Wir danken James Waters, Gable Wadsworth und Bo Broadwater für das Manuskript kritisch zu lesen. Wir danken auch vier anonymen Gutachtern für die Bereitstellung von nützlichen Kommentare. Wir danken für die finanzielle Unterstützung von Georgia Institute of Technology, der Burroughs Wellcome Fund Career Award in der Scientific-Schnittstelle, und dem Studenten-Forschungsnetzwerk Zuschuss von NSF Physik lebender Systeme.

1. DsDNA Probenvorbereitung <ol><li> Gestalten Sie global gekrümmt DNAs durch Wiederholung eines 10-mer-Sequenz. Zum Beispiel 5&#39;-GTGCCAGCAACAGATAGC - (TTTATCATCCTTTATCATCC X) 7 - TTTCATTCGAGCTCGTTGTTG-3 &#39;ist ein 186-bp-DNA gekrümmten wobei X eine Zufalls zusätzlichen Basis und der flankierenden Sequenz die sich wiederholende 10-mer-Sequenz Adaptersequenzen. HINWEIS:. In diesem Beispiel wurden zwei 10-mere mit gegenüberliegenden Präferenzen Nukleosom Bildung auf der Grundlage einer großen Nukleosom Belegung Studie von Kaplan et al 15 gewählt. Da die Schrauben Wiederholung der dsDNA ist nahe bei 10 bp, wird jede Netz Auslenkung der Schraubenachse des 10-mer zu akkumulieren, um eine Form wie ein Kreisbogen (Abbildung 3A) zu erzeugen. Da die Schrauben Zeit ist näher an 10,5 bp, wird eine zusätzliche Basis nach jeweils zwei Wiederholungen eingesetzt, um die gekrümmte Struktur so eben wie möglich zu halten. Diese Sequenzen kürzer als 200 bp aus Companie bestellt werdens Angebot, dass Gen-Synthese-Service. Es ist zweckmäßig, diese Sequenzen mit gemeinsamen Adaptersequenzen für nachfolgende Schritte flankieren. Das Verfahren ist in Fig. 3B schematisch dargestellt. </li><li> Führen Sie die PCR mit Primer 1 (GTGCCAGCAACAGATAGC) und Primer 2 (/ 5Cy3/TAAATTCCTACAACAACGAGCTCGAATG). HINWEIS: Primer 2 mit der FRET-Donor Cy3 am 5&#39;-Ende markiert. Ein typisches PCR-Protokoll Rezept und Radfahren sind in den Tabellen 1 und 2 dargestellt. </li><li> Führen Sie die PCR mit Primer 3 (/ 5BioTEG/GAAACATAG/iCy5/GAATTTACCGTGCCAGCAACAGATAGC) und Primer 4 (CAACAACGAGCTCGAATG). HINWEIS: Primer 3 mit dem FRET-Akzeptor Cy5 durch das Rückgrat und die Biotin-Linker am 5&#39;-Ende markiert. PCR-Rezept und Radfahren Protokoll wie oben. </li><li> Reinige die PCR-Produkte mit Hilfe eines PCR-Reinigung-Kit. </li><li> Mischen die Cy3-markierten Produkt und die Cy5-markierte Produkt in einem Puffer für den Strangaustausch (100 mM NaCl, 10 mM Tris-HCl pH 7,0, 1 mM EDTA) in Endkonzentrationen von 0,4 undNr. 181, M und 0,1 uM. HINWEIS: Die überschüssige Cy3-DNA erhöht die Konzentration des Duplex Durchführung sowohl Cy3 und Cy5 als Ergebnis der Strangaustausch. </li><li> Wechsel Stränge durch Inkubation bei 98,5 ° C für 2 Minuten, allmähliches Abkühlen bis 5 º C Anstiegsrate von 0,1 ° C / sec, und Inkubation bei 5 &#160; ° C für 2 Stunden. </li></ol> 2. Gel-Elektrophorese zu dsDNA Krümmung Detect <ol><li> Gießen Polyacrylamidgel 16,17 durch Mischen Acrylamid und Bisacrylamid Lösungen bei 29.2:0.8 Verhältnis von 5% (w / v) in 1 × Tris / Borat / EDTA (TBE)-Puffer bei pH 8,0. Hinweis: 10 ml Gel-Lösung enthält: 1,217 ml 40% Acrylamid, 0,667 ml 2% Bis-Acrylamid, 1 ml 10x TBE, 100 L Ammoniumpersulfat (APS), 10%, 10 l TEMED, und der Rest ist dH 2 O. Vollständige Verfestigung des Gels beträgt etwa 30 min. </li><li> Laden der Polyacrylamid-Gel mit DNA-Proben und die DNA-Leiter in 1X-Beladungspuffer (5% Glycerin, 0,03% (w / v) Bromphenolblau blue) und führen Sie das Gel bei 5-8 V / cm bei 4 ° C für 45 Minuten oder bis die Farbstofffront nähert sich dem Ende des Gels. </li><li> Färben Sie das Gel mit 1X TBE-Puffer, der 0,5 g / ml Ethidiumbromid für 30 min enthält. Identifizieren Sie die DNA-Banden unter UV-Beleuchtung. Vergleichen Bandpositionen mit der Größe Marker (100 bp DNA-Leiter), um die scheinbare Größe der DNA-Moleküle zu berechnen. HINWEIS: Gebogene DNAs bewegen in der Regel langsamer als gerade DNAs. </li></ol> 3. Durchflusszelle Vorbereitung <ol><li> Drill 6-7 Paare von Löchern, die entlang zwei gegenüberliegenden Rändern eines Glasobjektträgers (3&#39;&#39; × 1&#39;&#39;) unter Verwendung einer Bohrmaschine und Diamantbohrer. Nach dem Bohren, reiben Sie die Folie in fließendem Wasser, um sichtbare Glaspulver zu entfernen. HINWEIS: Die Löcher dienen als Perfusions-und Auslässe. Beim Bohren ist Kühl die Folie mit Wasser wichtig Rissbildung zu vermeiden. </li><li> Legen Sie die Folien aufrecht in ein Glas und füllen es mit Wasser. Beschallen für 15 min und übertragen sie in ein anderes Glas deAceton für Reinigungs dicated. Füllen Sie sie mit Aceton und beschallen für 15 min. Spülen Sie die Folien mit Ethanol mit einer Sprühflasche und dann mit Wasser. Legen Sie sie in einem Polypropylen-Glas, füllen Sie es mit 5 M Kaliumhydroxid und beschallen für 15 min. Schließlich beschallen die Folien in Wasser 15 min. Reinigen Sie die Deckgläser (Nr. 1, 24 x 40 mm) mit dem gleichen Protokoll. HINWEIS: Gereinigt Rutschen und Deckgläser können in dH 2 O für langfristige Gebrauch gespeichert werden. </li><li> Mischen 1 mg Biotin-PEG-Silan (MW 3400) mit 80 mg mPEG-Silan (MW 2000) in 340 L 0,1 M Natriumhydrogencarbonat-Lösung. Gut mischen und zentrifugieren Sie die Mischung kurz auf von Blasen loszuwerden. HINWEIS: Die Funktionalisierung der Oberfläche mit Polyethylenglykol (PEG) trägt zur Verringerung unspezifischer Bindung von DNA an die Oberfläche. </li><li> Setzen Sie 80 L der PEG-Lösung auf jeder Folie und senken Sie ein Deckglas darüber. Warten Sie 45 min. Trennen Sie das Deckglas aus der Folie mit einer Pinzette, spülen Sie sie mit reichlich dH 2 O und sei tSaum trocken im Freien. </li><li> Legen Sie dünne Streifen von doppelseitigem Klebeband auf der Folie, um Kanäle zu bilden. Richten Sie ein Deckglas darüber und drücken Sie fest auf das Deckglas gegen den Schieber, um flüssigkeitsdichte Kanäle bilden. Wählen Sie mit 5 Minuten-Epoxy, um die Kanten der Kanäle zu versiegeln. </li></ol> 4. Vorbereitung der Trolox-Lösung <ol><li> Setzen ~ 30 mg Trolox und 10 ml dH 2 O in einem Kolben und verwenden Sie einen Magneten Rührstab, um die Lösung in der offenen Luft für 18 Stunden rühren. </li><li> Filtern der Lösung unter Verwendung eines 0,2 &amp;mgr; m-Filter und den pH auf 7 durch Zugabe von ~ 6 ul 1 M Tris-Base (pH 11). Hinweis: Trolox ist ein Anti-Reagenz blinkt die üblicherweise in Einzel-Molekül verwendet wird, untersucht 18. Die Wirkung von Trolox Antifading kommt aus seiner oxidierten Derivat, das in teilweise abgebaut Trolox-Lösung 19 vorhanden ist. Schnell Lösen Trolox in Methanol oder hohen pH-Tris-Lösung sollte durch ineffiziente Oxidation vermieden werden. </li></ol> 5. Einzel-molkül Imaging <ol><li> Injizieren 15 ul NeutrAvidin-Lösung (0,5 mg / ml) in den Kanal und Warten für 2 Minuten vor dem Spülen mit 100 ul T50-Puffer (10 mM Tris-HCl, 50 mM NaCl, pH 7,0). </li><li> Injizieren 50 ul DNA-Probe (50-100 pM) in den Kanal. 5 min warten und spülen Sie die ungebundene DNA weg mit 100 L T50-Puffer. HINWEIS: Die DNA-Moleküle spezifisch an die Oberfläche binden durch die NeutrAvidin-Biotin-Wechselwirkung. </li><li> Füllen Sie den Kanal mit der Bildpuffer, die eine sauerstoffbindende System 20 (100 mm Lochkreis, 5 mM PCA, 1 mM Trolox und 500 mM NaCl) enthält. </li><li> Stellen Sie den Rahmen in EMCCD-Übertragungsmodus auf dem Computer mit 25 Bildern pro Sekunde streamen 2 x 2 klassierte Bilder (256 x 256). </li><li> Setzen Sionsöl auf dem Mikroskopobjektiv, und befestigen Sie die Durchflusszelle auf dem Mikroskoptisch mit Probe-Clips. Grob den Fokus, indem man die Laser-Reflexionsmuster an der Wand. Feineinstellung des Fokus mit der Live-Ansicht der Fluoreszenz imAlter auf dem Monitor. </li><li> Beginnt die Datenerfassung mit dem 532-nm-Laser auf. Überprüfen Sie die Live-Ansicht und stellen Sie den Fokus, wenn nötig. Stoppen Sie die Datenerfassung, wenn die meisten Moleküle haben gebleicht. HINWEIS: In dieser Anlage wird ein Labor-C-Programm geschrieben, um die Mikroskopsteuerung und Anzeige von Live-Bildern auf dem Bildschirm, wie sie auf der Festplatte gespeichert sind, verwendet. </li></ol> 6. Bildverarbeitung und Datenanalyse HINWEIS: Eine Zeitreihe von 256 x 256 Bilder werden mit einem MATLAB-Code verarbeitet, um Einzelmolekülzeitverläufe von Cy3-und Cy5-Intensitäten zu erzeugen. Um Pixel zwischen dem Spender und dem Akzeptor-Kanal Kanal des Split-View-Bild-Paare, 6-7 Paare von Cy3 und Cy5-Spots, wobei jedes Paar aus dem gleichen Molekül gleichmäßig über das Sichtfeld verteilt sind, werden von Hand gepflückt, und eine affine Transformation wird unter Verwendung der Koordinaten dieser Punkte als Ankerpunkte berechnet. <ol><li> Mit einem MATLAB-Skript, durch alle Einzelmolekül-Zeit zu suchen Spuren tHut zeigen mehrere Übergänge zwischen niedrigen und hohen FRET-Signale. Identifizieren Sie die geschleift und geloopten Staaten. HINWEIS: Die FRET-Signal wird als das Cy5 Intensität (I a), dividiert durch die Summe der Cy3-und Cy5-Intensitäten (I a + I d). Geschleift Staat hat hohe FRET-Wert, während ungeloopte Zustand niedrigen FRET-Wert hat. Das Histogramm von FRET-Signale von einem einzelnen Molekül ist bimodal wegen reversible Looping und unlooping verteilt. </li><li> Finden Sie die Schwelle, die die beiden Verteilungen durch die Bestimmung der Schnittpunkt zwischen den beiden Einbau Gaußkurven trennt. </li><li> Berechnen Sie die FRET-Effizienz als <img fo:content-width="0.6in" src="/files/ftp_upload/51667/eq7.jpg" /> und weisen Sie die geschleift Staaten mit hohen FRET-Werten und den geloopten Staaten mit niedrigen FRET-Werte. </li><li> Mit einem MATLAB-Skript, analysieren die kumulative Anzahl der Moleküle (N (t)), die eingeschleift (odererreicht die hohe FRET-Zustand) zu verschiedenen Zeitabläufen seit Beginn der Datenerfassung. HINWEIS: Da eine dsDNA-Molekül kann in jeder Konformation des geloopten Zustand zu Beginn der Datenerfassung zu starten, die Steigerungsrate in der Bevölkerung spiegelt die geschlungenen Schleifendurchschnittsrate gemittelt über anfängliche Konformationen. Entpacken Sie die Looping Rate k-Schleife durch den Einbau N (t) mit einer Exponentialfunktion: <img fo:content-width="1.8in" src="/files/ftp_upload/51667/eq1.jpg" /> Wenn biphasisch steigt, kann es mit einem Doppel Exponentialfunktion montiert werden: <img fo:content-width="2.2in" src="/files/ftp_upload/51667/eq2.jpg" /> In diesem Fall ist k Schleife erhalten aus: <img fo:content-width="1.7in" src="/files/ftp_upload/51667/eq3.jpg" /> HINWEIS: Theoretisch ist die Überlebenswahrscheinlichkeit, dass ein Polymer nicht zum Zeitpunkt t geschlungen ist nicht eine einfache oder doppelte Exponentialfunktion 12. Exponential fitting wird als praktisches Mittel, um die durchschnittliche Kreiszeit zu extrahieren. </li></ol> 7. Bestimmung der J-Faktor HINWEIS: Die J-Faktor darstellt, wie konzentriert das eine Ende eines dsDNA ist, um das andere Ende. Es kann durch Interpolieren der Konzentration von einem Ende des Segments der DNA, die die gleiche Reaktionsgeschwindigkeit mit dem anderen Ende des Segments gemessenen Schlingengeschwindigkeit erzeugen würde, bestimmt werden. Experimentell wird ein Endabschnitt auf der Oberfläche immobilisiert ist, und der andere Endabschnitt wird in einer bestimmten Konzentration c eingeführt. Wenn die gemessene Kühlrate zwischen den beiden Enden ist k Glühen, dann wird der Faktor 21 J gegeben durch <img fo:content-width="0.6in" src="/files/ftp_upload/51667/eq4.jpg" /> . Die Kühlrate-Konstante (k = k Glühen Glühen / C) ist unabhängig von der Sondenkonzentration. <ol><li> Fluss 20 ul von 30-50 pM Biotin-Cy5 Oligo (Primer 3) into NeutrAvidin einer beschichteten Kanal. Spülen Sie den Kanal mit 100 ul T50 abzuwaschen ungebundenen Oligos. </li><li> Vorbereitung des Bilderzeugungspuffer, wie in Teil 5 mit dem Zusatz von Cy3 Oligo (Primer 2) in einer Endkonzentration von 50 nM beschrieben. Fluss dieses Bildpuffer in den Kanal. </li><li> Während die 532-nm-Laser auf, kurz drehen Sie den 640-nm-Laser auf Standorte der Oberfläche gebundenen Cy5 Oligos zu identifizieren. Schalten Sie die 640-nm-Laser und starten Sie die Überwachung des FRET-Signals. HINWEIS: Bei der Hybridisierung eines Oligo Cy3 mit einem oberflächengebundenen Oligo Cy5, Cy5-Fluoreszenz wird von FRET auftreten. </li><li> Mit einem MATLAB-Skript, analysieren die Anzahl der Moleküle, die im ungebundenen Zustand (geringe Cy5-Intensität) zu starten, aber später in die geglühten Zustand (hohe Intensität Cy5) drehen als Funktion der Zeit aus den Cy5 Intensität Spuren. </li><li> Zeichnen Sie diese Anzahl von geglüht Moleküle gegen die Zeit. Setzen Sie diese Kurve mit einer einzigen Exponentialfunktion ( <img fo:content-width="1.8in" src="/files/ftp_upload/51667/eq5.jpg"/&gt;), Um die Kühlrate (k Glühen) zu erhalten. </li><li> Wiederholen dieses Experiment bei verschiedenen Cy3 Oligo-Konzentrationen (60, 100 und 180 nM), um die Linearität zwischen der Kühlrate und der Konzentration der Reaktanten zu bestätigen. Entpacken Sie die zweiter Ordnung Glühen Geschwindigkeitskonstante (k Glühen ) Von der Piste. </li><li> Berechnen Sie die J-Faktor aus <img fo:content-width="0.6in" src="/files/ftp_upload/51667/eq6.jpg" /> , Wobei k-Schleife ist der Schlingengeschwindigkeit in der gleichen Pufferbedingungen gemessen. </li></ol>

<ol>
	<li>Garcia, H. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biological+consequences+of+tightly+bent+DNA:+The+other+life+of+a+macromolecular+celebrity.">Biological consequences of tightly bent DNA: The other life of a macromolecular celebrity.</a> Biopolymers. 85, 115-130 (2007).</li><li>Wiggins, P. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+flexibility+of+DNA+on+short+length+scales+probed+by+atomic+force+microscopy.">High flexibility of DNA on short length scales probed by atomic force microscopy.</a> Nature Nanotechnology. 1, (2006).</li><li>Lionberger, T. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cooperative+kinking+at+distant+sites+in+mechanically+stressed+DNA.">Cooperative kinking at distant sites in mechanically stressed DNA.</a> Nucleic Acids Research. 41, 6785-6792 (2011).</li><li>Shore, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+flexibility+studied+by+covalent+closure+of+short+fragments+into+circles.">DNA flexibility studied by covalent closure of short fragments into circles.</a> Proc Natl Acad Sci U S A. 78, 4833-4837 (1981).</li><li>Geggier, S., Vologodskii, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequence+dependence+of+DNA+bending+rigidity.">Sequence dependence of DNA bending rigidity.</a> Proc Nat Acad Sci U S A. 107, 15421-15426 (1992).</li><li>Smith, S. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+mechanical+measurements+of+the+elasticity+of+single+DNA+molecules+by+using+magnetic+beads.">Direct mechanical measurements of the elasticity of single DNA molecules by using magnetic beads.</a> Science. 258, 1122-1126 (1992).</li><li>Peters, J. P., Maher, L. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+curvature+and+flexibility+in+vitro+and+in+vivo.">DNA curvature and flexibility in vitro and in vivo.</a> Quarterly Reviews of Biophysics. 43, 23-63 (2010).</li><li>Cloutier, T. E., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneous+sharp+bending+of+double-stranded+DNA.">Spontaneous sharp bending of double-stranded DNA.</a> Molecular Cell. 14, 355-362 (2004).</li><li>Du, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclization+of+short+DNA+fragments+and+bending+fluctuations+of+the+double+helix.">Cyclization of short DNA fragments and bending fluctuations of the double helix.</a> Proc Natl Acad Sci U S A. 102, 5397-5402 (2005).</li><li>Yuan, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=T4+DNA+ligase+is+more+than+an+effective+trap+of+cyclized+dsDNA.">T4 DNA ligase is more than an effective trap of cyclized dsDNA.</a> Nucl. Acids Res. 35, 5294-5302 (2007).</li><li>Manzo, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+effect+of+nonspecific+binding+of+lambda+repressor+on+DNA+looping+dynamics.">The effect of nonspecific binding of lambda repressor on DNA looping dynamics.</a> Biophysical Journal. 103, 1753-1761 (2012).</li><li>Le, T. T., Kim, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measuring+shape-dependent+looping+probability+of+DNA.">Measuring shape-dependent looping probability of DNA.</a> Biophys. J. 104, 2068-2076 (2013).</li><li>Vafabakhsh, R., Ha, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extreme+bendability+of+DNA+less+than+100+base+pairs+long+revealed+by+single-molecule+cyclization.">Extreme bendability of DNA less than 100 base pairs long revealed by single-molecule cyclization.</a> Science. 337, 1097-1101 (2012).</li><li>Friedman, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viewing+dynamic+assembly+of+molecular+complexes+by+multi-wavelength+single-molecule+fluorescence.">Viewing dynamic assembly of molecular complexes by multi-wavelength single-molecule fluorescence.</a> Biophysical Journal. 91, 1023-1031 (2006).</li><li>Kaplan, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+DNA-encoded+nucleosome+organization+of+a+eukaryotic+genome.">The DNA-encoded nucleosome organization of a eukaryotic genome.</a> Nature. 458, 362-366 (2009).</li><li>Koo, H. S., Crothers, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calibration+of+DNA+curvature+and+a+unified+description+of+sequence-directed+bending.">Calibration of DNA curvature and a unified description of sequence-directed bending.</a> Proc Nat Acad Sci U S A. 85, 1763-1767 (1988).</li><li>Prosseda, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+temperature-induced+narrow+DNA+curvature+range+sustains+the+maximum+activity+of+a+bacterial+promoter+in+vitro.">A temperature-induced narrow DNA curvature range sustains the maximum activity of a bacterial promoter in vitro.</a> Biochemistry. 49, 2778-2785 (2010).</li><li>Rasnik, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonblinking+and+long-lasting+single-molecule+fluorescence+imaging.">Nonblinking and long-lasting single-molecule fluorescence imaging.</a> Nature Methods. 3, 891-893 (2006).</li><li>Cordes, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+mechanism+of+Trolox+as+antiblinking+and+antibleaching+reagent.">On the mechanism of Trolox as antiblinking and antibleaching reagent.</a> J. Am. Chem. Soc. 131, 5018-5019 (2009).</li><li>Aitken, C. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+oxygen+scavenging+system+for+improvement+of+dye+stability+in+single-molecule+fluorescence+experiments.">An oxygen scavenging system for improvement of dye stability in single-molecule fluorescence experiments.</a> Biophys J. 94, 1826-1835 (2008).</li><li>Taylor, W. H., Hagerman, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+the+method+of+phage+T4+DNA+ligase-catalyzed+ring-closure+to+the+study+of+DNA+structure:+II.+NaCl-dependence+of+DNA+flexibility+and+helical+repeat.">Application of the method of phage T4 DNA ligase-catalyzed ring-closure to the study of DNA structure: II. NaCl-dependence of DNA flexibility and helical repeat.</a> Journal of Molecular Biology. 212, 363-376 (1990).</li><li>Bolshoy, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Curved+DNA+without+A-A:+experimental+estimation+of+all+16+DNA+wedge+angles.">Curved DNA without A-A: experimental estimation of all 16 DNA wedge angles.</a> Proc Natl Acad Sci U S A. 88, 2312-2316 (1991).</li><li>Gibson, D. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthesis+of+DNA+fragments+in+yeast+by+one-step+assembly+of+overlapping+oligonucleotides.">Synthesis of DNA fragments in yeast by one-step assembly of overlapping oligonucleotides.</a> Nucl. Acids Res. 37, 6984-6990 (2009).</li><li>Vologodskii, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bending+of+short+DNA+helices.">Bending of short DNA helices.</a> Artif DNA PNA XNA. 4, (2013).</li><li>Hoover, D. M., Lubkowski, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNAWorks:+an+automated+method+for+designing+oligonucleotides+for+PCR-based+gene+synthesis.">DNAWorks: an automated method for designing oligonucleotides for PCR-based gene synthesis.</a> Nucl. Acids Res. 30, (2002).</li><li>Waters, J. T., Kim, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Equilibrium+Statistics+of+a+Surface-Pinned+Semiflexible+Polymer.">Equilibrium Statistics of a Surface-Pinned Semiflexible Polymer.</a> Macromolecules. 46, 6659-6666 (2013).</li><li>Mills, J. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electrophoretic+evidence+that+single-stranded+regions+of+1+or+more+nucleotides+dramatically+increase+the+flexibility+of+DNA.">Electrophoretic evidence that single-stranded regions of 1 or more nucleotides dramatically increase the flexibility of DNA.</a> Biochemistry. 33, 1797-1803 (1994).</li></ol>

Die Autoren erklären, keine Interessenkonflikte.

Eine einfache Einzelmolekül-FRET-Assay, der auf Looping wurde verwendet, um die Kinetik der DNA von verschiedenen Eigenformen zu studieren. Gekrümmt DNAs können durch Wiederholen eines 10-mer-Sequenz in Phase mit dem Schrauben Zeitraum von 10,5 bp, hergestellt werden, und deren Krümmungen mit PAGE abgeschätzt werden. Diese dsDNAs werden mit klebrigen Enden entwickelt, um transienten Schleife Stabilisierung ermöglichen. Es extrahiert den Schlingengeschwindigkeit von der exponentiellen Anstieg in der Anzahl der Mole...

Das Verständnis der mechanischen Eigenschaften von dsDNA ist von grundlegender Bedeutung in der Grundlagenwissenschaften und technische Anwendungen. Die Struktur der dsDNA ist komplizierter als eine gerade, weil spiralförmigen Leiter Rolle, Neige-und Verdrehungswinkel zwischen aufeinanderfolgenden Basenpaare mit der Sequenz variieren. Temperaturschwankungen können dazu führen, dsDNA zu unterschiedlichen Modi Konformationsfluktuationen wie Biegen, Verdrehen und Strecken unterzogen werden. Übergänge wie Schmelzen und Knicken kann auch unter extremen Bedingungen auftreten. Unter dieser Bewegungen hat dsDNA Biege die auffälligste biologische Wirkung ein. dsDNA Biegung mit Gen-Repression oder Aktivierung, indem zwei entfernten Standorten nahe einander zugeordnet. Es spielt auch eine wichtige Rolle bei der DNA-Verpackung im Zellkern oder ein virales Kapsid. Biegeverformung dsDNA kann experimentell durch die hochauflösende Mikroskopie (AFM-und TEM-2 3) und der ThermoDyn visualisiert werdenamics und Kinetik kann durch Looping-Assays, die chemisch verbinden nebeneinander liegenden Stellen des dsDNA sucht werden. Ein solcher Test ist Ligase-abhängig Cyclisierung 4. In diesem Assay werden dsDNA-Molekülen mit &quot;klebrig&quot; (kohäsiven) Enden zirkularisiert oder durch DNA-Ligase dimerisiert. Durch Vergleichen der Raten der Kreis und die Dimer-Bildung, kann man eine effektive molare Konzentration von einem Ende der DNA in der Nähe des anderen Endes, die als J-Faktor bekannt ist, erhalten. Dieser Faktor ist dimensions J entspricht der Wahrscheinlichkeitsdichte des Findens ein Ende der DNA in einem kurzen Abstand von dem anderen Ende, und spiegelt damit die Flexibilität der DNA. Die Messung der J-Faktor als Funktion der DNA-Länge zeigt viele Merkmale über die DNA Mechanik einschließlich der Persistenz Länge 4,5. Das wurmartige Kette (WLC)-Modell wurde weithin als der kanonischen Polymer-Modell für dsDNA Mechanik basierend auf dem Erfolg in Erklärungen angesehenining der Kraft-Dehnungs-Kurven in DNA ziehen Experimente 6 und richtig Vorhersage der J Faktoren dsDNAs länger als 200 bp 7 erhalten. Allerdings mit der Cyclisierung Assay an dsDNA-Moleküle so kurz wie 100 bp, Cloutier und Widom maßen die J Faktoren, um mehrere Größenordnungen höher als die WLC-Modell-Vorhersage 8 sein. Ein Jahr später, Du et al. J Faktoren erzeugt im Einvernehmen mit dem WLC-Modell mit dem Cyclisierung Assay mit niedrigeren Konzentrationen von Ligase und schrieb den anomalen Ergebnis aus der Gruppe Widom hohen Konzentrationen verwendet Ligase 9. Diese Kontroverse zeigt beispielhaft die unvermeidlichen Einfluss der DNA-Ligase auf Cyclisierung Kinetik bei Verwendung der herkömmlichen Assay 9. Darüber hinaus kann auch auf DNA-Ligase DNA-Struktur und Steifigkeit durch unspezifische Bindung 10,11. Um die technischen Belange der Protein-abhängige Looping-Assays zu beseitigen, vor kurzem haben wir gezeigt, eine protein-kostenlos Looping Assay, der auf Fluoreszenz-Resonanz-Energie-Transfer (FRET) 12. In diesem Verfahren werden geschleift Konformationen von FRET zwischen dem Donor und Akzeptor in der Nähe der klebrigen Enden eines DNA-Moleküls gebunden nachgewiesen. Eine Totalreflexions-Fluoreszenzmikroskopobjektiv-Typ (TIRF) verwendet, um Bahnen der reversible Looping und unlooping Ereignisse von der Oberfläche immobilisierten DNA-Einzelmoleküle für einen längeren Zeitraum aufzuzeichnen. Diese Methode bietet PCR-basierten Aufbau von DNA-Molekülen an Mismatch-freie DNA-Moleküle, die eine entscheidende Verbesserung gegenüber einer ähnlichen Methode Vafabakhsh und Ha 13 zu generieren. Die Einzelmolekül-Aspekt dieses Protokoll ermöglicht die Messung von Verteilungen zusätzlich zu Durchschnittswerte Ensemble während der FRET-Aspekt ermöglicht es, DNA-Looping Dynamik wiederholt aus dem gleichen Molekül messen, auch unter Bedingungen, die Ligase-Aktivität beeinträchtigen können. Die TIRFM Aufbau ist in Abbildung 1 dargestellt. Eine benutzerdefinierteGestalteten Probentisch wird über eine Olympus IX61 Mikroskop Körper platziert. 532 nm und 640 nm-Laser von der Seite eingeführt werden und durch kleine elliptische Spiegel 14 in den hohen NA Ziel reflektiert wird, um kritische Einfallswinkel, unter dem Deckglas-Wasser-Grenzfläche zu erreichen. Wir stellen fest, dass eine weit verbreitete Durch Ziel TIR mit dichroitischen Spiegeln oder Prismen TIR-basierte Setups können auch für diese FRET-Anwendung verwendet werden. Das Fluoreszenzbild durch das Mikroskop gebildet wird durch einen dichroitischen Spiegel in Donor-und Akzeptor-Bilder aufgeteilt. Sie werden dann auf beiden Hälften eines EMCCD erneut abgebildet. Weitere Langpassemissionsfilter verwendet werden, um Hintergrundsignal zu reduzieren. Die Temperaturregelung ist unerlässlich für den Erwerb reproduzierbare kinetischen Daten. Zur Temperaturregelung wird das Ziel aus dem Mundstück des Mikroskopkörpers um die Wärmeübertragung und Wasser von einer Temperatur gesteuert Kühler / Heizung minimieren getrennt durch eine Messing-Kragen, die eng passt in Umlaufum die innere Metall unter der Ziel-Jacke. Diese Einrichtung ist in der Lage, stabile Temperaturregelung an der Deckfläche zwischen 15 und 50 ° C (Fig. 2) zu erreichen. In dieser Arbeit wurde die Probentemperatur auf 24 ° C gehalten wird Das folgende Protokoll zeigt die Schritt-für-Schritt-Verfahren für die DNA-Konstruktion, die Einschätzung der DNA-Form, Einzelmolekül-Experiments, und J-Faktor Bestimmung.

<table><tbody><tr><td>Small DNA FRAG Extract Kit-100PR</td><td>VWR</td><td>97060-558</td><td></td></tr><tr><td>Acrylamide 40% solution 500 ml</td><td>VWR</td><td>97064-522</td><td></td></tr><tr><td>Bis-acrylamide 2% (w/v) solution 500 ml</td><td>VWR</td><td>97063-948</td><td></td></tr><tr><td>GeneRuler 100 bp DNA Ladder, 100-1,000 bp</td><td>Fermentas</td><td>SM0241</td><td></td></tr><tr><td>Mini Vertical PAGE System</td><td>VWR</td><td>89032-300</td><td></td></tr><tr><td>Syringe filter 0.2 &amp;mu;m CS50</td><td>VWR</td><td>A2666</td><td></td></tr><tr><td>Trolox</td><td>Sigma-Aldrich</td><td>238813-1G</td><td>triplet state quencher</td></tr><tr><td>Protocatechuic acid (PCA)</td><td>Sigma-Aldrich</td><td>08992-50MG</td><td>oxygen scavenging system</td></tr><tr><td>Protocatechuate 3,4-Dioxygenase (PCD)</td><td>Sigma-Aldrich</td><td>P8279-25UN</td><td>oxygen scavenging system</td></tr><tr><td>mPEG-silane, MW 2,000 1 g</td><td>Laysan Bio</td><td>MPEG-SIL-2000-1g</td><td></td></tr><tr><td>Biotin-PEG-Silane, MW 3,400</td><td>Laysan Bio</td><td>Biotin-PEG-SIL-3400-1g</td><td></td></tr><tr><td>Avidin, NeutrAvidin Biotin-binding Protein</td><td>Invitrogen</td><td>A2666</td><td></td></tr><tr><td>Phusion Hot Start High-Fidelity DNA Polymerase</td><td>New England Biolabs</td><td>F-540L</td><td></td></tr><tr><td>Gel/PCR DNA Fragments Extraction Kit</td><td>IBI Scientific</td><td>IB47020</td><td></td></tr><tr><td>Premium plain glass microscope slides</td><td>Fisher Scientific</td><td>12-544-1</td><td></td></tr><tr><td>VWR micro cover glass, rectangular, no. 1</td><td>VWR</td><td>48404-456</td><td></td></tr><tr><td>Fisher Scientific Isotemp 1006S Recirculating Chiller/Heater</td><td>Fisher Scientific</td><td></td><td>temperature control</td></tr><tr><td>Objective Cooling Collar</td><td>Bioptechs</td><td>150303</td><td>temperature control</td></tr><tr><td>KMI53 Biological Micrometer Measuring Stage</td><td>Semprex</td><td>KMI53</td><td></td></tr><tr><td>High Performance DPSS Laser 532 nm 50 mW</td><td>Edmund optics</td><td>NT66-968</td><td>Cy3 excitation</td></tr><tr><td>CUBE Fiber Pigtailed 640 nm, 30 mW, Fiber, FC/APC Connector</td><td>Coherent</td><td>1139604</td><td>Cy5 excitation</td></tr><tr><td>650 nm BrightLine Dichroic Beamsplitter</td><td>Semrock</td><td>FF650-Di01-25x36</td><td>splitting dichroic</td></tr><tr><td>LaserMUX Beam Combiner, reflects 514.5, 532, &amp;amp; 543.5 nm lasers, 25 mm</td><td>Semrock</td><td>LM01-552-25</td><td>combining dichroic</td></tr><tr><td>Brightline Fluorescence Filter 593/40</td><td>Semrock</td><td>FF01-593/40-25</td><td>Cy3 emission filter</td></tr><tr><td>635 nm EdgeBasic LWP longpass Filter, 25 mm</td><td>Semrock</td><td>BLP01-635R-25</td><td>Cy5 emission filter</td></tr><tr><td>EMCCD iXon+</td><td>Andor Technology</td><td>DU-897E-CS0-#BV</td><td></td></tr><tr><td>IX51 inverted microscope frame</td><td>Olympus</td><td></td><td></td></tr><tr><td>Objective UApo N 100X/1.49 Oil TIRF</td><td>Olympus</td><td></td><td></td></tr><tr><td>Immersion oil type-F for fluorescence microscopy</td><td>Olympus</td><td>IMMOIL-F30CC</td><td></td></tr><tr><td>2 mm Diameter 45&amp;deg; Rod Lens Aluminum Coated&amp;nbsp;</td><td>Edmund optics</td><td>54-092</td><td>miniature mirror</td></tr><tr><td>1/4&quot; Travel Single-Axis Translation Stage</td><td>Thorlabs</td><td>MS-1</td><td>translation of miniature mirror</td></tr><tr><td>&amp;Oslash;1&quot; Achromatic Doublet, ARC: 400-700 nm, f=200 mm</td><td>Thorlabs</td><td>AC254-200-A</td><td>focusing lens</td></tr><tr><td>Adjustable Mechanical Slit</td><td>Thorlabs</td><td>VA100</td><td></td></tr><tr><td>Dielectric Mirror</td><td>Thorlabs</td><td>BB1-E02</td><td></td></tr><tr><td>&amp;Oslash;1&quot; Achromatic Doublet, f = 100 mm</td><td>Thorlabs</td><td>AC254-100-A</td><td>relay lens</td></tr><tr><td>Lens Mount for &amp;Oslash;1&quot; Optics</td><td>Thorlabs</td><td>LMR1</td><td></td></tr><tr><td>Dichroic Filter Mount</td><td>Thorlabs</td><td>FFM1</td><td></td></tr><tr><td>Fixed Cage Cube Platform</td><td>Thorlabs</td><td>B3C</td><td></td></tr><tr><td>Kinematic Mount for &amp;Oslash;1&quot; Optics</td><td>Thorlabs</td><td>KM100</td><td></td></tr><tr><td>N-BK7 Plano-Convex Lens, &amp;Oslash;1&quot;, f = 40 mm</td><td>Thorlabs</td><td>LA1422-A</td><td>collimating lens</td></tr><tr><td>N-BK7 Plano-Convex Lense, &amp;Oslash;6.0 mm, f = 15 mm</td><td>Thorlabs</td><td>LA1222-A</td><td>telescope lens</td></tr><tr><td>N-BK7 Plano-Convex Lense, &amp;Oslash;6.0 mm, f = 150 mm</td><td>Thorlabs</td><td>LA1433-A</td><td>telescope lens</td></tr></tbody></table>

studying dna looping by single-molecule fret

Biegen der Doppelstrang-DNA (dsDNA) mit vielen wichtigen biologischen Prozessen wie der DNA-Protein-DNA-Erkennung und Verpackung in Nukleosomen verbunden. Thermodynamik der dsDNA Biege wurde durch eine Methode namens Cyclisierung, die auf DNA-Ligase kovalent zu verbinden setzt kurz klebrigen Enden eines dsDNA sucht. Allerdings kann Ligationseffizienz durch viele Faktoren, die nicht verwandt sind dsDNA Looping, wie die DNA-Struktur rund um die klebrigen Enden verbunden, und Ligase betroffen sein können auch die scheinbare Schleifenrate beeinflussen durch Mechanismen wie unspezifische Bindung. Hier zeigen wir, wie man dsDNA Looping Kinetik ohne Ligase durch Erfassen transienter DNA-Schleifenbildung durch FRET (Fluorescence Resonance Energy Transfer) zu messen. dsDNA-Moleküle werden mit einem einfachen PCR-basiertes Protokoll mit einem FRET-Paar und einem Biotin-Linker konstruiert. Die Schleifenwahrscheinlichkeitsdichte als die J-Faktor bekannt ist, aus dem Looping Rate und der Kühlrate zwischen zwei abschaltung extrahiertted klebrigen Enden. Durch das Testen zwei dsDNAs mit verschiedenen intrinsischen Krümmungen zeigen wir, dass die J-Faktor ist sensibel für die Eigenform der dsDNA.

DNA-Moleküle für die Untersuchung verwendet Schleifen bestehen aus einem Duplexregion der variablen Sequenz und Länge und einzelsträngige Überhänge, welche komplementär zueinander sind. Die Überhänge, die 7-Basis lang sind, können miteinander zu glühen, um die Loop-Zustand zu erfassen. Jeder Überstand enthält entweder Cy3 oder Cy5, die in dem DNA-Rückgrat durch Amiditchemie verbunden ist. Die Cy5-Überhang ist auch mit Biotin-TEG (15-Atom-Tetra-Ethylen-Glykol-Abstandshalter) für die Oberflächen Immobilis...

Watch this Scientific Journal Video about Studying DNA Looping by Single-Molecule FRET at JoVE.com

Studying DNA Looping by Single-Molecule FRET

Diese Studie stellt eine detaillierte experimentelle Verfahren zur Looping Dynamik der Doppelstrang-DNA mit Einzelmolekül-Fluoreszenz-Resonanz-Energie-Transfer (FRET) zu messen. Das Protokoll beschreibt auch, wie die Looping-Wahrscheinlichkeitsdichte genannt J-Faktor zu extrahieren.

Studieren von DNA-Looping von Einzelmolekül-FRET

Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into ...

studying-dna-looping-by-single-molecule-fret

Universidad de Cartagena UDEC

Research

JoVE Journal

Biology

15.3K Aufrufe.  Georgia Institute of Technology.  Diese Studie stellt eine detaillierte experimentelle Verfahren zur Looping Dynamik der Doppelstrang-DNA mit Einzelmolekül-Fluoreszenz-Resonanz-Energie-Transfer (FRET) zu messen. Das Protokoll beschreibt auch, wie die Looping-Wahrscheinlichkeitsdichte genannt J-Faktor zu extrahieren. 

Serie: Studying DNA Looping by Single-Molecule FRET

High Precision FRET at Single-molecule Level for Biomolecule Structure Determination

A protocol on how to perform high-precision interdye distance measurements using F&#246;rster resonance energy transfer (FRET) at the single-molecule level in multiparameter fluorescence detection (MFD) mode is presented here. MFD maximizes the usage of all &#34;dimensions&#34; of fluorescence to reduce photophysical and experimental artifacts and allows for the measurement of interdye distance with an accuracy up to ~1 &#197; in rigid biomolecules. This method was used to identify three conformational states of the ligand-binding domain of the N-methyl-D-aspartate (NMDA) receptor to explain the activation of the receptor upon ligand binding. When comparing the known crystallographic structures with experimental measurements, they agreed within less than 3 &#197; for more dynamic biomolecules. Gathering a set of distance restraints that covers the entire dimensionality of the biomolecules would make it possible to provide a structural model of dynamic biomolecules.

A protocol for high-precision FRET experiments at the single molecule level is presented here. Additionally, this methodology can be used to identify three conformational states in the ligand-binding domain of the N-methyl-D-aspartate (NMDA) receptor. Determining precise distances is the first step towards building structural models based on FRET experiments.

Hochpräzisions-FRET auf Einzelmolekül-Niveau für die Bestimmung der Biomolekülstruktur

A protocol on how to perform high-precision interdye distance measurements using F&#246;rster resonance energy transfer (FRET) at the single-molecule ...

Forschung

Biochemie

A Simple, Robust, and High Throughput Single Molecule Flow Stretching Assay Implementation for Studying Transport of Molecules Along DNA

We describe a simple, robust and high throughput single molecule flow-stretching assay for studying 1D diffusion of molecules along DNA. In this assay, glass coverslips are functionalized in a one-step reaction with silane-PEG-biotin. Flow cells are constructed by sandwiching an adhesive tape with pre-cut channels between a functionalized coverslip and a PDMS slab containing inlet and outlet holes. Multiple channels are integrated into one flow cell and the flow of reagents into each channel can be fully automated, which significantly increases the assay throughput and reduces hands-on time per assay. Inside each channel, biotin-&#955;-DNAs are immobilized on the surface and a laminar flow is applied to flow-stretch the DNAs. The DNA molecules are stretched to &#62;80% of their contour length and serve as spatially extended templates for studying the binding and transport activity of fluorescently labeled molecules. The trajectories of single molecules are tracked by time-lapse Total Internal Reflection Fluorescence (TIRF) imaging. Raw images are analyzed using streamlined custom single particle tracking software to automatically identify trajectories of single molecules diffusing along DNA and estimate their 1D diffusion constants.

This protocol demonstrates a simple, robust and high throughput single molecule flow-stretching assay for studying one-dimensional (1D) diffusion of molecules along DNA.

Einfach, Robust und hohen Durchsatz Molekül fließen Stretching Assay-Implementierung für das Studium Transport von Molekülen entlang DNA

We describe a simple, robust and high throughput single molecule flow-stretching assay for studying 1D diffusion of molecules along DNA. In this assay, ...

Probing The Structure And Dynamics Of Nucleosomes Using Atomic Force Microscopy Imaging

Chromatin, which is a long chain of nucleosome subunits, is a dynamic system that allows for such critical processes as DNA replication and transcription to take place in eukaryotic cells. The dynamics of nucleosomes provides access to the DNA by replication and transcription machineries, and critically contributes to the molecular mechanisms underlying chromatin functions. Single-molecule studies such as atomic force microscopy (AFM) imaging have contributed significantly to our current understanding of the role of nucleosome structure and dynamics. The current protocol describes the steps enabling high-resolution AFM imaging techniques to study the structural and dynamic properties of nucleosomes. The protocol is illustrated by AFM data obtained for the centromere nucleosomes in which H3 histone is replaced with its counterpart centromere protein A (CENP-A). The protocol starts with the assembly of mono-nucleosomes using a continuous dilution method. The preparation of the mica substrate functionalized with aminopropyl silatrane (APS-mica) that is used for the nucleosome imaging is critical for the AFM visualization of nucleosomes described and the procedure to prepare the substrate is provided. Nucleosomes deposited on the APS-mica surface are first imaged using static AFM, which captures a snapshot of the nucleosome population. From analyses of these images, such parameters as the size of DNA wrapped around the nucleosomes can be measured and this process is also detailed. The time-lapse AFM imaging procedure in the liquid is described for the high-speed time-lapse AFM that can capture several frames of nucleosome dynamics per second. Finally, the analysis of nucleosome dynamics enabling the quantitative characterization of the dynamic processes is described and illustrated.

Here, we present a protocol to characterize nucleosome particles at the single-molecule level using static and time-lapse atomic force microscopy (AFM) imaging techniques. The surface functionalization method described allows for the capture of the structure and dynamics of nucleosomes in high-resolution at the nanoscale.

Erforschung der Struktur und Dynamik der Nukleosomen mit Atomic Force Microscopy Imaging

Chromatin, which is a long chain of nucleosome subunits, is a dynamic system that allows for such critical processes as DNA replication and transcription ...

Magnetic Tweezers for the Measurement of Twist and Torque

Single-molecule techniques make it possible to investigate the behavior of individual biological molecules in solution in real time. These techniques include so-called force spectroscopy approaches such as atomic force microscopy, optical tweezers, flow stretching, and magnetic tweezers. Amongst these approaches, magnetic tweezers have distinguished themselves by their ability to apply torque while maintaining a constant stretching force. Here, it is illustrated how such a &#8220;conventional&#8221; magnetic tweezers experimental configuration can, through a straightforward modification of its field configuration to minimize the magnitude of the transverse field, be adapted to measure the degree of twist in a biological molecule. The resulting configuration is termed the freely-orbiting magnetic tweezers. Additionally, it is shown how further modification of the field configuration can yield a transverse field with a magnitude intermediate between that of the &#8220;conventional&#8221; magnetic tweezers and the freely-orbiting magnetic tweezers, which makes it possible to directly measure the torque stored in a biological molecule. This configuration is termed the magnetic torque tweezers. The accompanying video explains in detail how the conversion of conventional magnetic tweezers into freely-orbiting magnetic tweezers and magnetic torque tweezers can be accomplished, and demonstrates the use of these techniques. These adaptations maintain all the strengths of conventional magnetic tweezers while greatly expanding the versatility of this powerful instrument.

Magnetic tweezers, a powerful single-molecule manipulation technique, can be adapted for the direct measurements of the twist (using a configuration called freely-orbiting magnetic tweezers) and torque (using a configuration termed magnetic torque tweezers) in biological macromolecules. Guidelines for performing such measurements are given, including applications to the study of DNA and associated nucleo-protein filaments.

Magnetische Pinzette zur Messung von Dreh-und Drehmoment

Single-molecule techniques make it possible to investigate the behavior of individual biological molecules in solution in real time. These techniques ...

Biotechnik

Nanomanipulation of Single RNA Molecules by Optical Tweezers

A large portion of the human genome is transcribed but not translated. In this post genomic era, regulatory functions of RNA have been shown to be increasingly important. As RNA function often depends on its ability to adopt alternative structures, it is difficult to predict RNA three-dimensional structures directly from sequence. Single-molecule approaches show potentials to solve the problem of RNA structural polymorphism by monitoring molecular structures one molecule at a time. This work presents a method to precisely manipulate the folding and structure of single RNA molecules using optical tweezers. First, methods to synthesize molecules suitable for single-molecule mechanical work are described. Next, various calibration procedures to ensure the proper operations of the optical tweezers are discussed. Next, various experiments are explained. To demonstrate the utility of the technique, results of mechanically unfolding RNA hairpins and a single RNA kissing complex are used as evidence. In these examples, the nanomanipulation technique was used to study folding of each structural domain, including secondary and tertiary, independently. Lastly, the limitations and future applications of the method are discussed.

Optical tweezers have been used to study RNA folding by stretching individual molecules from their 5&#8217; and 3&#8217; ends. Here common procedures are described to synthesize RNA molecules for tweezing, calibration of the instrument, and methods to manipulate single molecules.

Nanomanipulation von RNA-Einzelmoleküle durch Optische Pinzetten

A large portion of the human genome is transcribed but not translated. In this post genomic era, regulatory functions of RNA have been shown to be ...

Dual DNA Rulers to Study the Mechanism of Ribosome Translocation with Single-Nucleotide Resolution

The ribosome translocation refers to the ribosomal movement on the mRNA by exactly three nucleotides (nt), which is the central step in protein synthesis. To investigate its mechanism, there are two essential technical requirements. First is single-nt resolution that can resolve normal translocation from frameshifting, during which the ribosome moves by other than 3 nt. The second is the capability to probe both the entrance and exit sides of mRNA in order to elucidate the whole picture of translocation. We report the dual DNA ruler assay that is based on the critical dissociation forces of DNA-mRNA duplexes, obtained by force-induced remnant magnetization spectroscopy (FIRMS).&#160; With 2-4 pN force resolution, the dual ruler assay is sufficient to distinguish different translocation steps. By implementing a long linker on the probing DNAs, they can reach the mRNA on the opposite side of the ribosome, so that the mRNA position can be determined for both sides. Therefore, the dual ruler assay is uniquely suited to investigate the ribosome translocation, and nucleic acid motion in general. We show representative results which indicated a looped mRNA conformation and resolved normal translocation from frameshifting.

Dual DNA ruler assay is developed to determine the mRNA position during ribosome translocation, which relies on the dissociation forces of the formed DNA-mRNA duplexes. With single-nucleotide resolution and capability of reaching both ends of mRNA, it can provide mechanistic insights for ribosome translocation and probe other nucleic acid displacements.

Dual DNA Lineale zur Untersuchung des Mechanismus der Ribosomentranslokation mit Single-Nukleotid-Auflösung

The ribosome translocation refers to the ribosomal movement on the mRNA by exactly three nucleotides (nt), which is the central step in protein synthesis. ...

R-Loop Analysis by Dot-Blot

The three-stranded nucleic acid structure, R-loop, is increasingly recognized for its role in gene regulation. Initially, R-loops were thought to be the by-products of transcription; but recent findings of fewer R-loops in diseased cells made it clear that R-loops have functional roles in a variety of human cells. Next, it is critical to understand the roles of R-loops and how cells balance their abundance. A challenge in the field is the quantitation of R-loops since much of the work relies on the S9.6 monoclonal antibody whose specificity for RNA-DNA hybrids has been questioned. Here, we use dot-blots with the S9.6 antibody to quantify R-loops and show the sensitivity and specificity of this assay with RNase H, RNase T1, and RNase III that cleave RNA-DNA hybrids, single-stranded RNA, and double-stranded RNA, respectively. This method is highly reproducible, uses general laboratory equipment and reagents, and provides results within two days. This assay can be used in research and clinical settings to quantify R-loops and assess the effect of mutations in genes such as senataxin on R-loop abundance.

This protocol details a simple method that quantifies R-loop, a three-stranded nucleic acid structure that comprises of an RNA-DNA hybrid and a displaced DNA strand.

The three-stranded nucleic acid structure, R-loop, is increasingly recognized for its role in gene regulation. Initially, R-loops were thought to be the ...

Genetik

Optical Tweezers to Study RNA-Protein Interactions in Translation Regulation

RNA adopts diverse structural folds, which are essential for its functions and thereby can impact diverse processes in the cell. In addition, the structure and function of an RNA can be modulated by various trans-acting factors, such as proteins, metabolites or other RNAs. Frameshifting RNA molecules, for instance, are regulatory RNAs located in coding regions, which direct translating ribosomes into an alternative open reading frame, and thereby act as gene switches. They may also adopt different folds after binding to proteins or other trans-factors. To dissect the role of RNA-binding proteins in translation and how they modulate RNA structure and stability, it is crucial to study the interplay and mechanical features of these RNA-protein complexes simultaneously.&#160;This work illustrates how to employ single-molecule-fluorescence-coupled optical tweezers to explore the conformational and thermodynamic landscape of RNA-protein complexes at a high resolution. As an example, the interaction of the SARS-CoV-2 programmed ribosomal frameshifting element with the trans-acting factor short isoform of zinc-finger antiviral protein is elaborated. In addition, fluorescence-labeled ribosomes were monitored using the confocal unit, which would ultimately enable the study of translation elongation. The fluorescence coupled OT assay can be widely applied to explore diverse RNA-protein complexes or trans-acting factors regulating translation and could facilitate studies of RNA-based gene regulation.

This protocol presents a complete experimental workflow for studying RNA-protein interactions using optical tweezers. Several possible experimental setups are outlined including the combination of optical tweezers with confocal microscopy.

Optische Pinzette untersucht RNA-Protein-Interaktionen in der Translationsregulation

RNA adopts diverse structural folds, which are essential for its functions and thereby can impact diverse processes in the cell. In addition, the ...

Single-Molecule Imaging of EWS-FLI1 Condensates Assembling on DNA

The fusion genes resulting from chromosomal translocation have been found in many solid tumors or leukemia. EWS-FLI1, which belongs to the FUS/EWS/TAF15 (FET) family of fusion oncoproteins, is one of the most frequently involved fusion genes in Ewing sarcoma. These FET family fusion proteins typically harbor a low-complexity domain (LCD) of FET protein at their N-terminus and a DNA-binding domain (DBD) at their C-terminus. EWS-FLI1 has been confirmed to form biomolecular condensates at its target binding loci due to LCD-LCD and LCD-DBD interactions, and these condensates can recruit RNA polymerase II to enhance gene transcription. However, how these condensates are assembled at their binding sites remains unclear. Recently, a single-molecule biophysics method-DNA Curtains-was applied to visualize these assembling processes of EWS-FLI1 condensates. Here, the detailed experimental protocol and data analysis approaches are discussed for the application of DNA Curtains in studying the biomolecular condensates assembling on target DNA.

Here, we describe the use of the single-molecule imaging method, DNA Curtains, to study the biophysical mechanism of EWS-FLI1 condensates assembling on DNA.

Einzelmolekül-Bildgebung von EWS-FLI1-Kondensaten auf DNA

The fusion genes resulting from chromosomal translocation have been found in many solid tumors or leukemia. EWS-FLI1, which belongs to the FUS/EWS/TAF15 ...

<meta charset="utf8"></head><body>In situ Nukleosomenrekonstitution für Einzelmolekülstudien

In Situ Nucleosome Assembly for Single-Molecule Correlative Force and Fluorescence Microscopy

Nucleosomes constitute the primary unit of eukaryotic chromatin and have been the focus of numerous informative single-molecule investigations regarding their biophysical properties and interactions with chromatin-binding proteins. Nucleosome reconstitution on DNA for these studies typically involves a salt dialysis procedure that provides precise control over the placement and number of nucleosomes formed along a DNA tether. However, this protocol is time-consuming and requires a substantial amount of DNA and histone octamers as inputs. To offer an alternative strategy, an in situ nucleosome reconstitution method for single-molecule force and fluorescence microscopy that utilizes the histone chaperone Nap1 is described. This method enables users to assemble nucleosomes on any DNA template without the need for strong nucleosome positioning sequences, adjust nucleosome density on demand, and use fewer reagents. In situ nucleosome formation occurs within seconds, offering a simpler experimental workflow and a convenient transition into single-molecule measurements. Examples of two downstream assays for probing nucleosome mechanics and visualizing the behavior of individual proteins on chromatin are further described.

<meta charset="utf8"></head><body>Autor im Rampenlicht: Effiziente Nukleosomenrekonstitution für Einzelmolekültechniken

This article presents a detailed experimental procedure for reconstituting nucleosome-containing DNA tethers for single-molecule correlative force and fluorescence microscopy. It further describes several downstream experiments that can be conducted to visualize the binding behavior of chromatin-interacting proteins and analyze changes in the physical properties of nucleosomes.

In-situ-Nukleosomenassemblierung für die Einzelmolekül-Korrelativkraft- und Fluoreszenzmikroskopie

Nucleosomes constitute the primary unit of eukaryotic chromatin and have been the focus of numerous informative single-molecule investigations regarding ...