıcı aracılığıyla FRET alıcı Cy5 ile etiketlenir. PCR tarifi ve bisiklet protokol yukarıdaki gibidir. </li><li> Bir PCR temizleme kiti kullanılarak PCR ürünleri saflaştırılır. </li><li> 0.4 ve nihai konsantrasyonlarda iplik değişimi için bir tampon (100 mM NaCl, 10 mM Tris-HCl pH 7.0, 1 mM EDTA) içinde Cy3-etiketli ürün ve Cy5 etiketli ürünün karıştırın# 181; sırasıyla M ve 0.1 mcM. Not: aşırı Cy3-DNA şerit değişimi sonucu Cy3 ve Cy5 hem taşıyan çift yönlü konsantrasyonunu arttırır. </li><li> 2 dakika için 98.5 ° C &#39;de enkübe edilerek Değişim şeritler, yavaş yavaş 5 soğutulduktan ° C 0.1 ° C / sn bir artış hızı ile ve 5 de inkübe &#160; 2 saat boyunca ° C. </li></ol> 2.. Jel Elektroforez dsDNA Eğrilik Algılama <ol><li> 29.2:0.8 oranında akrilamid ve bis-akrilamid solüsyon karıştırılarak bir poliakrilamid jeli 16,17 dökün,% 5 (ağ / hac) pH 8.0 &#39;de 1X Tris / borat / EDTA (TBE) tamponu. Not: jel solüsyonu 10 mi içerir: 1.217 ml% 40 akrilamit, 0.667 ml% 2 bis-akrilamid, 1 mi TBE 10X, 100 L amonyum persülfat (APS) 10,% 10, L TEMED, ve geri kalan dH 2 O olduğu Jelin tam katılaşması yaklaşık 30 dakika sürer. </li><li> DNA örnekleri ve 1X yükleme tamponu içinde DNA merdiveni (% 5 gliserol,% 0.03 (ağırlık / hacim) bromofenol bl ile poliakrilamid jel yükue) ve 5-8 de jel de 45 dakika boyunca 4 ° C&#39;de veya boya ön kadar V / cm jel sonuna yaklaşır. </li><li> 30 dakika için 0.5 g / ml etidyum bromid içeren 1X TBE tamponu kullanılarak jel leke. UV ışık altında DNA bantları belirlenmesi. DNA moleküllerinin belirgin boyutlarını hesaplamak için boyut markeri (100 bp DNA merdiven) ile bant pozisyonları karşılaştır. NOT: Kavisli DNA&#39;lar genellikle düz DNA&#39;ların daha yavaş hareket eder. </li></ol> 3.. Hücre Hazırlama Akış <ol><li> Bir matkap basın ve elmas matkap kullanarak bir cam slayt iki zıt kenarları (3&#39;&#39; x 1&#39;&#39;) boyunca delik 6-7 çiftleri delin. Delindikten sonra, görünür cam tozunu su akan slayt ovmak. NOT: delik perfüzyon giriş ve çıkışları olarak hizmet vermektedir. Sondaj esnasında su ile slayt soğutma çatlamasını önlemek için önemlidir. </li><li> Cam bir kavanoza dik slaytlar yerleştirin ve su ile doldurun. 15 dakika boyunca sonikasyon ve başka bir cam kavanoz de içine aktarabilirsinizaseton temizlik için endikedir. 15 dakika boyunca aseton ve sonikasyon ile doldurun. Daha sonra bir sprey şişesi ve su kullanılarak, etanol ile slaytlar durulayın. Polipropilen kavanoza koyun, 5 M potasyum hidroksit ile doldurun ve sonicate 15 dakika için. Son olarak, 15 dakika boyunca su içinde slaytlar sonikasyon. Aynı protokolü kullanarak lamelleri (No. 1, 24 x 40 mm) temizleyin. NOT: Temizlenmiş slaytlar ve lamelleri uzun süreli kullanım için dH 2 O saklanabilir. </li><li> 0.1 M sodyum bikarbonat çözeltisi 340 L mPEG-silan 80 mg (MW 2000) ile biotin-PEG-silan, 1 mg (MW 3400) karıştırın. İyice karıştırın ve baloncuklar kurtulmak için kısaca karışımı santrifüj. NOT: Polietilen glikol (PEG) ile yüzeyin işlevselleştirme yüzeyine spesifik olmayan DNA bağlanma azaltmaya yardımcı olur. </li><li> Her slaytta PEG çözeltisi 80 L koyun ve hafifçe üzerine bir lamel düşük. 45 dakika boyunca bekleyin. , Cımbız ile slayt lamel ayırın dH 2 O bol miktarda durulayın ve izin taçık havada hem kuru. </li><li> Kanallar oluşturmak üzere slaytta çift-çubuk ince şerit bant yerleştirin. Bunun üzerine bir lamel hizalayın ve sıkıca sıvı geçirmez kanallar oluşturmak üzere slayt karşı lamel basın. Kanalların kenarları mühür 5 dakika epoksi kullanın. </li></ol> Trolox Çözüm 4. Hazırlanması <ol><li> Bir şişe içinde ~ 30 mg troloks ve 10 ml dH 2 O koyun ve 18 saat süre ile açık havada solüsyonu karıştırmak için bir mıknatıs karıştırma çubuğu kullanmaktadır. </li><li> Bir 0.2 mikron filtre kullanılarak filtre edilir ve çözelti 1 M Tris bazı (pH 11)-6 ul ekleyerek pH 7&#39;ye ayarlanır. Not: Trolox genel olarak 18 çalışmalar, tek bir molekül olarak kullanılan bir anti-yanıp sönen reaktiftir. Trolox ® solmaya hareket kısmen bozulmuş Trolox ® çözeltisi 19 içinde mevcut olan kendi oksitlenmiş türevi gelmektedir. Metanol ya da yüksek hızlı bir şekilde pH Tris Trolox ® çözeltisi içinde çözündürülmesi için yetersiz oksidasyon kaçınılmalıdır. </li></ol> 5. Tek molecule Görüntüleme <ol><li> Kanala NeutrAvidin çözeltisi (0.5 mg / ml) 15 ul enjekte edilir ve T50 tampon 100 ul (10 mM Tris-HCl, 50 mM NaCl, pH 7.0) ile yıkamadan önce 2 dakika boyunca bekleyin. </li><li> Kanalın içine DNA örneği (50-100 pM), 50 ul enjekte edilir. 5 dakika bekleyin ve T50 tampon 100 L uzakta ilişkisiz DNA durulayın. Not: DNA molekülleri, özellikle NeutrAvidin-biyotin etkileşimi yoluyla yüzeye bağlanacaktır. </li><li> Bir oksijen tutucu sistem 20 (100 mM PCD, 5 mM PCA, 1 mM Trolox ve 500 mM NaCl) içeren bir görüntüleme tamponu ile kanal doldurun. </li><li> Saniyede 25 kare bilgisayara 2 x 2 binned görüntüleri (256 x 256) akışı çerçeve transfer modunda EMCCD ayarlayın. </li><li> Mikroskop objektif üzerinde daldırma yağ koymak, ve numune klipsler kullanılarak mikroskop sahnede akış hücresi düzeltmek. Duvara lazer yansıma şekline bakarak odağı kaba ayarlayın. Floresan im canlı görünümünü kullanarak odağı İnce ayarımonitörde yaş. </li><li> Üzerinde 532 nm lazer ile veri toplama başlar. Canlı görünümünü kontrol edin ve gerekirse odağı ayarlayın. En molekülleri photobleached olduğunda veri toplama durdurun. NOT: Bu tesiste, mikroskop kontrol ve sabit diske kaydedilmiş olarak monitörde canlı görüntüleri görüntülemek için bir laboratuvar-C yazılı programı kullanılmıştır. </li></ol> 6.. Görüntü İşleme ve Veri Analizi NOT: 256 x 256 görüntülerin bir zaman serisi Cy3 ve Cy5 şiddetlerinde tek-molekül zaman izlerini oluşturmak için bir MATLAB kodu tarafından işlenir. Donör kanal ve bölünmüş görünüm görüntü alıcı kanal arasındaki pikselleri eşleştirmek için, Cy3 ve Cy5 noktalar 6-7 çifti, eşit görüş alanına yayılmış aynı molekülün her çifti, elle bir afin dönüşüm aldı, ve vardır çapa noktaları olarak bu noktalar koordinatları kullanılarak hesaplanır. <ol><li> MATLAB komut dosyası kullanarak, tüm tek-molekül süre bakmak t izleridüşük ve yüksek FRET sinyalleri arasında şapka gösterisi çoklu geçişler. Döngüye ve unlooped durumlarını belirlemek. Not: FRET sinyali Cy5 yoğunluğu olarak tanımlanan (I a) Cy3 ve Cy5 yoğunluklarının toplamı (I I a + d) bölünür. Unlooped hali düşük FRET değere sahip iken döngüye devlet yüksek FRET değeri vardır. Tek bir molekülden FRET sinyallerinin histogram bimodally için geri loop ve unlooping arasında dağıtılır. </li><li> İki monte Gauss eğrileri arasındaki kesişim belirleyerek iki dağılımları ayıran eşik bulun. </li><li> FRET verimliliği gibi hesaplayın <img fo:content-width="0.6in" src="/files/ftp_upload/51667/eq7.jpg" /> ve yüksek FRET değerleri ve düşük FRET değerleri ile unlooped devletlerle döngüye durumları atayın. </li><li> MATLAB komut dosyası kullanarak, moleküllerin (N (t)) kümülatif sayısını analiz o döngüye (veyaveri toplama başından bu yana farklı zaman geçerse de yüksek FRET devlet) ulaştı. NOT: dsDNA molekül veri toplama başında unlooped devletin herhangi bir yapısındaki başlayabilirsiniz yana, ilmekli nüfus artış oranı ortalama döngü oranı ilk konformasyonlar üzerinden ortalama yansıtır. Üstel fonksiyonu ile N (t) takarak döngü oranı k döngü Özü: <img fo:content-width="1.8in" src="/files/ftp_upload/51667/eq1.jpg" /> Biphasically artarsa, o bir çift üstel fonksiyonu ile donatılmış olabilir: <img fo:content-width="2.2in" src="/files/ftp_upload/51667/eq2.jpg" /> Bu durumda, k döngü elde edilir: <img fo:content-width="1.7in" src="/files/ftp_upload/51667/eq3.jpg" /> Not: Teorik olarak, bir polimer t zamanında döngüye olmadığını hayatta kalma olasılığı, tek veya çift üstel fonksiyon 12 değildir. Üstel fitting ortalama döngü süresini elde etmek için pratik bir araç olarak kullanılır. </li></ol> 7. J Factor Belirlenmesi Not: J faktörü dsDNA bir ucu diğer ucunda yaklaşık kadar konsantre edildi temsil eder. Bu döngü oranı olarak ölçülen diğer ucu bölümü ile aynı reaksiyon oranını üretecektir DNA&#39;nın bir ucu diliminin konsantrasyonunu interpolasyonuyla belirlenebilir. Deneysel olarak, bir uç kademeli bir yüzeyi üzerinde immobilize edilir ve diğer uç kademeli bir belirli konsantrasyon ° C&#39;de ilave edilir. Iki ucu arasındaki ölçülen bağlanma oranı k tavlama ise, J faktörü 21 ile verilir <img fo:content-width="0.6in" src="/files/ftp_upload/51667/eq4.jpg" /> . Tavlama oranı sabiti (k tavlama = k tavlama / C), prob konsantrasyonu bağımsızdır. <ol><li> 30-50 pM biotin-Cy5 oligo 20 ul (Primer 3) akış iBir NeutrAvidin kaplı kanal nto. Ilişkisiz oligolarını yıkayacak 100 ul T50 ile kanal durulayın. </li><li> 50 nM&#39;lik bir nihai konsantrasyonda Cy3 oligo (Primer 2) ilavesi ile kısmen 5&#39;te tarif edildiği gibi görüntüleme tamponu hazırlayın. Kanala bu görüntüleme tampon akış. </li><li> Üzerinde 532 nm lazer tutarken, kısaca yüzey bağlı Cy5 Oligoların konumlarını belirlemek için 640 nm lazer açın. 640 nm lazer kapatın ve FRET sinyal izleme başlar. NOT: Bir yüzeye bağlı Cy5 oligo için bir Cy3 oligo hibridizasyon üzerine, Cy5 floresans FRET dan ortaya çıkacaktır. </li><li> MATLAB komut dosyası kullanılarak, ilişkisiz devlet (düşük yoğunluklu Cy5) başlar ama daha sonra Cy5 yoğunluk izlerinden zamanın bir fonksiyonu olarak tavlı devlet (yüksek Cy5 yoğunluğu) dönüşmesi moleküllerinin sayısını analiz. </li><li> Tavlı moleküllerin karşı zaman bu sayı çiziniz. Tek bir üstel fonksiyonu ile (bu eğrinin <img fo:content-width="1.8in" src="/files/ftp_upload/51667/eq5.jpg"/&gt;), Tavlama oranı (k anneal) elde edilmiştir. </li><li> Tavlama oranı ve reaktan konsantrasyonu arasında lineer teyit etmek için farklı oligo Cy3 konsantrasyonda (60, 100 ve 180 nM) bu deney tekrarlayın. Ikinci dereceden tavlama oranı sabiti (k tavlama Özü ) Yamaç. </li><li> J faktör hesaplayın <img fo:content-width="0.6in" src="/files/ftp_upload/51667/eq6.jpg" /> , K döngü aynı tampon durumda ölçülen döngü hızıdır. </li></ol>

<ol>
	<li>Garcia, H. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biological+consequences+of+tightly+bent+DNA:+The+other+life+of+a+macromolecular+celebrity.">Biological consequences of tightly bent DNA: The other life of a macromolecular celebrity.</a> Biopolymers. 85, 115-130 (2007).</li><li>Wiggins, P. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+flexibility+of+DNA+on+short+length+scales+probed+by+atomic+force+microscopy.">High flexibility of DNA on short length scales probed by atomic force microscopy.</a> Nature Nanotechnology. 1, (2006).</li><li>Lionberger, T. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cooperative+kinking+at+distant+sites+in+mechanically+stressed+DNA.">Cooperative kinking at distant sites in mechanically stressed DNA.</a> Nucleic Acids Research. 41, 6785-6792 (2011).</li><li>Shore, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+flexibility+studied+by+covalent+closure+of+short+fragments+into+circles.">DNA flexibility studied by covalent closure of short fragments into circles.</a> Proc Natl Acad Sci U S A. 78, 4833-4837 (1981).</li><li>Geggier, S., Vologodskii, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequence+dependence+of+DNA+bending+rigidity.">Sequence dependence of DNA bending rigidity.</a> Proc Nat Acad Sci U S A. 107, 15421-15426 (1992).</li><li>Smith, S. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+mechanical+measurements+of+the+elasticity+of+single+DNA+molecules+by+using+magnetic+beads.">Direct mechanical measurements of the elasticity of single DNA molecules by using magnetic beads.</a> Science. 258, 1122-1126 (1992).</li><li>Peters, J. P., Maher, L. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+curvature+and+flexibility+in+vitro+and+in+vivo.">DNA curvature and flexibility in vitro and in vivo.</a> Quarterly Reviews of Biophysics. 43, 23-63 (2010).</li><li>Cloutier, T. E., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneous+sharp+bending+of+double-stranded+DNA.">Spontaneous sharp bending of double-stranded DNA.</a> Molecular Cell. 14, 355-362 (2004).</li><li>Du, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclization+of+short+DNA+fragments+and+bending+fluctuations+of+the+double+helix.">Cyclization of short DNA fragments and bending fluctuations of the double helix.</a> Proc Natl Acad Sci U S A. 102, 5397-5402 (2005).</li><li>Yuan, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=T4+DNA+ligase+is+more+than+an+effective+trap+of+cyclized+dsDNA.">T4 DNA ligase is more than an effective trap of cyclized dsDNA.</a> Nucl. Acids Res. 35, 5294-5302 (2007).</li><li>Manzo, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+effect+of+nonspecific+binding+of+lambda+repressor+on+DNA+looping+dynamics.">The effect of nonspecific binding of lambda repressor on DNA looping dynamics.</a> Biophysical Journal. 103, 1753-1761 (2012).</li><li>Le, T. T., Kim, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measuring+shape-dependent+looping+probability+of+DNA.">Measuring shape-dependent looping probability of DNA.</a> Biophys. J. 104, 2068-2076 (2013).</li><li>Vafabakhsh, R., Ha, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extreme+bendability+of+DNA+less+than+100+base+pairs+long+revealed+by+single-molecule+cyclization.">Extreme bendability of DNA less than 100 base pairs long revealed by single-molecule cyclization.</a> Science. 337, 1097-1101 (2012).</li><li>Friedman, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viewing+dynamic+assembly+of+molecular+complexes+by+multi-wavelength+single-molecule+fluorescence.">Viewing dynamic assembly of molecular complexes by multi-wavelength single-molecule fluorescence.</a> Biophysical Journal. 91, 1023-1031 (2006).</li><li>Kaplan, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+DNA-encoded+nucleosome+organization+of+a+eukaryotic+genome.">The DNA-encoded nucleosome organization of a eukaryotic genome.</a> Nature. 458, 362-366 (2009).</li><li>Koo, H. S., Crothers, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calibration+of+DNA+curvature+and+a+unified+description+of+sequence-directed+bending.">Calibration of DNA curvature and a unified description of sequence-directed bending.</a> Proc Nat Acad Sci U S A. 85, 1763-1767 (1988).</li><li>Prosseda, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+temperature-induced+narrow+DNA+curvature+range+sustains+the+maximum+activity+of+a+bacterial+promoter+in+vitro.">A temperature-induced narrow DNA curvature range sustains the maximum activity of a bacterial promoter in vitro.</a> Biochemistry. 49, 2778-2785 (2010).</li><li>Rasnik, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonblinking+and+long-lasting+single-molecule+fluorescence+imaging.">Nonblinking and long-lasting single-molecule fluorescence imaging.</a> Nature Methods. 3, 891-893 (2006).</li><li>Cordes, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+mechanism+of+Trolox+as+antiblinking+and+antibleaching+reagent.">On the mechanism of Trolox as antiblinking and antibleaching reagent.</a> J. Am. Chem. Soc. 131, 5018-5019 (2009).</li><li>Aitken, C. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+oxygen+scavenging+system+for+improvement+of+dye+stability+in+single-molecule+fluorescence+experiments.">An oxygen scavenging system for improvement of dye stability in single-molecule fluorescence experiments.</a> Biophys J. 94, 1826-1835 (2008).</li><li>Taylor, W. H., Hagerman, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+the+method+of+phage+T4+DNA+ligase-catalyzed+ring-closure+to+the+study+of+DNA+structure:+II.+NaCl-dependence+of+DNA+flexibility+and+helical+repeat.">Application of the method of phage T4 DNA ligase-catalyzed ring-closure to the study of DNA structure: II. NaCl-dependence of DNA flexibility and helical repeat.</a> Journal of Molecular Biology. 212, 363-376 (1990).</li><li>Bolshoy, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Curved+DNA+without+A-A:+experimental+estimation+of+all+16+DNA+wedge+angles.">Curved DNA without A-A: experimental estimation of all 16 DNA wedge angles.</a> Proc Natl Acad Sci U S A. 88, 2312-2316 (1991).</li><li>Gibson, D. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthesis+of+DNA+fragments+in+yeast+by+one-step+assembly+of+overlapping+oligonucleotides.">Synthesis of DNA fragments in yeast by one-step assembly of overlapping oligonucleotides.</a> Nucl. Acids Res. 37, 6984-6990 (2009).</li><li>Vologodskii, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bending+of+short+DNA+helices.">Bending of short DNA helices.</a> Artif DNA PNA XNA. 4, (2013).</li><li>Hoover, D. M., Lubkowski, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNAWorks:+an+automated+method+for+designing+oligonucleotides+for+PCR-based+gene+synthesis.">DNAWorks: an automated method for designing oligonucleotides for PCR-based gene synthesis.</a> Nucl. Acids Res. 30, (2002).</li><li>Waters, J. T., Kim, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Equilibrium+Statistics+of+a+Surface-Pinned+Semiflexible+Polymer.">Equilibrium Statistics of a Surface-Pinned Semiflexible Polymer.</a> Macromolecules. 46, 6659-6666 (2013).</li><li>Mills, J. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electrophoretic+evidence+that+single-stranded+regions+of+1+or+more+nucleotides+dramatically+increase+the+flexibility+of+DNA.">Electrophoretic evidence that single-stranded regions of 1 or more nucleotides dramatically increase the flexibility of DNA.</a> Biochemistry. 33, 1797-1803 (1994).</li></ol>

Yazarlar çıkar çatışması beyan ederim.

FRET göre basit bir tek-molekül deney farklı şekillerde iç DNA&#39;ların ilmek kinetiğini incelemek için kullanılmıştır. Eğimli DNA&#39;lar 10.5 bp&#39;lik sarmal süresi ile aynı fazda bir 10-mer dizisini tekrar ile hazırlanabilir, ve eğrilikleri PAGE kullanılarak tahmin edilebilir. Bu dsDNAs geçici döngü stabilizasyonu sağlamak için yapışkan uçları ile tasarlanmıştır. Zamanla döngüye moleküllerin sayısındaki artıştan üstel döngü hızı ekstre edilmiştir. Kesilmiş yapışkan uç...

DsDNA&#39;nın mekanik özelliklerini anlama, temel bilimler ve mühendislik uygulamalarında temel bir öneme sahiptir. Ardışık baz çiftleri arasına rulo, eğim ve büküm açıları dizisi ile değişebilir çünkü dsDNA&#39;nın yapısı düz bir sarmal merdiven daha karmaşıktır. Termal dalgalanmalar dsDNA gibi, bükme büküm ve germe gibi yapısal dalgalanmalara farklı modları geçmesi neden olabilir. Bu eritme ve dolanmaya olarak geçişleri de aşırı koşullarda oluşabilir. Bu hareketler arasında, dsDNA bükme en çok dikkat çeken biyolojik etkiye sahiptir 1. dsDNA eğilme birbirine yakın iki uzak siteleri getirerek gen baskıyla veya aktivasyonu ile ilişkilidir. Ayrıca, DNA hücre çekirdeğinin içine ambalaj veya bir viral kapsid önemli bir rol oynar. DsDNA bükülmesi deformasyonu yüksek çözünürlüklü mikroskopisi (AFM 2 ve 3 TEM) ve Thermodyn ile deneysel olarak görselleştirilebiliramics ve kinetik kimyasal dsDNA&#39;nın yan yana sitelere link loop tahliller ile ele alınabilir. Böyle bir deney, ligaz bağımlı siklizasyon 4&#39;tür. Bu testte, &#39;yapışkan&#39; (yapışkan) uçları ile dsDNA moleküller sirküle veya DNA ligazı ile dimerize. Daire ve dimer oluşumunun oranlarını karşılaştırarak, bir J faktör olarak bilinen diğer ucu, yakın DNA&#39;nın bir ucunun etkin bir molar konsantrasyon elde edebilir. Bu, J faktör diğer ucunda, kısa bir mesafede, DNA&#39;nın bir ucu bulma olasılığı yoğunluğuna boyutlu eşdeğerdir ve bu şekilde DNA&#39;nın bir esneklik göstermektedir. DNA uzunluğunun bir fonksiyonu olarak J faktörünün ölçülmesi kalıcı uzunluğu 4,5 &#39;da dahil olmak üzere bir DNA ile ilgili birçok mekanik özelliklerini ortaya koymaktadır. Solucan benzeri zincir (WLC) modeli yaygın bir açıklamaya onun başarısına dayanan dsDNA mekaniği için kanonik polimer modeli olarak kabul edilmiştirDNA deneyleri 6 çekerek, doğru ve uzun 200 bp 7 daha dsDNAs arasında J faktörleri tahmin elde kuvvet-uzatma eğrileri adencilik. Bununla birlikte, 100 bp kadar kısa dsDNA moleküller üzerinde siklizasyon deneyi kullanılarak, Cloutier ve Widom WLC modeli tahmin 8 daha yüksek, birkaç kat olmak J faktörleri ölçülür. Bir yıl sonra, Du ve ark. ligazı düşük konsantrasyonları ile siklizasyon deneyi kullanılarak WLC modeli ile uyum içinde J faktörleri üretilen ve Widom gruptan 9 ligaz kullanılan yüksek konsantrasyonlara anormal sonucu bağlanabilir. Geleneksel tahlil 9 kullanırken bu tartışma siklizasyonudur kinetik DNA ligaz kaçınılmaz etkisini örneğidir. Ayrıca, DNA ligaz, aynı zamanda non-spesifik bağlanma 10,11 aracılığıyla gerçekleştirilen DNA yapısı ve sertlik etkileyebilir. Protein-bağımlı ilmek testlerin teknik endişelerini ortadan kaldırmak için, son zamanlarda bir prot gösterdiFlüoresans Rezonans Enerji Transferi (FRET) 12 göre ein içermeyen döngü deneyi. Bu yöntemde, döngüye konformasyonları bir DNA molekülünün yapışkan uçlarının yakınında bağlı verici ve alıcı arasında FRET ile tespit edilir. Objektif tipi toplam iç yansıma flüoresans mikroskobu (TIRFM) geri loop ve uzun bir süre için hareketsiz kılınmış yüzeye tek bir DNA moleküllerinden unlooping etkinlikleri yörüngeleri kaydetmek için kullanılır. Bu yöntem, Vafabakhsh Ha ve 13 ile benzer bir yöntem üzerinde çok önemli bir gelişmedir uyumsuzluk içermeyen DNA molekülleri oluşturmak için DNA moleküllerinin PCR tabanlı bir montaj sağlar. Bu protokol, tek moleküllü bir yönü, FRET yönü bir hatta ligaz aktivitesi bozabilir koşullarda, aynı molekülde tekrar tekrar DNA ilmek dinamikleri ölçmek için sağlar Buna ek olarak dağılımlarının ölçüm ortalamalar topluluğa sağlar. TIRFM düzeneği Şekil 1&#39;de gösterilmiştir. Özel bir-Tasarlanmış numune aşama bir Olympus IX61 mikroskop vücuda yerleştirilir. 532 nm ve 640 nm lazerler tarafından tanıtıldı ve lamel-su arayüzünde geliş kritik açıyı elde etmek için yüksek NA objektif içine küçük eliptik ayna 14 tarafından yansıtılır. Daha yaygın bir dikroik ayna veya prizma bazlı TIR kurulumları kullanılarak objektif TIR da FRET, bu uygulama için kullanılabilir unutmayın. Mikroskop ile oluşan floresan görüntü bir dikroik ayna, verici ve alıcı görüntüleri ayrılmıştır. Daha sonra, bir EMCCD iki yarısı üzerine yeniden görüntülü. Ek uzun geçiş filtresi emisyon arka plan sinyali azaltmak için kullanılır. Sıcaklık kontrolü tekrarlanabilir kinetik verileri elde etmek için gereklidir. Sıcaklık kontrolü için, objektif, sıcaklık kontrollü bir soğutucu / ısıtıcı ısı transferi, ve su en aza indirmek için mikroskop vücudun burun parçası ayrılır sıkıca oturan bir pirinç bileziği yoluyla sirküle ediliramaç kılıfın altında iç metal etrafında. Bu kurulum 15 ve 50 ° C arasında lamel yüzey (Şekil 2) sağlam sıcaklık kontrolünü sağlamak mümkün. Bu çalışmada, örnek sıcaklığı 24 ° C&#39;de muhafaza edilmiştir Aşağıdaki protokol DNA yapımında, DNA şekil tahmini, tek molekül deney ve J faktör belirlenmesi için adım adım işlemi sunar.

<table><tbody><tr><td>Small DNA FRAG Extract Kit-100PR</td><td>VWR</td><td>97060-558</td><td></td></tr><tr><td>Acrylamide 40% solution 500 ml</td><td>VWR</td><td>97064-522</td><td></td></tr><tr><td>Bis-acrylamide 2% (w/v) solution 500 ml</td><td>VWR</td><td>97063-948</td><td></td></tr><tr><td>GeneRuler 100 bp DNA Ladder, 100-1,000 bp</td><td>Fermentas</td><td>SM0241</td><td></td></tr><tr><td>Mini Vertical PAGE System</td><td>VWR</td><td>89032-300</td><td></td></tr><tr><td>Syringe filter 0.2 &amp;mu;m CS50</td><td>VWR</td><td>A2666</td><td></td></tr><tr><td>Trolox</td><td>Sigma-Aldrich</td><td>238813-1G</td><td>triplet state quencher</td></tr><tr><td>Protocatechuic acid (PCA)</td><td>Sigma-Aldrich</td><td>08992-50MG</td><td>oxygen scavenging system</td></tr><tr><td>Protocatechuate 3,4-Dioxygenase (PCD)</td><td>Sigma-Aldrich</td><td>P8279-25UN</td><td>oxygen scavenging system</td></tr><tr><td>mPEG-silane, MW 2,000 1 g</td><td>Laysan Bio</td><td>MPEG-SIL-2000-1g</td><td></td></tr><tr><td>Biotin-PEG-Silane, MW 3,400</td><td>Laysan Bio</td><td>Biotin-PEG-SIL-3400-1g</td><td></td></tr><tr><td>Avidin, NeutrAvidin Biotin-binding Protein</td><td>Invitrogen</td><td>A2666</td><td></td></tr><tr><td>Phusion Hot Start High-Fidelity DNA Polymerase</td><td>New England Biolabs</td><td>F-540L</td><td></td></tr><tr><td>Gel/PCR DNA Fragments Extraction Kit</td><td>IBI Scientific</td><td>IB47020</td><td></td></tr><tr><td>Premium plain glass microscope slides</td><td>Fisher Scientific</td><td>12-544-1</td><td></td></tr><tr><td>VWR micro cover glass, rectangular, no. 1</td><td>VWR</td><td>48404-456</td><td></td></tr><tr><td>Fisher Scientific Isotemp 1006S Recirculating Chiller/Heater</td><td>Fisher Scientific</td><td></td><td>temperature control</td></tr><tr><td>Objective Cooling Collar</td><td>Bioptechs</td><td>150303</td><td>temperature control</td></tr><tr><td>KMI53 Biological Micrometer Measuring Stage</td><td>Semprex</td><td>KMI53</td><td></td></tr><tr><td>High Performance DPSS Laser 532 nm 50 mW</td><td>Edmund optics</td><td>NT66-968</td><td>Cy3 excitation</td></tr><tr><td>CUBE Fiber Pigtailed 640 nm, 30 mW, Fiber, FC/APC Connector</td><td>Coherent</td><td>1139604</td><td>Cy5 excitation</td></tr><tr><td>650 nm BrightLine Dichroic Beamsplitter</td><td>Semrock</td><td>FF650-Di01-25x36</td><td>splitting dichroic</td></tr><tr><td>LaserMUX Beam Combiner, reflects 514.5, 532, &amp;amp; 543.5 nm lasers, 25 mm</td><td>Semrock</td><td>LM01-552-25</td><td>combining dichroic</td></tr><tr><td>Brightline Fluorescence Filter 593/40</td><td>Semrock</td><td>FF01-593/40-25</td><td>Cy3 emission filter</td></tr><tr><td>635 nm EdgeBasic LWP longpass Filter, 25 mm</td><td>Semrock</td><td>BLP01-635R-25</td><td>Cy5 emission filter</td></tr><tr><td>EMCCD iXon+</td><td>Andor Technology</td><td>DU-897E-CS0-#BV</td><td></td></tr><tr><td>IX51 inverted microscope frame</td><td>Olympus</td><td></td><td></td></tr><tr><td>Objective UApo N 100X/1.49 Oil TIRF</td><td>Olympus</td><td></td><td></td></tr><tr><td>Immersion oil type-F for fluorescence microscopy</td><td>Olympus</td><td>IMMOIL-F30CC</td><td></td></tr><tr><td>2 mm Diameter 45&amp;deg; Rod Lens Aluminum Coated&amp;nbsp;</td><td>Edmund optics</td><td>54-092</td><td>miniature mirror</td></tr><tr><td>1/4&quot; Travel Single-Axis Translation Stage</td><td>Thorlabs</td><td>MS-1</td><td>translation of miniature mirror</td></tr><tr><td>&amp;Oslash;1&quot; Achromatic Doublet, ARC: 400-700 nm, f=200 mm</td><td>Thorlabs</td><td>AC254-200-A</td><td>focusing lens</td></tr><tr><td>Adjustable Mechanical Slit</td><td>Thorlabs</td><td>VA100</td><td></td></tr><tr><td>Dielectric Mirror</td><td>Thorlabs</td><td>BB1-E02</td><td></td></tr><tr><td>&amp;Oslash;1&quot; Achromatic Doublet, f = 100 mm</td><td>Thorlabs</td><td>AC254-100-A</td><td>relay lens</td></tr><tr><td>Lens Mount for &amp;Oslash;1&quot; Optics</td><td>Thorlabs</td><td>LMR1</td><td></td></tr><tr><td>Dichroic Filter Mount</td><td>Thorlabs</td><td>FFM1</td><td></td></tr><tr><td>Fixed Cage Cube Platform</td><td>Thorlabs</td><td>B3C</td><td></td></tr><tr><td>Kinematic Mount for &amp;Oslash;1&quot; Optics</td><td>Thorlabs</td><td>KM100</td><td></td></tr><tr><td>N-BK7 Plano-Convex Lens, &amp;Oslash;1&quot;, f = 40 mm</td><td>Thorlabs</td><td>LA1422-A</td><td>collimating lens</td></tr><tr><td>N-BK7 Plano-Convex Lense, &amp;Oslash;6.0 mm, f = 15 mm</td><td>Thorlabs</td><td>LA1222-A</td><td>telescope lens</td></tr><tr><td>N-BK7 Plano-Convex Lense, &amp;Oslash;6.0 mm, f = 150 mm</td><td>Thorlabs</td><td>LA1433-A</td><td>telescope lens</td></tr></tbody></table>

studying dna looping by single-molecule fret

Iki-şeritli DNA (dsDNA) eğilmesi gibi DNA-protein tanıma ve nükleozom içine DNA paket gibi birçok önemli biyolojik süreçler ile ilişkilidir. DsDNA bükme Termodinamik kovalent bir dsDNA&#39;nın kısa yapışkan uçlarını birleştiren DNA ligaz dayanan bir yöntem denilen siklizasyonu tarafından incelenmiştir. Bununla birlikte, bu gibi bağlama verimliliği DNA katılan yapışkan uçlarını çevreleyen yapı ve ligaz gibi döngü dsDNA ile ilişkili olmayan bir çok faktör tarafından etkilenebilir, aynı zamanda, non-spesifik bağlanma gibi mekanizmalar yoluyla belirgin ilmek hızını etkileyebilir. Burada, biz FRET (Floresan Rezonans Enerji Transferi) tarafından geçici DNA döngü oluşumunu tespit ederek ligazın olmadan dsDNA ilmek kinetik ölçmek için nasıl göstereceğim. dsDNA molekülleri, FRET çifti ve bir biyotin bağlayıcı ile basit PCR tabanlı bir protokol kullanılarak inşa edilmektedir. J faktörü olarak bilinen döngü olasılık yoğunluk kapa iki döngü arasındaki oran ile tavlama oranı elde edilirted yapışkan biter. Farklı içsel eğriliğe sahip iki dsDNAs test ederek, J faktör dsDNA iç şekline duyarlı olduğunu göstermektedir.

Ilmekleme çalışma için kullanılan DNA molekülleri değişken sırasının uzunluğu ve her bir diğerine tamamlayıcı olan tek şeritli çıkıntılarının bir çift yönlü bölge oluşur. 7-baz uzunluğunda olan çıkıntılar, ilmekli durumunu yakalamak için birbirine bağlandığı olabilir. Her bir çıkıntı sitidin kimya yoluyla DNA omurgada bağlantılıdır Cy3 veya Cy5 ya da içerir. Cy5-çıkıntı da hareketsizleştirme yüzeyi (Şekil 4A) için biotin-TEG (15-atom Tetra-Etilen Gli...

Watch this Scientific Journal Video about Studying DNA Looping by Single-Molecule FRET at JoVE.com

Studying DNA Looping by Single-Molecule FRET

Bu çalışma, tek bir molekül flüoresan rezonans enerji transferi (FRET) kullanılarak çift sarmallı DNA ilmek dinamiklerini ölçmek için bir ayrıntılı deneysel prosedür sunmaktadır. Protokol ayrıca J faktörü denilen döngü olasılık yoğunluğunu ayıklamak için nasıl açıklar.

Tek Molekül FRET DNA döngü oluşturma incelenmesi

Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into ...

studying-dna-looping-by-single-molecule-fret

Universidad de Cartagena UDEC

Research

JoVE Journal

Biology

15.3K Görüntüleme.  Georgia Institute of Technology.  Bu çalışma, tek bir molekül flüoresan rezonans enerji transferi (FRET) kullanılarak çift sarmallı DNA ilmek dinamiklerini ölçmek için bir ayrıntılı deneysel prosedür sunmaktadır. Protokol ayrıca J faktörü denilen döngü olasılık yoğunluğunu ayıklamak için nasıl açıklar. 

Video: Studying DNA Looping by Single-Molecule FRET

High Precision FRET at Single-molecule Level for Biomolecule Structure Determination

A protocol on how to perform high-precision interdye distance measurements using F&#246;rster resonance energy transfer (FRET) at the single-molecule level in multiparameter fluorescence detection (MFD) mode is presented here. MFD maximizes the usage of all &#34;dimensions&#34; of fluorescence to reduce photophysical and experimental artifacts and allows for the measurement of interdye distance with an accuracy up to ~1 &#197; in rigid biomolecules. This method was used to identify three conformational states of the ligand-binding domain of the N-methyl-D-aspartate (NMDA) receptor to explain the activation of the receptor upon ligand binding. When comparing the known crystallographic structures with experimental measurements, they agreed within less than 3 &#197; for more dynamic biomolecules. Gathering a set of distance restraints that covers the entire dimensionality of the biomolecules would make it possible to provide a structural model of dynamic biomolecules.

A protocol for high-precision FRET experiments at the single molecule level is presented here. Additionally, this methodology can be used to identify three conformational states in the ligand-binding domain of the N-methyl-D-aspartate (NMDA) receptor. Determining precise distances is the first step towards building structural models based on FRET experiments.

Biyomolekül Yapısının Belirlenmesi İçin Tek Molekül Seviyesinde Yüksek Hassasiyetteki FRET

A protocol on how to perform high-precision interdye distance measurements using F&#246;rster resonance energy transfer (FRET) at the single-molecule ...

Biyokimya

A Simple, Robust, and High Throughput Single Molecule Flow Stretching Assay Implementation for Studying Transport of Molecules Along DNA

We describe a simple, robust and high throughput single molecule flow-stretching assay for studying 1D diffusion of molecules along DNA. In this assay, glass coverslips are functionalized in a one-step reaction with silane-PEG-biotin. Flow cells are constructed by sandwiching an adhesive tape with pre-cut channels between a functionalized coverslip and a PDMS slab containing inlet and outlet holes. Multiple channels are integrated into one flow cell and the flow of reagents into each channel can be fully automated, which significantly increases the assay throughput and reduces hands-on time per assay. Inside each channel, biotin-&#955;-DNAs are immobilized on the surface and a laminar flow is applied to flow-stretch the DNAs. The DNA molecules are stretched to &#62;80% of their contour length and serve as spatially extended templates for studying the binding and transport activity of fluorescently labeled molecules. The trajectories of single molecules are tracked by time-lapse Total Internal Reflection Fluorescence (TIRF) imaging. Raw images are analyzed using streamlined custom single particle tracking software to automatically identify trajectories of single molecules diffusing along DNA and estimate their 1D diffusion constants.

This protocol demonstrates a simple, robust and high throughput single molecule flow-stretching assay for studying one-dimensional (1D) diffusion of molecules along DNA.

Basit, sağlam ve yüksek üretilen iş tek bir molekül akışı germe tahlil uygulama boyunca DNA moleküllerinin taşıma eğitimi için

We describe a simple, robust and high throughput single molecule flow-stretching assay for studying 1D diffusion of molecules along DNA. In this assay, ...

Probing The Structure And Dynamics Of Nucleosomes Using Atomic Force Microscopy Imaging

Chromatin, which is a long chain of nucleosome subunits, is a dynamic system that allows for such critical processes as DNA replication and transcription to take place in eukaryotic cells. The dynamics of nucleosomes provides access to the DNA by replication and transcription machineries, and critically contributes to the molecular mechanisms underlying chromatin functions. Single-molecule studies such as atomic force microscopy (AFM) imaging have contributed significantly to our current understanding of the role of nucleosome structure and dynamics. The current protocol describes the steps enabling high-resolution AFM imaging techniques to study the structural and dynamic properties of nucleosomes. The protocol is illustrated by AFM data obtained for the centromere nucleosomes in which H3 histone is replaced with its counterpart centromere protein A (CENP-A). The protocol starts with the assembly of mono-nucleosomes using a continuous dilution method. The preparation of the mica substrate functionalized with aminopropyl silatrane (APS-mica) that is used for the nucleosome imaging is critical for the AFM visualization of nucleosomes described and the procedure to prepare the substrate is provided. Nucleosomes deposited on the APS-mica surface are first imaged using static AFM, which captures a snapshot of the nucleosome population. From analyses of these images, such parameters as the size of DNA wrapped around the nucleosomes can be measured and this process is also detailed. The time-lapse AFM imaging procedure in the liquid is described for the high-speed time-lapse AFM that can capture several frames of nucleosome dynamics per second. Finally, the analysis of nucleosome dynamics enabling the quantitative characterization of the dynamic processes is described and illustrated.

Here, we present a protocol to characterize nucleosome particles at the single-molecule level using static and time-lapse atomic force microscopy (AFM) imaging techniques. The surface functionalization method described allows for the capture of the structure and dynamics of nucleosomes in high-resolution at the nanoscale.

Atomik kuvvet mikroskobu Imaging'i kullanma oluşturarlar dinamikleri ve yapısını sondalama

Chromatin, which is a long chain of nucleosome subunits, is a dynamic system that allows for such critical processes as DNA replication and transcription ...

Magnetic Tweezers for the Measurement of Twist and Torque

Single-molecule techniques make it possible to investigate the behavior of individual biological molecules in solution in real time. These techniques include so-called force spectroscopy approaches such as atomic force microscopy, optical tweezers, flow stretching, and magnetic tweezers. Amongst these approaches, magnetic tweezers have distinguished themselves by their ability to apply torque while maintaining a constant stretching force. Here, it is illustrated how such a &#8220;conventional&#8221; magnetic tweezers experimental configuration can, through a straightforward modification of its field configuration to minimize the magnitude of the transverse field, be adapted to measure the degree of twist in a biological molecule. The resulting configuration is termed the freely-orbiting magnetic tweezers. Additionally, it is shown how further modification of the field configuration can yield a transverse field with a magnitude intermediate between that of the &#8220;conventional&#8221; magnetic tweezers and the freely-orbiting magnetic tweezers, which makes it possible to directly measure the torque stored in a biological molecule. This configuration is termed the magnetic torque tweezers. The accompanying video explains in detail how the conversion of conventional magnetic tweezers into freely-orbiting magnetic tweezers and magnetic torque tweezers can be accomplished, and demonstrates the use of these techniques. These adaptations maintain all the strengths of conventional magnetic tweezers while greatly expanding the versatility of this powerful instrument.

Magnetic tweezers, a powerful single-molecule manipulation technique, can be adapted for the direct measurements of the twist (using a configuration called freely-orbiting magnetic tweezers) and torque (using a configuration termed magnetic torque tweezers) in biological macromolecules. Guidelines for performing such measurements are given, including applications to the study of DNA and associated nucleo-protein filaments.

Büküm ve Moment Ölçümü için Manyetik Cımbız

Single-molecule techniques make it possible to investigate the behavior of individual biological molecules in solution in real time. These techniques ...

Biyomühendislik

Nanomanipulation of Single RNA Molecules by Optical Tweezers

A large portion of the human genome is transcribed but not translated. In this post genomic era, regulatory functions of RNA have been shown to be increasingly important. As RNA function often depends on its ability to adopt alternative structures, it is difficult to predict RNA three-dimensional structures directly from sequence. Single-molecule approaches show potentials to solve the problem of RNA structural polymorphism by monitoring molecular structures one molecule at a time. This work presents a method to precisely manipulate the folding and structure of single RNA molecules using optical tweezers. First, methods to synthesize molecules suitable for single-molecule mechanical work are described. Next, various calibration procedures to ensure the proper operations of the optical tweezers are discussed. Next, various experiments are explained. To demonstrate the utility of the technique, results of mechanically unfolding RNA hairpins and a single RNA kissing complex are used as evidence. In these examples, the nanomanipulation technique was used to study folding of each structural domain, including secondary and tertiary, independently. Lastly, the limitations and future applications of the method are discussed.

Optical tweezers have been used to study RNA folding by stretching individual molecules from their 5&#8217; and 3&#8217; ends. Here common procedures are described to synthesize RNA molecules for tweezing, calibration of the instrument, and methods to manipulate single molecules.

Optik cımbız ile Tek RNA Moleküllerin Nanomanipulation

A large portion of the human genome is transcribed but not translated. In this post genomic era, regulatory functions of RNA have been shown to be ...

Dual DNA Rulers to Study the Mechanism of Ribosome Translocation with Single-Nucleotide Resolution

The ribosome translocation refers to the ribosomal movement on the mRNA by exactly three nucleotides (nt), which is the central step in protein synthesis. To investigate its mechanism, there are two essential technical requirements. First is single-nt resolution that can resolve normal translocation from frameshifting, during which the ribosome moves by other than 3 nt. The second is the capability to probe both the entrance and exit sides of mRNA in order to elucidate the whole picture of translocation. We report the dual DNA ruler assay that is based on the critical dissociation forces of DNA-mRNA duplexes, obtained by force-induced remnant magnetization spectroscopy (FIRMS).&#160; With 2-4 pN force resolution, the dual ruler assay is sufficient to distinguish different translocation steps. By implementing a long linker on the probing DNAs, they can reach the mRNA on the opposite side of the ribosome, so that the mRNA position can be determined for both sides. Therefore, the dual ruler assay is uniquely suited to investigate the ribosome translocation, and nucleic acid motion in general. We show representative results which indicated a looped mRNA conformation and resolved normal translocation from frameshifting.

Dual DNA ruler assay is developed to determine the mRNA position during ribosome translocation, which relies on the dissociation forces of the formed DNA-mRNA duplexes. With single-nucleotide resolution and capability of reaching both ends of mRNA, it can provide mechanistic insights for ribosome translocation and probe other nucleic acid displacements.

Çift DNA cetvelleri tek Nükledotid çözünürlüğe sahip Ribosome translocation mekanizmasını Incelemek için

The ribosome translocation refers to the ribosomal movement on the mRNA by exactly three nucleotides (nt), which is the central step in protein synthesis. ...

R-Loop Analysis by Dot-Blot

The three-stranded nucleic acid structure, R-loop, is increasingly recognized for its role in gene regulation. Initially, R-loops were thought to be the by-products of transcription; but recent findings of fewer R-loops in diseased cells made it clear that R-loops have functional roles in a variety of human cells. Next, it is critical to understand the roles of R-loops and how cells balance their abundance. A challenge in the field is the quantitation of R-loops since much of the work relies on the S9.6 monoclonal antibody whose specificity for RNA-DNA hybrids has been questioned. Here, we use dot-blots with the S9.6 antibody to quantify R-loops and show the sensitivity and specificity of this assay with RNase H, RNase T1, and RNase III that cleave RNA-DNA hybrids, single-stranded RNA, and double-stranded RNA, respectively. This method is highly reproducible, uses general laboratory equipment and reagents, and provides results within two days. This assay can be used in research and clinical settings to quantify R-loops and assess the effect of mutations in genes such as senataxin on R-loop abundance.

This protocol details a simple method that quantifies R-loop, a three-stranded nucleic acid structure that comprises of an RNA-DNA hybrid and a displaced DNA strand.

The three-stranded nucleic acid structure, R-loop, is increasingly recognized for its role in gene regulation. Initially, R-loops were thought to be the ...

Genetik

Optical Tweezers to Study RNA-Protein Interactions in Translation Regulation

RNA adopts diverse structural folds, which are essential for its functions and thereby can impact diverse processes in the cell. In addition, the structure and function of an RNA can be modulated by various trans-acting factors, such as proteins, metabolites or other RNAs. Frameshifting RNA molecules, for instance, are regulatory RNAs located in coding regions, which direct translating ribosomes into an alternative open reading frame, and thereby act as gene switches. They may also adopt different folds after binding to proteins or other trans-factors. To dissect the role of RNA-binding proteins in translation and how they modulate RNA structure and stability, it is crucial to study the interplay and mechanical features of these RNA-protein complexes simultaneously.&#160;This work illustrates how to employ single-molecule-fluorescence-coupled optical tweezers to explore the conformational and thermodynamic landscape of RNA-protein complexes at a high resolution. As an example, the interaction of the SARS-CoV-2 programmed ribosomal frameshifting element with the trans-acting factor short isoform of zinc-finger antiviral protein is elaborated. In addition, fluorescence-labeled ribosomes were monitored using the confocal unit, which would ultimately enable the study of translation elongation. The fluorescence coupled OT assay can be widely applied to explore diverse RNA-protein complexes or trans-acting factors regulating translation and could facilitate studies of RNA-based gene regulation.

This protocol presents a complete experimental workflow for studying RNA-protein interactions using optical tweezers. Several possible experimental setups are outlined including the combination of optical tweezers with confocal microscopy.

Çeviri Yönetmeliğinde RNA-Protein Etkileşimlerini İncelemek için Optik Cımbız

RNA adopts diverse structural folds, which are essential for its functions and thereby can impact diverse processes in the cell. In addition, the ...

Single-Molecule Imaging of EWS-FLI1 Condensates Assembling on DNA

The fusion genes resulting from chromosomal translocation have been found in many solid tumors or leukemia. EWS-FLI1, which belongs to the FUS/EWS/TAF15 (FET) family of fusion oncoproteins, is one of the most frequently involved fusion genes in Ewing sarcoma. These FET family fusion proteins typically harbor a low-complexity domain (LCD) of FET protein at their N-terminus and a DNA-binding domain (DBD) at their C-terminus. EWS-FLI1 has been confirmed to form biomolecular condensates at its target binding loci due to LCD-LCD and LCD-DBD interactions, and these condensates can recruit RNA polymerase II to enhance gene transcription. However, how these condensates are assembled at their binding sites remains unclear. Recently, a single-molecule biophysics method-DNA Curtains-was applied to visualize these assembling processes of EWS-FLI1 condensates. Here, the detailed experimental protocol and data analysis approaches are discussed for the application of DNA Curtains in studying the biomolecular condensates assembling on target DNA.

Here, we describe the use of the single-molecule imaging method, DNA Curtains, to study the biophysical mechanism of EWS-FLI1 condensates assembling on DNA.

DNA Üzerine Birleştirilen EWS-FLI1 Kondensatlarının Tek Moleküllü Görüntülenmesi

The fusion genes resulting from chromosomal translocation have been found in many solid tumors or leukemia. EWS-FLI1, which belongs to the FUS/EWS/TAF15 ...

<meta charset="utf8"></head><body>Tek moleküllü çalışmalar için yerinde nükleozom sulandırması

In Situ Nucleosome Assembly for Single-Molecule Correlative Force and Fluorescence Microscopy

Nucleosomes constitute the primary unit of eukaryotic chromatin and have been the focus of numerous informative single-molecule investigations regarding their biophysical properties and interactions with chromatin-binding proteins. Nucleosome reconstitution on DNA for these studies typically involves a salt dialysis procedure that provides precise control over the placement and number of nucleosomes formed along a DNA tether. However, this protocol is time-consuming and requires a substantial amount of DNA and histone octamers as inputs. To offer an alternative strategy, an in situ nucleosome reconstitution method for single-molecule force and fluorescence microscopy that utilizes the histone chaperone Nap1 is described. This method enables users to assemble nucleosomes on any DNA template without the need for strong nucleosome positioning sequences, adjust nucleosome density on demand, and use fewer reagents. In situ nucleosome formation occurs within seconds, offering a simpler experimental workflow and a convenient transition into single-molecule measurements. Examples of two downstream assays for probing nucleosome mechanics and visualizing the behavior of individual proteins on chromatin are further described.

<meta charset="utf8"></head><body>Yazar Spotlight: Tek Moleküllü Teknikler için Verimli Nükleozom Sulandırma

This article presents a detailed experimental procedure for reconstituting nucleosome-containing DNA tethers for single-molecule correlative force and fluorescence microscopy. It further describes several downstream experiments that can be conducted to visualize the binding behavior of chromatin-interacting proteins and analyze changes in the physical properties of nucleosomes.

Tek moleküllü korelasyon kuvveti ve floresan mikroskobu için yerinde nükleozom düzeneği

Nucleosomes constitute the primary unit of eukaryotic chromatin and have been the focus of numerous informative single-molecule investigations regarding ...