We thank James Waters, Gable Wadsworth and Bo Broadwater for critically reading the manuscript. We also thank four anonymous reviewers for providing useful comments. We acknowledge financial support from Georgia Institute of Technology, the Burroughs Wellcome Fund Career Award at the Scientific Interface, and the student research network grant from NSF Physics of Living Systems.

1. dsDNA Sample Preparation
<ol>
	<li>Design globally curved DNAs by repeating a 10-mer sequence. For example, 5&#8217;-GTGCCAGCAACAGATAGC - (TTTATCATCCTTTATCATCCX)7 - TTTCATTCGAGCTCGTTGTTG-3&#8217; is a 186-bp curved DNA where X is a random extra base and the sequence flanking the repeating 10-mer sequence are adapter sequences. 
	NOTE: In this example two 10-mers with opposite preferences to nucleosome formation based on a large-scale nucleosome occupancy study by Kaplan et al.15 were chosen. Since the helical repeat of dsDNA is close to 10 bp, any net deflection of the helical axis of the 10-mer will accumulate to produce a shape like a circular arc (Figure 3A). Since the helical period is closer to 10.5 bp, an extra base is inserted after every two repeats to keep the curved structure as planar as possible. These sequences shorter than 200 bp can be ordered from companies that offer gene synthesis service. It is convenient to flank these sequences with common adapter sequences for subsequent steps. The procedure is schematized in Figure 3B.</li>
	<li>Perform PCR with Primer 1 (GTGCCAGCAACAGATAGC) and Primer 2 (/5Cy3/TAAATTCCTACAACAACGAGCTCGAATG). NOTE: Primer 2 is labeled with the FRET donor Cy3 at the 5&#39; end. A typical PCR recipe and cycling protocol are presented in Tables 1 and 2.</li>
	<li>Perform PCR with Primer 3 (/5BioTEG/GAAACATAG/iCy5/GAATTTACCGTGCCAGCAACAGATAGC) and Primer 4 (CAACAACGAGCTCGAATG). NOTE: Primer 3 is labeled with the FRET acceptor Cy5 through the backbone and the biotin-linker at the 5&#39; end. PCR recipe and cycling protocol are as above.</li>
	<li>Purify the PCR products using a PCR cleanup kit.</li>
	<li>Mix the Cy3-labeled product and the Cy5-labeled product in a buffer for strand exchange (100 mM NaCl, 10 mM Tris-HCl pH 7.0, 1 mM EDTA) at final concentrations of 0.4 &#181;M and 0.1 &#181;M, respectively. NOTE: The excess Cy3-DNA increases the concentration of the duplex carrying both Cy3 and Cy5 as a result of strand exchange.</li>
	<li>Exchange strands by incubating at 98.5 &#176;C for 2 min, gradually cooling to 5 &#176;C with ramp rate of 0.1 &#176;C/sec, and incubating at 5&#160;&#176;C for 2 hr.</li>
</ol>
2. Gel Electrophoresis to Detect dsDNA Curvature
<ol>
	<li>Pour the polyacrylamide gel16,17 by mixing acrylamide and bis-acrylamide solutions at 29.2:0.8 ratio, 5% (w/v) in 1X Tris/Borate/EDTA (TBE) buffer at pH 8.0. Note: 10 ml of gel solution contains: 1.217 ml 40% acrylamide, 0.667 ml 2% bis-acrylamide, 1 ml TBE 10X, 100 L ammonium persulfate (APS) 10%, 10 L TEMED, and the rest is dH2O. Full solidification of the gel takes about 30 min.</li>
	<li>Load the polyacrylamide gel with DNA samples and the DNA ladder in 1X loading buffer (5% glycerol, 0.03% (w/v) bromophenol blue) and run the gel at 5-8 V/cm at 4 &#176;C for 45 min or until the dye front approaches the end of the gel.</li>
	<li>Stain the gel using 1X TBE buffer that contains 0.5 g/ml ethidium bromide for 30 min. Identify the DNA bands under UV illumination. Compare band positions with the size marker (100 bp DNA ladder) to calculate the apparent sizes of the DNA molecules. NOTE: Curved DNAs generally move slower than straight DNAs.</li>
</ol>
3. Flow Cell Preparation
<ol>
	<li>Drill 6-7 pairs of holes along two opposite edges of a glass slide (3&#8217;&#8217; x 1&#8217;&#8217;) using a drill press and diamond drill bits. After drilling, rub the slide in flowing water to remove visible glass powder. NOTE: The holes serve as perfusion inlets and outlets. During drilling, cooling the slide with water is important to prevent cracking.</li>
	<li>Place the slides upright in a glass jar and fill it with water. Sonicate for 15 min and transfer them into another glass jar dedicated for acetone cleaning. Fill it with acetone and sonicate for 15 min. Rinse the slides with ethanol using a spray bottle and then with water. Place them in a polypropylene jar, fill it with 5 M potassium hydroxide, and sonicate for 15 min. Finally, sonicate the slides in water for 15 min. Clean the coverslips (no. 1, 24 x 40 mm) using the same protocol. NOTE: Cleaned slides and coverslips can be stored in dH2O for long term use.</li>
	<li>Mix 1 mg of biotin-PEG-silane (MW 3400) with 80 mg of mPEG-silane (MW 2000) in 340 L of 0.1 M sodium bicarbonate solution. Mix well and centrifuge the mixture briefly to get rid of bubbles. NOTE: The functionalization of the surface with polyethylene glycol (PEG) helps reduce nonspecific binding of DNA to the surface.</li>
	<li>Put 80 L of the PEG solution on each slide and gently lower a coverslip over it. Wait for 45 min. Separate the coverslip from the slide with tweezers, rinse them with copious amount of dH2O and let them dry in open air.</li>
	<li>Place thin strips of double-stick tape across the slide to form channels. Align a coverslip over it and firmly press the coverslip against the slide to form liquid-tight channels. Use 5 minute epoxy to seal the edges of the channels.</li>
</ol>
4. Preparation of Trolox Solution
<ol>
	<li>Put ~30 mg Trolox and 10 ml dH2O in a flask and use a magnet stir bar to stir the solution in open air for 18 hr.</li>
	<li>Filter the solution using a 0.2 &#181;m filter and adjust the pH to 7 by adding ~6 &#181;l of 1 M Tris base (pH 11). Note: Trolox is an anti-blinking reagent which is commonly used in single-molecule studies18. The antifading action of Trolox comes from its oxidized derivative which is present in partially degraded Trolox solution19. Quickly dissolving Trolox in methanol or high pH Tris solution should be avoided because of inefficient oxidation.</li>
</ol>
5. Single-molecule Imaging
<ol>
	<li>Inject 15 &#181;l of NeutrAvidin solution (0.5 mg/ml) into the channel and wait for 2 min before rinsing with 100 &#181;l of T50 buffer (10 mM Tris-HCl, 50 mM NaCl, pH 7.0).</li>
	<li>Inject 50 &#181;l of DNA sample (50-100 pM) into the channel. Wait for 5 min and rinse the unbound DNA away with 100 L of T50 buffer. NOTE: DNA molecules will specifically bind to the surface through the NeutrAvidin-biotin interaction.</li>
	<li>Fill the channel with the imaging buffer that contains an oxygen scavenging system20 (100 mM PCD, 5 mM PCA, 1 mM Trolox, and 500 mM NaCl).</li>
	<li>Set the EMCCD in frame-transfer mode to stream 2 x 2 binned images (256 x 256) to the computer at 25 frames per sec.</li>
	<li>Put immersion oil on the microscope objective, and fix the flow cell on the microscope stage using specimen clips. Coarse-adjust the focus by looking at the laser reflection pattern on the wall. Fine-adjust the focus using the live view of fluorescence images on the monitor.</li>
	<li>Begin data acquisition with the 532 nm laser on. Check the live view and adjust the focus if necessary. Stop data acquisition when most molecules have photobleached. 
	NOTE: In this facility, a lab-written C program to control the microscope and display live images on the monitor as they are saved to the hard disk is used.</li>
</ol>
6. Image Processing and Data Analysis
NOTE: A time series of 256 x 256 images are processed by a MATLAB code to generate single-molecule time traces of Cy3 and Cy5 intensities. To pair pixels between the donor channel and the acceptor channel of the split-view image, 6-7 pairs of Cy3 and Cy5 spots, each pair from the same molecule evenly dispersed across the field of view, are manually picked, and an affine transformation is calculated using the coordinates of these spots as anchor points.
<ol>
	<li>Using a MATLAB script, look through all single-molecule time traces that show multiple transitions between low and high FRET signals. Identify the looped and unlooped states. 
	NOTE: The FRET signal is defined as the Cy5 intensity ( Ia ) divided by the sum of Cy3 and Cy5 intensities ( Ia + Id ). Looped state has high FRET value while unlooped state has low FRET value. The histogram of FRET signals from a single molecule is bimodally distributed because of reversible looping and unlooping.</li>
	<li>Find the threshold that separates the two distributions by determining the intersection between the two fitted Gaussian curves.</li>
	<li>Calculate the FRET efficiency as <img fo:content-width="0.6in" src="/files/ftp_upload/51667/eq7.jpg" /> and assign the looped states with high FRET values and the unlooped states with low FRET values.</li>
	<li>Using a MATLAB script, analyze the cumulative number of molecules ( N(t) ) that looped (or reached the high FRET state) at different time lapses since the start of data acquisition. NOTE: Since a dsDNA molecule can start in any conformation of the unlooped state at the start of data acquisition, the rate of increase in the looped population reflects the mean looping rate averaged over initial conformations. Extract the looping rate kloop by fitting N(t) with an exponential function: <img fo:content-width="1.8in" src="/files/ftp_upload/51667/eq1.jpg" /> If increases biphasically, it can be fitted with a double exponential function: <img fo:content-width="2.2in" src="/files/ftp_upload/51667/eq2.jpg" /> In this case, kloop is obtained from: <img fo:content-width="1.7in" src="/files/ftp_upload/51667/eq3.jpg" /> NOTE: Theoretically, the survival probability that a polymer has not looped at time t is not a single or double exponential function12. Exponential fitting is used as a practical means to extract the average looping time.</li>
</ol>
7. Determining the J Factor
NOTE: The J factor represents how concentrated one end of a dsDNA is around the other end. It can be determined by interpolating the concentration of one end segment of the DNA that would produce the same reaction rate with the other end segment as the measured looping rate. Experimentally, one end segment is immobilized on the surface, and the other end segment is introduced at a certain concentration c. If the measured annealing rate between the two ends is kanneal, then the J factor21 is given by <img fo:content-width="0.6in" src="/files/ftp_upload/51667/eq4.jpg" />. The annealing rate constant ( kanneal = kanneal / C ) is independent of the probe concentration.
<ol>
	<li>Flow 20 &#181;l of 30-50 pM biotin-Cy5 oligo (Primer 3) into a NeutrAvidin-coated channel. Rinse the channel with 100 &#181;l T50 to wash away unbound oligos.</li>
	<li>Prepare the imaging buffer as described in part 5 with the addition of Cy3 oligo (Primer 2) at a final concentration of 50 nM. Flow this imaging buffer into the channel.</li>
	<li>While keeping the 532 nm laser on, briefly turn the 640 nm laser on to identify locations of surface-bound Cy5 oligos. Turn off the 640 nm laser and start monitoring the FRET signal. 
	NOTE: Upon hybridization of a Cy3 oligo to a surface-bound Cy5 oligo, Cy5 fluorescence will arise from FRET.</li>
	<li>Using a MATLAB script, analyze the number of molecules which start in the unbound state (low Cy5 intensity) but later turn into the annealed state (high Cy5 intensity) as a function of time from the Cy5 intensity traces.</li>
	<li>Plot this number of annealed molecules vs. time. Fit this curve with a single exponential function (<img fo:content-width="1.8in" src="/files/ftp_upload/51667/eq5.jpg" />) to obtain the annealing rate ( kanneal ).</li>
	<li>Repeat this experiment at different Cy3 oligo concentrations (60, 100, and 180 nM) to confirm linearity between the annealing rate and the reactant concentration. Extract the second-order annealing rate constant ( kanneal ) from the slope.</li>
	<li>Calculate the J factor from <img fo:content-width="0.6in" src="/files/ftp_upload/51667/eq6.jpg" />, where kloop is the looping rate measured in the same buffer condition.</li>
</ol>

<ol>
	<li>Garcia, H. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biological+consequences+of+tightly+bent+DNA:+The+other+life+of+a+macromolecular+celebrity.">Biological consequences of tightly bent DNA: The other life of a macromolecular celebrity.</a> Biopolymers. 85, 115-130 (2007).</li><li>Wiggins, P. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+flexibility+of+DNA+on+short+length+scales+probed+by+atomic+force+microscopy.">High flexibility of DNA on short length scales probed by atomic force microscopy.</a> Nature Nanotechnology. 1, (2006).</li><li>Lionberger, T. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cooperative+kinking+at+distant+sites+in+mechanically+stressed+DNA.">Cooperative kinking at distant sites in mechanically stressed DNA.</a> Nucleic Acids Research. 41, 6785-6792 (2011).</li><li>Shore, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+flexibility+studied+by+covalent+closure+of+short+fragments+into+circles.">DNA flexibility studied by covalent closure of short fragments into circles.</a> Proc Natl Acad Sci U S A. 78, 4833-4837 (1981).</li><li>Geggier, S., Vologodskii, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequence+dependence+of+DNA+bending+rigidity.">Sequence dependence of DNA bending rigidity.</a> Proc Nat Acad Sci U S A. 107, 15421-15426 (1992).</li><li>Smith, S. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+mechanical+measurements+of+the+elasticity+of+single+DNA+molecules+by+using+magnetic+beads.">Direct mechanical measurements of the elasticity of single DNA molecules by using magnetic beads.</a> Science. 258, 1122-1126 (1992).</li><li>Peters, J. P., Maher, L. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+curvature+and+flexibility+in+vitro+and+in+vivo.">DNA curvature and flexibility in vitro and in vivo.</a> Quarterly Reviews of Biophysics. 43, 23-63 (2010).</li><li>Cloutier, T. E., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneous+sharp+bending+of+double-stranded+DNA.">Spontaneous sharp bending of double-stranded DNA.</a> Molecular Cell. 14, 355-362 (2004).</li><li>Du, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclization+of+short+DNA+fragments+and+bending+fluctuations+of+the+double+helix.">Cyclization of short DNA fragments and bending fluctuations of the double helix.</a> Proc Natl Acad Sci U S A. 102, 5397-5402 (2005).</li><li>Yuan, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=T4+DNA+ligase+is+more+than+an+effective+trap+of+cyclized+dsDNA.">T4 DNA ligase is more than an effective trap of cyclized dsDNA.</a> Nucl. Acids Res. 35, 5294-5302 (2007).</li><li>Manzo, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+effect+of+nonspecific+binding+of+lambda+repressor+on+DNA+looping+dynamics.">The effect of nonspecific binding of lambda repressor on DNA looping dynamics.</a> Biophysical Journal. 103, 1753-1761 (2012).</li><li>Le, T. T., Kim, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measuring+shape-dependent+looping+probability+of+DNA.">Measuring shape-dependent looping probability of DNA.</a> Biophys. J. 104, 2068-2076 (2013).</li><li>Vafabakhsh, R., Ha, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extreme+bendability+of+DNA+less+than+100+base+pairs+long+revealed+by+single-molecule+cyclization.">Extreme bendability of DNA less than 100 base pairs long revealed by single-molecule cyclization.</a> Science. 337, 1097-1101 (2012).</li><li>Friedman, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viewing+dynamic+assembly+of+molecular+complexes+by+multi-wavelength+single-molecule+fluorescence.">Viewing dynamic assembly of molecular complexes by multi-wavelength single-molecule fluorescence.</a> Biophysical Journal. 91, 1023-1031 (2006).</li><li>Kaplan, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+DNA-encoded+nucleosome+organization+of+a+eukaryotic+genome.">The DNA-encoded nucleosome organization of a eukaryotic genome.</a> Nature. 458, 362-366 (2009).</li><li>Koo, H. S., Crothers, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calibration+of+DNA+curvature+and+a+unified+description+of+sequence-directed+bending.">Calibration of DNA curvature and a unified description of sequence-directed bending.</a> Proc Nat Acad Sci U S A. 85, 1763-1767 (1988).</li><li>Prosseda, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+temperature-induced+narrow+DNA+curvature+range+sustains+the+maximum+activity+of+a+bacterial+promoter+in+vitro.">A temperature-induced narrow DNA curvature range sustains the maximum activity of a bacterial promoter in vitro.</a> Biochemistry. 49, 2778-2785 (2010).</li><li>Rasnik, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonblinking+and+long-lasting+single-molecule+fluorescence+imaging.">Nonblinking and long-lasting single-molecule fluorescence imaging.</a> Nature Methods. 3, 891-893 (2006).</li><li>Cordes, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+mechanism+of+Trolox+as+antiblinking+and+antibleaching+reagent.">On the mechanism of Trolox as antiblinking and antibleaching reagent.</a> J. Am. Chem. Soc. 131, 5018-5019 (2009).</li><li>Aitken, C. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+oxygen+scavenging+system+for+improvement+of+dye+stability+in+single-molecule+fluorescence+experiments.">An oxygen scavenging system for improvement of dye stability in single-molecule fluorescence experiments.</a> Biophys J. 94, 1826-1835 (2008).</li><li>Taylor, W. H., Hagerman, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+the+method+of+phage+T4+DNA+ligase-catalyzed+ring-closure+to+the+study+of+DNA+structure:+II.+NaCl-dependence+of+DNA+flexibility+and+helical+repeat.">Application of the method of phage T4 DNA ligase-catalyzed ring-closure to the study of DNA structure: II. NaCl-dependence of DNA flexibility and helical repeat.</a> Journal of Molecular Biology. 212, 363-376 (1990).</li><li>Bolshoy, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Curved+DNA+without+A-A:+experimental+estimation+of+all+16+DNA+wedge+angles.">Curved DNA without A-A: experimental estimation of all 16 DNA wedge angles.</a> Proc Natl Acad Sci U S A. 88, 2312-2316 (1991).</li><li>Gibson, D. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthesis+of+DNA+fragments+in+yeast+by+one-step+assembly+of+overlapping+oligonucleotides.">Synthesis of DNA fragments in yeast by one-step assembly of overlapping oligonucleotides.</a> Nucl. Acids Res. 37, 6984-6990 (2009).</li><li>Vologodskii, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bending+of+short+DNA+helices.">Bending of short DNA helices.</a> Artif DNA PNA XNA. 4, (2013).</li><li>Hoover, D. M., Lubkowski, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNAWorks:+an+automated+method+for+designing+oligonucleotides+for+PCR-based+gene+synthesis.">DNAWorks: an automated method for designing oligonucleotides for PCR-based gene synthesis.</a> Nucl. Acids Res. 30, (2002).</li><li>Waters, J. T., Kim, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Equilibrium+Statistics+of+a+Surface-Pinned+Semiflexible+Polymer.">Equilibrium Statistics of a Surface-Pinned Semiflexible Polymer.</a> Macromolecules. 46, 6659-6666 (2013).</li><li>Mills, J. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electrophoretic+evidence+that+single-stranded+regions+of+1+or+more+nucleotides+dramatically+increase+the+flexibility+of+DNA.">Electrophoretic evidence that single-stranded regions of 1 or more nucleotides dramatically increase the flexibility of DNA.</a> Biochemistry. 33, 1797-1803 (1994).</li></ol>

The authors declare no conflicts of interest.

A simple single-molecule assay based on FRET was used to study looping kinetics of DNAs of different intrinsic shapes. Curved DNAs can be prepared by repeating a 10-mer sequence in phase with the helical period of 10.5 bp, and their curvatures can be estimated using PAGE. These dsDNAs are designed with sticky ends to allow transient loop stabilization. We extracted the looping rate from the exponential rise in the number of looped molecules over time. The annealing rate constant between the disconnected sticky end segmen...

Understanding the mechanical properties of dsDNA is of fundamental importance in basic sciences and engineering applications. The structure of dsDNA is more complicated than a straight helical ladder because roll, tilt, and twist angles between successive base pairs can vary with sequence. Thermal fluctuations can cause dsDNA to undergo diverse modes of conformational fluctuations such as bending, twisting and stretching. Transitions such as melting and kinking can also occur in extreme conditions.
Among these motions, dsDNA bending has the most noticeable biological impact1. dsDNA bending is associated with gene repression or activation by bringing two distant sites close to each other. It also plays an important role in DNA packaging inside the cell nucleus or a viral capsid. Bending deformation of dsDNA can be visualized experimentally by high-resolution microscopy (AFM2 and TEM3), and the thermodynamics and kinetics can be studied by looping assays, which chemically link juxtaposed sites of the dsDNA.
One such assay is ligase-dependent cyclization4. In this assay, dsDNA molecules with &#8216;sticky&#8217; (cohesive) ends are circularized or dimerized by DNA ligase. By comparing the rates of circle and dimer formation, one can obtain an effective molar concentration of one end of the DNA in the vicinity of the other end, which is known as the J factor. This J factor is dimensionally equivalent to the probability density of finding one end of the DNA at a short distance from the other end, and thus reflects the flexibility of the DNA. Measuring the J factor as a function of DNA length reveals many characteristics about DNA mechanics including the persistence length4,5.
The worm-like chain (WLC) model has been widely regarded as the canonical polymer model for dsDNA mechanics based on its success in explaining the force-extension curves obtained in DNA pulling experiments6, and correctly predicting the J factors of dsDNAs longer than 200 bp7. However, using the cyclization assay on dsDNA molecules as short as 100 bp, Cloutier and Widom measured the J factors to be several orders of magnitude higher than the WLC model prediction8. A year later, Du et al. produced J factors in agreement with the WLC model using the cyclization assay with lower concentrations of ligase and attributed the anomalous result from the Widom group to high ligase concentrations used9. This controversy exemplifies the unavoidable influence of DNA ligase on cyclization kinetics when using the conventional assay9. Moreover, DNA ligase can also affect DNA structure and stiffness through nonspecific binding10,11.
To eliminate the technical concerns of protein-dependent looping assays, we recently demonstrated a protein-free looping assay based on Fluorescence Resonance Energy Transfer (FRET)12. In this method, looped conformations are detected by FRET between the donor and acceptor attached near the sticky ends of a DNA molecule. An objective-type total internal reflection fluorescence microscope (TIRFM) is used to record trajectories of reversible looping and unlooping events from surface-immobilized single DNA molecules for a prolonged period of time. This method features PCR-based assembly of DNA molecules to generate mismatch-free DNA molecules, which is a crucial improvement over a similar method by Vafabakhsh and Ha13. The single-molecule aspect of this protocol allows measurement of distributions in addition to ensemble averages while the FRET aspect allows one to measure DNA looping dynamics repeatedly from the same molecule, even in conditions that can impair ligase activity.
The TIRFM setup is shown in Figure 1. A custom-designed specimen stage is placed over an Olympus IX61 microscope body. 532 nm and 640 nm lasers are introduced from the side and are reflected by tiny elliptical mirrors14 into the high NA objective to achieve critical angle of incidence at the coverslip-water interface. We note that more widespread through-objective TIR using dichroic mirrors or prism-based TIR setups can also be used for this FRET application. The fluorescence image formed by the microscope is split into donor and acceptor images by a dichroic mirror. They are then re-imaged onto two halves of an EMCCD. Additional long-pass emission filters are used to reduce background signal.
Temperature control is essential for acquiring reproducible kinetic data. For temperature control, the objective is separated from the nosepiece of the microscope body to minimize heat transfer, and water from a temperature controlled chiller/heater is circulated through a brass collar that tightly fits around the interior metal beneath the objective jacket. This setup is able to achieve robust temperature control at the coverslip surface between 15 and 50 &#176;C (Figure 2). In this work, the sample temperature was maintained at 24 &#176;C.
The following protocol presents the step-by-step procedure for DNA construction, estimation of DNA shape, single-molecule experiment, and J factor determination.

<table><tbody><tr><td>Small DNA FRAG Extract Kit-100PR</td><td>VWR</td><td>97060-558</td><td></td></tr><tr><td>Acrylamide 40% solution 500 ml</td><td>VWR</td><td>97064-522</td><td></td></tr><tr><td>Bis-acrylamide 2% (w/v) solution 500 ml</td><td>VWR</td><td>97063-948</td><td></td></tr><tr><td>GeneRuler 100 bp DNA Ladder, 100-1,000 bp</td><td>Fermentas</td><td>SM0241</td><td></td></tr><tr><td>Mini Vertical PAGE System</td><td>VWR</td><td>89032-300</td><td></td></tr><tr><td>Syringe filter 0.2 &amp;mu;m CS50</td><td>VWR</td><td>A2666</td><td></td></tr><tr><td>Trolox</td><td>Sigma-Aldrich</td><td>238813-1G</td><td>triplet state quencher</td></tr><tr><td>Protocatechuic acid (PCA)</td><td>Sigma-Aldrich</td><td>08992-50MG</td><td>oxygen scavenging system</td></tr><tr><td>Protocatechuate 3,4-Dioxygenase (PCD)</td><td>Sigma-Aldrich</td><td>P8279-25UN</td><td>oxygen scavenging system</td></tr><tr><td>mPEG-silane, MW 2,000 1 g</td><td>Laysan Bio</td><td>MPEG-SIL-2000-1g</td><td></td></tr><tr><td>Biotin-PEG-Silane, MW 3,400</td><td>Laysan Bio</td><td>Biotin-PEG-SIL-3400-1g</td><td></td></tr><tr><td>Avidin, NeutrAvidin Biotin-binding Protein</td><td>Invitrogen</td><td>A2666</td><td></td></tr><tr><td>Phusion Hot Start High-Fidelity DNA Polymerase</td><td>New England Biolabs</td><td>F-540L</td><td></td></tr><tr><td>Gel/PCR DNA Fragments Extraction Kit</td><td>IBI Scientific</td><td>IB47020</td><td></td></tr><tr><td>Premium plain glass microscope slides</td><td>Fisher Scientific</td><td>12-544-1</td><td></td></tr><tr><td>VWR micro cover glass, rectangular, no. 1</td><td>VWR</td><td>48404-456</td><td></td></tr><tr><td>Fisher Scientific Isotemp 1006S Recirculating Chiller/Heater</td><td>Fisher Scientific</td><td></td><td>temperature control</td></tr><tr><td>Objective Cooling Collar</td><td>Bioptechs</td><td>150303</td><td>temperature control</td></tr><tr><td>KMI53 Biological Micrometer Measuring Stage</td><td>Semprex</td><td>KMI53</td><td></td></tr><tr><td>High Performance DPSS Laser 532 nm 50 mW</td><td>Edmund optics</td><td>NT66-968</td><td>Cy3 excitation</td></tr><tr><td>CUBE Fiber Pigtailed 640 nm, 30 mW, Fiber, FC/APC Connector</td><td>Coherent</td><td>1139604</td><td>Cy5 excitation</td></tr><tr><td>650 nm BrightLine Dichroic Beamsplitter</td><td>Semrock</td><td>FF650-Di01-25x36</td><td>splitting dichroic</td></tr><tr><td>LaserMUX Beam Combiner, reflects 514.5, 532, &amp;amp; 543.5 nm lasers, 25 mm</td><td>Semrock</td><td>LM01-552-25</td><td>combining dichroic</td></tr><tr><td>Brightline Fluorescence Filter 593/40</td><td>Semrock</td><td>FF01-593/40-25</td><td>Cy3 emission filter</td></tr><tr><td>635 nm EdgeBasic LWP longpass Filter, 25 mm</td><td>Semrock</td><td>BLP01-635R-25</td><td>Cy5 emission filter</td></tr><tr><td>EMCCD iXon+</td><td>Andor Technology</td><td>DU-897E-CS0-#BV</td><td></td></tr><tr><td>IX51 inverted microscope frame</td><td>Olympus</td><td></td><td></td></tr><tr><td>Objective UApo N 100X/1.49 Oil TIRF</td><td>Olympus</td><td></td><td></td></tr><tr><td>Immersion oil type-F for fluorescence microscopy</td><td>Olympus</td><td>IMMOIL-F30CC</td><td></td></tr><tr><td>2 mm Diameter 45&amp;deg; Rod Lens Aluminum Coated&amp;nbsp;</td><td>Edmund optics</td><td>54-092</td><td>miniature mirror</td></tr><tr><td>1/4&quot; Travel Single-Axis Translation Stage</td><td>Thorlabs</td><td>MS-1</td><td>translation of miniature mirror</td></tr><tr><td>&amp;Oslash;1&quot; Achromatic Doublet, ARC: 400-700 nm, f=200 mm</td><td>Thorlabs</td><td>AC254-200-A</td><td>focusing lens</td></tr><tr><td>Adjustable Mechanical Slit</td><td>Thorlabs</td><td>VA100</td><td></td></tr><tr><td>Dielectric Mirror</td><td>Thorlabs</td><td>BB1-E02</td><td></td></tr><tr><td>&amp;Oslash;1&quot; Achromatic Doublet, f = 100 mm</td><td>Thorlabs</td><td>AC254-100-A</td><td>relay lens</td></tr><tr><td>Lens Mount for &amp;Oslash;1&quot; Optics</td><td>Thorlabs</td><td>LMR1</td><td></td></tr><tr><td>Dichroic Filter Mount</td><td>Thorlabs</td><td>FFM1</td><td></td></tr><tr><td>Fixed Cage Cube Platform</td><td>Thorlabs</td><td>B3C</td><td></td></tr><tr><td>Kinematic Mount for &amp;Oslash;1&quot; Optics</td><td>Thorlabs</td><td>KM100</td><td></td></tr><tr><td>N-BK7 Plano-Convex Lens, &amp;Oslash;1&quot;, f = 40 mm</td><td>Thorlabs</td><td>LA1422-A</td><td>collimating lens</td></tr><tr><td>N-BK7 Plano-Convex Lense, &amp;Oslash;6.0 mm, f = 15 mm</td><td>Thorlabs</td><td>LA1222-A</td><td>telescope lens</td></tr><tr><td>N-BK7 Plano-Convex Lense, &amp;Oslash;6.0 mm, f = 150 mm</td><td>Thorlabs</td><td>LA1433-A</td><td>telescope lens</td></tr></tbody></table>

studying dna looping by single-molecule fret

Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can also affect the apparent looping rate through mechanisms such as nonspecific binding. Here, we show how to measure dsDNA looping kinetics without ligase by detecting transient DNA loop formation by FRET (Fluorescence Resonance Energy Transfer). dsDNA molecules are constructed using a simple PCR-based protocol with a FRET pair and a biotin linker. The looping probability density known as the J factor is extracted from the looping rate and the annealing rate between two disconnected sticky ends. By testing two dsDNAs with different intrinsic curvatures, we show that the J factor is sensitive to the intrinsic shape of the dsDNA.

DNA molecules used for the looping study consist of a duplex region of variable sequence and length and single-stranded overhangs that are complementary to each other. The overhangs, which are 7-base long, can anneal to each other to capture the looped state. Each overhang contains either Cy3 or Cy5 that is linked in the DNA backbone through amidite chemistry. The Cy5-overhang is also linked with biotin-TEG (15-atom Tetra-Ethylene Glycol spacer) for surface immobilization (see Figure 4A). All these modif...

Watch this Scientific Journal Video about Studying DNA Looping by Single-Molecule FRET at JoVE.com

Studying DNA Looping by Single-Molecule FRET

This study presents a detailed experimental procedure to measure looping dynamics of double-stranded DNA using single-molecule Fluorescence Resonance Energy Transfer (FRET). The protocol also describes how to extract the looping probability density called the J factor.

Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into ...

studying-dna-looping-by-single-molecule-fret

Universidad de Cartagena UDEC

Research

JoVE Journal

Biology

15.3K Views.  Georgia Institute of Technology. This study presents a detailed experimental procedure to measure looping dynamics of double-stranded DNA using single-molecule Fluorescence Resonance Energy Transfer (FRET). The protocol also describes how to extract the looping probability density called the J factor.

Video: Studying DNA Looping by Single-Molecule FRET

High Precision FRET at Single-molecule Level for Biomolecule Structure Determination

A protocol on how to perform high-precision interdye distance measurements using F&#246;rster resonance energy transfer (FRET) at the single-molecule level in multiparameter fluorescence detection (MFD) mode is presented here. MFD maximizes the usage of all &#34;dimensions&#34; of fluorescence to reduce photophysical and experimental artifacts and allows for the measurement of interdye distance with an accuracy up to ~1 &#197; in rigid biomolecules. This method was used to identify three conformational states of the ligand-binding domain of the N-methyl-D-aspartate (NMDA) receptor to explain the activation of the receptor upon ligand binding. When comparing the known crystallographic structures with experimental measurements, they agreed within less than 3 &#197; for more dynamic biomolecules. Gathering a set of distance restraints that covers the entire dimensionality of the biomolecules would make it possible to provide a structural model of dynamic biomolecules.

A protocol for high-precision FRET experiments at the single molecule level is presented here. Additionally, this methodology can be used to identify three conformational states in the ligand-binding domain of the N-methyl-D-aspartate (NMDA) receptor. Determining precise distances is the first step towards building structural models based on FRET experiments.

A protocol on how to perform high-precision interdye distance measurements using F&#246;rster resonance energy transfer (FRET) at the single-molecule ...

Biochemistry

A Simple, Robust, and High Throughput Single Molecule Flow Stretching Assay Implementation for Studying Transport of Molecules Along DNA

We describe a simple, robust and high throughput single molecule flow-stretching assay for studying 1D diffusion of molecules along DNA. In this assay, glass coverslips are functionalized in a one-step reaction with silane-PEG-biotin. Flow cells are constructed by sandwiching an adhesive tape with pre-cut channels between a functionalized coverslip and a PDMS slab containing inlet and outlet holes. Multiple channels are integrated into one flow cell and the flow of reagents into each channel can be fully automated, which significantly increases the assay throughput and reduces hands-on time per assay. Inside each channel, biotin-&#955;-DNAs are immobilized on the surface and a laminar flow is applied to flow-stretch the DNAs. The DNA molecules are stretched to &#62;80% of their contour length and serve as spatially extended templates for studying the binding and transport activity of fluorescently labeled molecules. The trajectories of single molecules are tracked by time-lapse Total Internal Reflection Fluorescence (TIRF) imaging. Raw images are analyzed using streamlined custom single particle tracking software to automatically identify trajectories of single molecules diffusing along DNA and estimate their 1D diffusion constants.

This protocol demonstrates a simple, robust and high throughput single molecule flow-stretching assay for studying one-dimensional (1D) diffusion of molecules along DNA.

We describe a simple, robust and high throughput single molecule flow-stretching assay for studying 1D diffusion of molecules along DNA. In this assay, ...

Probing The Structure And Dynamics Of Nucleosomes Using Atomic Force Microscopy Imaging

Chromatin, which is a long chain of nucleosome subunits, is a dynamic system that allows for such critical processes as DNA replication and transcription to take place in eukaryotic cells. The dynamics of nucleosomes provides access to the DNA by replication and transcription machineries, and critically contributes to the molecular mechanisms underlying chromatin functions. Single-molecule studies such as atomic force microscopy (AFM) imaging have contributed significantly to our current understanding of the role of nucleosome structure and dynamics. The current protocol describes the steps enabling high-resolution AFM imaging techniques to study the structural and dynamic properties of nucleosomes. The protocol is illustrated by AFM data obtained for the centromere nucleosomes in which H3 histone is replaced with its counterpart centromere protein A (CENP-A). The protocol starts with the assembly of mono-nucleosomes using a continuous dilution method. The preparation of the mica substrate functionalized with aminopropyl silatrane (APS-mica) that is used for the nucleosome imaging is critical for the AFM visualization of nucleosomes described and the procedure to prepare the substrate is provided. Nucleosomes deposited on the APS-mica surface are first imaged using static AFM, which captures a snapshot of the nucleosome population. From analyses of these images, such parameters as the size of DNA wrapped around the nucleosomes can be measured and this process is also detailed. The time-lapse AFM imaging procedure in the liquid is described for the high-speed time-lapse AFM that can capture several frames of nucleosome dynamics per second. Finally, the analysis of nucleosome dynamics enabling the quantitative characterization of the dynamic processes is described and illustrated.

Here, we present a protocol to characterize nucleosome particles at the single-molecule level using static and time-lapse atomic force microscopy (AFM) imaging techniques. The surface functionalization method described allows for the capture of the structure and dynamics of nucleosomes in high-resolution at the nanoscale.

Chromatin, which is a long chain of nucleosome subunits, is a dynamic system that allows for such critical processes as DNA replication and transcription ...

Magnetic Tweezers for the Measurement of Twist and Torque

Single-molecule techniques make it possible to investigate the behavior of individual biological molecules in solution in real time. These techniques include so-called force spectroscopy approaches such as atomic force microscopy, optical tweezers, flow stretching, and magnetic tweezers. Amongst these approaches, magnetic tweezers have distinguished themselves by their ability to apply torque while maintaining a constant stretching force. Here, it is illustrated how such a &#8220;conventional&#8221; magnetic tweezers experimental configuration can, through a straightforward modification of its field configuration to minimize the magnitude of the transverse field, be adapted to measure the degree of twist in a biological molecule. The resulting configuration is termed the freely-orbiting magnetic tweezers. Additionally, it is shown how further modification of the field configuration can yield a transverse field with a magnitude intermediate between that of the &#8220;conventional&#8221; magnetic tweezers and the freely-orbiting magnetic tweezers, which makes it possible to directly measure the torque stored in a biological molecule. This configuration is termed the magnetic torque tweezers. The accompanying video explains in detail how the conversion of conventional magnetic tweezers into freely-orbiting magnetic tweezers and magnetic torque tweezers can be accomplished, and demonstrates the use of these techniques. These adaptations maintain all the strengths of conventional magnetic tweezers while greatly expanding the versatility of this powerful instrument.

Magnetic tweezers, a powerful single-molecule manipulation technique, can be adapted for the direct measurements of the twist (using a configuration called freely-orbiting magnetic tweezers) and torque (using a configuration termed magnetic torque tweezers) in biological macromolecules. Guidelines for performing such measurements are given, including applications to the study of DNA and associated nucleo-protein filaments.

Single-molecule techniques make it possible to investigate the behavior of individual biological molecules in solution in real time. These techniques ...

Bioengineering

Nanomanipulation of Single RNA Molecules by Optical Tweezers

A large portion of the human genome is transcribed but not translated. In this post genomic era, regulatory functions of RNA have been shown to be increasingly important. As RNA function often depends on its ability to adopt alternative structures, it is difficult to predict RNA three-dimensional structures directly from sequence. Single-molecule approaches show potentials to solve the problem of RNA structural polymorphism by monitoring molecular structures one molecule at a time. This work presents a method to precisely manipulate the folding and structure of single RNA molecules using optical tweezers. First, methods to synthesize molecules suitable for single-molecule mechanical work are described. Next, various calibration procedures to ensure the proper operations of the optical tweezers are discussed. Next, various experiments are explained. To demonstrate the utility of the technique, results of mechanically unfolding RNA hairpins and a single RNA kissing complex are used as evidence. In these examples, the nanomanipulation technique was used to study folding of each structural domain, including secondary and tertiary, independently. Lastly, the limitations and future applications of the method are discussed.

Optical tweezers have been used to study RNA folding by stretching individual molecules from their 5&#8217; and 3&#8217; ends. Here common procedures are described to synthesize RNA molecules for tweezing, calibration of the instrument, and methods to manipulate single molecules.

A large portion of the human genome is transcribed but not translated. In this post genomic era, regulatory functions of RNA have been shown to be ...

Dual DNA Rulers to Study the Mechanism of Ribosome Translocation with Single-Nucleotide Resolution

The ribosome translocation refers to the ribosomal movement on the mRNA by exactly three nucleotides (nt), which is the central step in protein synthesis. To investigate its mechanism, there are two essential technical requirements. First is single-nt resolution that can resolve normal translocation from frameshifting, during which the ribosome moves by other than 3 nt. The second is the capability to probe both the entrance and exit sides of mRNA in order to elucidate the whole picture of translocation. We report the dual DNA ruler assay that is based on the critical dissociation forces of DNA-mRNA duplexes, obtained by force-induced remnant magnetization spectroscopy (FIRMS).&#160; With 2-4 pN force resolution, the dual ruler assay is sufficient to distinguish different translocation steps. By implementing a long linker on the probing DNAs, they can reach the mRNA on the opposite side of the ribosome, so that the mRNA position can be determined for both sides. Therefore, the dual ruler assay is uniquely suited to investigate the ribosome translocation, and nucleic acid motion in general. We show representative results which indicated a looped mRNA conformation and resolved normal translocation from frameshifting.

Dual DNA ruler assay is developed to determine the mRNA position during ribosome translocation, which relies on the dissociation forces of the formed DNA-mRNA duplexes. With single-nucleotide resolution and capability of reaching both ends of mRNA, it can provide mechanistic insights for ribosome translocation and probe other nucleic acid displacements.

The ribosome translocation refers to the ribosomal movement on the mRNA by exactly three nucleotides (nt), which is the central step in protein synthesis. ...

R-Loop Analysis by Dot-Blot

The three-stranded nucleic acid structure, R-loop, is increasingly recognized for its role in gene regulation. Initially, R-loops were thought to be the by-products of transcription; but recent findings of fewer R-loops in diseased cells made it clear that R-loops have functional roles in a variety of human cells. Next, it is critical to understand the roles of R-loops and how cells balance their abundance. A challenge in the field is the quantitation of R-loops since much of the work relies on the S9.6 monoclonal antibody whose specificity for RNA-DNA hybrids has been questioned. Here, we use dot-blots with the S9.6 antibody to quantify R-loops and show the sensitivity and specificity of this assay with RNase H, RNase T1, and RNase III that cleave RNA-DNA hybrids, single-stranded RNA, and double-stranded RNA, respectively. This method is highly reproducible, uses general laboratory equipment and reagents, and provides results within two days. This assay can be used in research and clinical settings to quantify R-loops and assess the effect of mutations in genes such as senataxin on R-loop abundance.

This protocol details a simple method that quantifies R-loop, a three-stranded nucleic acid structure that comprises of an RNA-DNA hybrid and a displaced DNA strand.

The three-stranded nucleic acid structure, R-loop, is increasingly recognized for its role in gene regulation. Initially, R-loops were thought to be the ...

Genetics

Optical Tweezers to Study RNA-Protein Interactions in Translation Regulation

RNA adopts diverse structural folds, which are essential for its functions and thereby can impact diverse processes in the cell. In addition, the structure and function of an RNA can be modulated by various trans-acting factors, such as proteins, metabolites or other RNAs. Frameshifting RNA molecules, for instance, are regulatory RNAs located in coding regions, which direct translating ribosomes into an alternative open reading frame, and thereby act as gene switches. They may also adopt different folds after binding to proteins or other trans-factors. To dissect the role of RNA-binding proteins in translation and how they modulate RNA structure and stability, it is crucial to study the interplay and mechanical features of these RNA-protein complexes simultaneously.&#160;This work illustrates how to employ single-molecule-fluorescence-coupled optical tweezers to explore the conformational and thermodynamic landscape of RNA-protein complexes at a high resolution. As an example, the interaction of the SARS-CoV-2 programmed ribosomal frameshifting element with the trans-acting factor short isoform of zinc-finger antiviral protein is elaborated. In addition, fluorescence-labeled ribosomes were monitored using the confocal unit, which would ultimately enable the study of translation elongation. The fluorescence coupled OT assay can be widely applied to explore diverse RNA-protein complexes or trans-acting factors regulating translation and could facilitate studies of RNA-based gene regulation.

This protocol presents a complete experimental workflow for studying RNA-protein interactions using optical tweezers. Several possible experimental setups are outlined including the combination of optical tweezers with confocal microscopy.

RNA adopts diverse structural folds, which are essential for its functions and thereby can impact diverse processes in the cell. In addition, the ...

Single-Molecule Imaging of EWS-FLI1 Condensates Assembling on DNA

The fusion genes resulting from chromosomal translocation have been found in many solid tumors or leukemia. EWS-FLI1, which belongs to the FUS/EWS/TAF15 (FET) family of fusion oncoproteins, is one of the most frequently involved fusion genes in Ewing sarcoma. These FET family fusion proteins typically harbor a low-complexity domain (LCD) of FET protein at their N-terminus and a DNA-binding domain (DBD) at their C-terminus. EWS-FLI1 has been confirmed to form biomolecular condensates at its target binding loci due to LCD-LCD and LCD-DBD interactions, and these condensates can recruit RNA polymerase II to enhance gene transcription. However, how these condensates are assembled at their binding sites remains unclear. Recently, a single-molecule biophysics method-DNA Curtains-was applied to visualize these assembling processes of EWS-FLI1 condensates. Here, the detailed experimental protocol and data analysis approaches are discussed for the application of DNA Curtains in studying the biomolecular condensates assembling on target DNA.

Here, we describe the use of the single-molecule imaging method, DNA Curtains, to study the biophysical mechanism of EWS-FLI1 condensates assembling on DNA.

The fusion genes resulting from chromosomal translocation have been found in many solid tumors or leukemia. EWS-FLI1, which belongs to the FUS/EWS/TAF15 ...

In Situ Nucleosome Reconstitution for Single-Molecule Studies

In Situ Nucleosome Assembly for Single-Molecule Correlative Force and Fluorescence Microscopy

Nucleosomes constitute the primary unit of eukaryotic chromatin and have been the focus of numerous informative single-molecule investigations regarding their biophysical properties and interactions with chromatin-binding proteins. Nucleosome reconstitution on DNA for these studies typically involves a salt dialysis procedure that provides precise control over the placement and number of nucleosomes formed along a DNA tether. However, this protocol is time-consuming and requires a substantial amount of DNA and histone octamers as inputs. To offer an alternative strategy, an in situ nucleosome reconstitution method for single-molecule force and fluorescence microscopy that utilizes the histone chaperone Nap1 is described. This method enables users to assemble nucleosomes on any DNA template without the need for strong nucleosome positioning sequences, adjust nucleosome density on demand, and use fewer reagents. In situ nucleosome formation occurs within seconds, offering a simpler experimental workflow and a convenient transition into single-molecule measurements. Examples of two downstream assays for probing nucleosome mechanics and visualizing the behavior of individual proteins on chromatin are further described.

Author Spotlight: Efficient Nucleosome Reconstitution for Single-Molecule Techniques

This article presents a detailed experimental procedure for reconstituting nucleosome-containing DNA tethers for single-molecule correlative force and fluorescence microscopy. It further describes several downstream experiments that can be conducted to visualize the binding behavior of chromatin-interacting proteins and analyze changes in the physical properties of nucleosomes.

Nucleosomes constitute the primary unit of eukaryotic chromatin and have been the focus of numerous informative single-molecule investigations regarding ...