Ringraziamo C Zhang per la cura dei pesci. Questo lavoro è stato sostenuto dalla National Science Foundation naturali della Cina (31.171.074, 31.371.099 e 31.571.067 di GP) e dal talento Progetto Pujiang (09PJ1401900 a GP).

Esperimenti zebrafish sono stati approvati dal Comitato Istituzionale cura degli animali e Usa Fudan University. Zebrafish sono state sollevate e allevati secondo le procedure standard 20. 1. preparativi <ol><li> Coltivare 17 dpf e 25 dpf zebrafish larvale <ol><li> Trasferimento 2 maschi e 2 femmine zebrafish adulti (in buona salute, da 3 a 6 mesi di età, di laboratorio AB strain) ad un serbatoio traversata nel tardo pomeriggio prima del giorno traversata. Separare i maschi e le femmine con una barriera. La mattina seguente, rinfrescare l&#39;acqua della vasca e togliere la barriera per consentire loro di accoppiarsi. Raccogliere uova a 100 mm di Petri 1 a 2 h dopo la fecondazione. </li><li> Tenere circa 40 embrioni in un piatto 100 millimetri con 40 ml di media embrione (EM) a 28,5 ° C durante il periodo di sviluppo iniziale (4 giorni) e aggiornare la EM due volte al giorno. Trasferimento larve a 1 serbatoi L (40 larve per 300 dell&#39;acqua del sistema mL) e si nutrono con rotiferi dal vivo (fornitura completa, due volte al giorno), dopo 5 dpf.Live feed artemie, invece di dieta rotifero dopo 10 dpf. Trasferire il pesce nel sistema ricircolo dell&#39;acqua a 14 dpf 21. </li><li> Sollevare zebrafish larvale nel sistema di ricircolo dell&#39;acqua fino al 17 dpf o 25 dpf. Garantire il ciclo luce / buio è 14/10 h ed il pH valore dell&#39;acqua sistema è di circa 7.2. Misurare la lunghezza del corpo di 17 dpf (5,5 a 6,8 millimetri) e 25 dpf (da 8 a 11 mm) larve 22. </li></ol></li><li> Preparare 2% agar per la dissezione. <ol><li> Aggiungere 4 g di agar a 200 ml di acqua sterile. Scaldare la miscela in un forno a microonde fino a quando si scopre trasparente. </li><li> Raffreddare la soluzione di agar per circa 15 minuti, poi versarlo in 60 mm di diametro Petri piatti (circa 1/3 del volume della piastra). Conservare le piastre di agar solidificato a 4 ° C. </li></ol></li></ol> 2. Protocollo 1: sezionare il tessuto gonadico del 17 e 25 dpf Larve <ol><li> Aggiungere ghiaccio tritato nel serbatoio per anestetizzare 17 dpf larve. trasferire illarve anestetizzato a un 100 mm refrigerate Petri con la soluzione di 30 ml di freddo Ringer. Mantenere il pesce incubate in soluzione della refrigerate di Ringer per almeno 15 minuti per anestetizzare completamente le larve. </li><li> Trasferire le larve di una piastra di agar pre-raffreddata con un cucchiaio di plastica di piccole dimensioni. Immergere l&#39;intero corpo di pesce in 10 ml refrigerate soluzione di Ringer e delicatamente adagiarla su un fianco. </li><li> Effettuare le seguenti operazioni sotto il campo di visione stereo microscopio 25X. Bloccare il tronco di pesce con una pinzetta per la stabilizzazione. Strappare l&#39;addome longitudinalmente dall&#39;ano al cuore con un altro paio di pinzette. Rimuovere delicatamente la pelle ed i muscoli su un lato del corpo per esporre gli organi interni. </li><li> Rimuovere la massa di organi ventrali alla vescica natatoria con attenzione. Evitare di danneggiare gonade attaccato alla vescica natatoria. </li><li> Tagliare il collegamento tra la vescica natatoria e il corpo anteriore. Estrarre l&#39;intera vescica natatoria e tessuto gonadico delicatamente. NOTA: Nella maggior parte casos, il tessuto gonadico a 17 dpf contiene circostante tessuto epiteliale e protonephridium. Essi non sono facilmente separati l&#39;uno dall&#39;altro, ma a 25 dpf può essere facilmente separati. Gonade è collegato anche l&#39;ano. Una giunzione con gonadi sinistra e destra collegati tra loro alle ano sarà chiaramente visibile. </li><li> Utilizzare le pinzette per separare con attenzione il tessuto gonadico dalla vescica natatoria e ripulire i tessuti adiposi circostanti. </li><li> trasferire immediatamente il tessuto gonadico isolato ad un prechilled 1,5 mL provetta contenente una soluzione di 200 microlitri Ringer. Tenere la provetta in ghiaccio fino a quando tutti i tessuti gonadici sono separati dal larve. </li><li> Sezionare le gonadi di 25 DPF larve come descritto nei punti 2.1 - 2.7. </li></ol> 3. Protocollo 2: Analisi di espressione genica dei tessuti gonadici isolati <ol><li> Estrarre l&#39;RNA totale dai tessuti gonadici larvali. <ol><li> Trasferire i isolati tessuti gonadici ad un nuovo RNase-free 1.5 ml di tubo e rimuovere soluzione di Ringer. Aggiungere 100 microlitri soluzione di lisi. Vortice finché i tessuti sono completamente lisato. </li><li> Eseguire la procedura di estrazione dell&#39;RNA totale secondo le istruzioni del produttore. </li><li> Aggiungere 1/10 volume di 10x DNasi I buffer e 1 ml di DNasi I per la soluzione di RNA e mescolare delicatamente. Incubare per 20 minuti a 37 ° C. </li><li> Aggiungere 1/10 del volume di reagente DNasi inattivazione alla soluzione di RNA. Incubare per 10 minuti a 70 ° C. Misurare la concentrazione di RNA totale utilizzando uno spettrofotometro. Conservare a -20 ° C. </li></ol></li><li> Eseguire sintesi del DNA prima filamento <ol><li> Utilizzare un oligo (dT) Primer -linker per eseguire la sintesi del primo filamento di cDNA seguendo il protocollo del produttore. Aggiungere 1 a 2 mg di RNA per un volume totale di reazione a 20 ml. </li><li> Incubare la soluzione di reazione per 90 minuti a 45 ° C. Terminare la reazione mediante riscaldamento a 70 ° C per 5 min. </li><li> Aggiungere 1 ml RNasi H al cDNA cosìluzione per rimuovere l&#39;RNA residua. Mescolare delicatamente e centrifugare per 10 s a ~ 13.000 x g. Incubare per 20 minuti a 37 ° C. Aggiungere 20 ml di acqua priva di nucleasi. Conservare a -70 ° C. </li></ol></li><li> Eseguire fluorescente PCR quantitativa <ol><li> Eseguire qPCR su un sistema ciclatore con un colorante fluorescente. Utilizzare i seguenti PCR condizioni di ciclo: 35 cicli a 95 ° C per 15 s, Tm-5 ° C per 15 s, 68 ° C per 30 s. Utilizzare sequenze primer come segue: AMH (fwd: GTGGATGGCAGCAGTACGAC; rev: GCGGAGAGGTGGAAGAGAGAATG), cyp19a1a (fwd: GTCCTGTTGTCTCCTACTGTCG; rev: CATTTGAGTTGAATATGATGCCCTG), nanos3 (fwd: GCTCGGTGTACGCCAAATCAACAT; rev: CCAAGTGAAAACACAACACCAGTGC), vasa (fwd: ATCGCATAGGAAGAACTGGACGCT; rev: CCAAGTGAAAACACAACACCAGTGC) e β-actina (fwd: AGTGCGACGTGGACATCCGTA; rev: GCACTTCCTGTGGACGATGGA) 19. </li></ol></li></ol>

<ol>
	<li>Wilson, C. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wild+sex+in+zebrafish:+loss+of+the+natural+sex+determinant+in+domesticated+strains.">Wild sex in zebrafish: loss of the natural sex determinant in domesticated strains.</a> Genetics. 198 (3), 1291-1308 (2014).</li><li>Liew, W. C., Orban, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zebrafish+sex:+a+complicated+affair.">Zebrafish sex: a complicated affair.</a> Genomics. 13 (2), 172-187 (2014).</li><li>Orban, L., Sreenivasan, R., Olsson, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long+and+winding+roads:+Testis+differentiation+in+zebrafish.">Long and winding roads: Testis differentiation in zebrafish.</a> Mol. Cell. Endocrinol. 312 (1-2), 35-41 (2009).</li><li>Blaser, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transition+from+non-motile+behaviour+to+directed+migration+during+early+PGC+development+in+zebrafish.">Transition from non-motile behaviour to directed migration during early PGC development in zebrafish.</a> J. Cell Sci. 118, 4027-4038 (2005).</li><li>Wang, X. G., Orban, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Anti-M&#252;llerian+hormone+and+11+&#946;-hydroxylase+show+reciprocal+expression+to+that+of+aromatase+in+the+transforming+gonad+of+zebrafish+males.">Anti-M&#252;llerian hormone and 11 &#946;-hydroxylase show reciprocal expression to that of aromatase in the transforming gonad of zebrafish males.</a> Dev. Dynam. 236 (5), 1329-1338 (2007).</li><li>Siegfried, K. R., N&#252;sslein-Volhard, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Germ+line+control+of+female+sex+determination+in+zebrafish.">Germ line control of female sex determination in zebrafish.</a> Dev. Biol. 324 (2), 277-287 (2008).</li><li>Uchida, D., Yamashita, M., Kitano, T., Iguchi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oocyte+apoptosis+during+the+transition+from+ovary-like+tissue+to+testes+during+sex+differentiation+of+juvenile+zebrafish.">Oocyte apoptosis during the transition from ovary-like tissue to testes during sex differentiation of juvenile zebrafish.</a> J. Exp. Biol. 205 (Pt 6), 711-718 (2002).</li><li>Groh, K. J., Sch&#246;nenberger, R., Eggen, R. I. L., Segner, H., Suter, M. J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+protein+expression+in+zebrafish+during+gonad+differentiation+by+targeted+proteomics.">Analysis of protein expression in zebrafish during gonad differentiation by targeted proteomics.</a> Gen. Comp. Endocr. 193, 210-220 (2013).</li><li>Siegfried, K. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+search+of+determinants:+gene+expression+during+gonadal+sex+differentiation.">In search of determinants: gene expression during gonadal sex differentiation.</a> J. Fish Biol. 76 (8), 1879-1902 (2010).</li><li>Small, C. M., Carney, G. E., Mo, Q., Vannucci, M., Jones, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+microarray+analysis+of+sex-+and+gonad-biased+gene+expression+in+the+zebrafish:+evidence+for+masculinization+of+the+transcriptome.">A microarray analysis of sex- and gonad-biased gene expression in the zebrafish: evidence for masculinization of the transcriptome.</a> BMC Genomics. 10, 579 (2009).</li><li>Chiang, E. F., Yan, Y. L., Guiguen, Y., Postlethwait, J., Chung, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+Cyp19+(P450+aromatase)+genes+on+duplicated+zebrafish+chromosomes+are+expressed+in+ovary+or+brain.">Two Cyp19 (P450 aromatase) genes on duplicated zebrafish chromosomes are expressed in ovary or brain.</a> Mol. Biol. Evol. 18 (4), 542-550 (2001).</li><li>Kishida, M., Callard, G. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+cytochrome+P450+aromatase+isoforms+in+zebrafish+(Danio+rerio)+brain+and+ovary+are+differentially+programmed+and+estrogen+regulated+during+early+development.">Distinct cytochrome P450 aromatase isoforms in zebrafish (Danio rerio) brain and ovary are differentially programmed and estrogen regulated during early development.</a> Endocrinology. 142 (2), 740-750 (2001).</li><li>Rodr&#237;guez-Mar&#237;, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+and+expression+pattern+of+zebrafish+anti-M&#252;llerian+hormone+(amh)+relative+to+sox9a,+sox9b,+and+cyp19a1a,+during+gonad+development.">Characterization and expression pattern of zebrafish anti-M&#252;llerian hormone (amh) relative to sox9a, sox9b, and cyp19a1a, during gonad development.</a> Gene Expr.Patterns. 5 (5), 655-667 (2005).</li><li>Krovel, A. V., Olsen, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+a+vas::EGFP+transgene+in+primordial+germ+cells+of+the+zebrafish.">Expression of a vas::EGFP transgene in primordial germ cells of the zebrafish.</a> Mech Dev. 116 (1-2), 141-150 (2002).</li><li>Krovel, A. V., Olsen, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sexual+dimorphic+expression+pattern+of+a+splice+variant+of+zebrafish+vasa+during+gonadal+development.">Sexual dimorphic expression pattern of a splice variant of zebrafish vasa during gonadal development.</a> Dev. Biol. 271 (1), 190-197 (2004).</li><li>Tzung, K. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Early+depletion+of+primordial+germ+cells+in+zebrafish+promotes+testis+formation.">Early depletion of primordial germ cells in zebrafish promotes testis formation.</a> Stem Cell Reports. 4 (1), 61-73 (2015).</li><li>Hsiao, C., Tsai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transgenic+zebrafish+with+fluorescent+germ+cell:+a+useful+tool+to+visualize+germ+cell+proliferation+and+juvenile+hermaphroditism+in+vivo.">Transgenic zebrafish with fluorescent germ cell: a useful tool to visualize germ cell proliferation and juvenile hermaphroditism in vivo.</a> Dev. Biol. 262 (2), 313-323 (2003).</li><li>Jorgensen, A., Nielsen, J. E., Morthorst, J. E., Bjerregaard, P., Leffers, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laser+capture+microdissection+of+gonads+from+juvenile+zebrafish.">Laser capture microdissection of gonads from juvenile zebrafish.</a> Reprod Biol Endocrinol. 7, 97 (2009).</li><li>Chen, S., Zhang, H., Wang, F., Zhang, W., Peng, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=nr0b1+(DAX1)+mutation+in+zebrafish+causes+female-to-male+sex+reversal+through+abnormal+gonadal+proliferation+and+differentiation.">nr0b1 (DAX1) mutation in zebrafish causes female-to-male sex reversal through abnormal gonadal proliferation and differentiation.</a> Mol. Cell. Endocrinol. 433, 105-116 (2016).</li><li>Westerfield, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The Zebrafish Book: A Guide for The Laboratory Use of Zebrafish (Danio rerio). , (2000).</li><li>Liew, W. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polygenic+sex+determination+system+in+zebrafish.">Polygenic sex determination system in zebrafish.</a> PLoS One. 7 (4), e34397 (2012).</li><li>Parichy, D. M., Elizondo, M. R., Mills, M. G., Gordon, T. N., Engeszer, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Normal+table+of+postembryonic+zebrafish+development:+staging+by+externally+visible+anatomy+of+the+living+fish.">Normal table of postembryonic zebrafish development: staging by externally visible anatomy of the living fish.</a> Dev Dyn. 238 (12), 2975-3015 (2009).</li><li>Gupta, T., Mullins, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+of+Organs+from+the+Adult+Zebrafish.">Dissection of Organs from the Adult Zebrafish.</a> J. Vis Exp. (37), (2010).</li><li>Arnaout, R., Reischauer, S., Stainier, D. Y. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recovery+of+Adult+Zebrafish+Hearts+for+High-throughput+Applications.">Recovery of Adult Zebrafish Hearts for High-throughput Applications.</a> J. Vis Exp. (94), (2014).</li><li>Gerlach, G. F., Schrader, L. N., Wingert, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+of+the+Adult+Zebrafish+Kidney.">Dissection of the Adult Zebrafish Kidney.</a> J. Vis Exp. (54), (2011).</li><li>Yoon, C., Kawakami, K., Hopkins, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zebrafish+vasa+homologue+RNA+is+localized+to+the+cleavage+planes+of+2-+and+4-cell-stage+embryos+and+is+expressed+in+the+primordial+germ+cells.">Zebrafish vasa homologue RNA is localized to the cleavage planes of 2- and 4-cell-stage embryos and is expressed in the primordial germ cells.</a> Development. 124 (16), 3157-3165 (1997).</li><li>Braat, A. K., Speksnijder, J. E., Zivkovic, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Germ+line+development+in+fishes.">Germ line development in fishes.</a> Int. J. Dev. Biol. 43 (7), 745-760 (1999).</li><li>Huang, H. Y., Ketting, R. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+zebrafish+gonads+for+RNA+isolation.">Isolation of zebrafish gonads for RNA isolation.</a> Methods Mol Biol. 1093, 183-194 (2014).</li></ol>

Gli autori dichiarano di non avere interessi finanziari in competizione.

Il pesce zebra è diventato un modello potente ed è ampiamente utilizzato nello sviluppo e nella ricerca sulle malattie correlate. I metodi per l&#39;isolamento degli organi in zebrafish adulti come il cervello, il cuore, gonadi, e del rene, sono stati ben documentati 23, 24, 25. A causa delle piccole dimensioni e rimodellamento dinamica dei tessuti gonadici nella zebrafish larvale, isolamento di tessuto gonadico è un compito...

Il principale determinante del sesso femminile nel selvaggio cromosoma zebrafish 4 è perso o modificato nel zebrafish addomesticato (vale a dire i ceppi più comuni di laboratorio) 1. Al contrario, hanno un sistema di determinazione del sesso poligenica accompagnato da fattori ambientali come la temperatura, l&#39;ipossia, la disponibilità di cibo e la densità di popolazione. I meccanismi dettagliati dello sviluppo sessuale zebrafish non sono pienamente compresi. Domande fondamentali come quando si verifica determinazione del sesso zebrafish, ciò che il segnale determinazione sessuale primaria (s) è / sono, e quali geni regolano il primo passo di trasformazione gonadi restano da risolvere 2, 3. Nel processo di sviluppo sessuale zebrafish, più tappe importanti sono state riconosciute. Nella fase iniziale di sviluppo, a partire dal 4 HPF (ore dopo la fecondazione) cellule germinali primordiali (PGC) sottoporsi specifica, migrazione cresta genitale eproliferazione. Numeri PGC e interazioni reciproche tra cellule germinali e cellule somatiche sono importanti per gonadi differenziazione 4. A 13 dpf (giorni dopo la fecondazione), le gonadi sono in fase indifferenziata. Con 17 DPF, le gonadi si sviluppano in ovaie bi-potenziali in entrambi i maschi e femmine futuri. La transizione apoptosi dipendente da ovaio al testicolo inizio alle 21 a 25 dpf e può continuare per diverse settimane. Da 35 dpf, il sesso della gonade è stata determinata e produzione di gameti sesso-specifico è in corso in entrambe le ovaie e testicoli 5, 6, 7. Fino ad oggi, sono stati proposti diversi geni candidati ei meccanismi di determinazione del sesso. Proteomica e analisi trascrittomica hanno isolato molti geni con espressione dimorfismo sessuale e questi geni sono stati utilizzati per studiare la differenziazione del sesso in zebrafish 8, </sup&gt; 9, 10. Ad esempio, in zebrafish larvale, il gene cyp19a1a è specificamente espresso nelle ovaie, ma non nel testicolo 11, 12. Inoltre, gene amh è debolmente espressa nelle cellule follicolo granulosa ovarica, ma fortemente nei testicoli cellule di Sertoli 13. Al contrario, gene vasa continuamente espresso nelle cellule germinali sia zebrafish maschile e femminile, che lo rendono adatto marcatore gonadi 14, 15. Indagare gonadici livelli di espressione genica è fondamentale per capire il meccanismo molecolare di determinazione del sesso e la differenziazione soprattutto nella fase ovaie bi-potenziale 3, 9. Tuttavia, le piccole dimensioni delle zebrafish larvale e corrispondentemente piccole gonadi complicare l&#39;isolamento di gonadal tessuti per ulteriori analisi molecolari. Precedenti studi utilizzati sezionati tutta la regione del tronco tra l&#39;opercoli e pori anale 16. Questa preparazione, anche se contenenti gonadi, costituito da più tessuti e organi. In alternativa, gli animali transgenici con espressione GFP specifico gonade come vasa: EGFP sono stati usati per l&#39;isolamento tessuto gonadico mediante fluorescenza delle cellule attivate (FACS) e la cattura laser micro-dissezione 17, 18. Ma la loro applicazione diffusa è limitata. Qui, descriviamo una semplice procedura per isolare il tessuto gonadico da zebrafish larvale a 17 dpf e 25 dpf. Dimostriamo la posizione delle gonadi rispetto ad altri organi e isolare le gonadi morfologicamente intatte dai tessuti circostanti. Mostriamo ulteriormente i geni specifici gonade come vasa e cyp19a1a sono altamente espresso nelle gonadi isolate rispetto al tessuto tronco tramite PCR quantitativa (qPCR) analisi. Il presente protocollo permette l&#39;identificazione, l&#39;isolamento, la purificazione dell&#39;RNA e l&#39;amplificazione di geni specifici gonadici da zebrafish larvale, consentendo così successiva analisi molecolare del tessuto gonadica 19.

<table><tbody><tr><td>Cell culture dish 100 mm</td><td>Corning</td><td>430167</td><td>For embryo incubation</td></tr><tr><td>20x EM</td><td></td><td></td><td>For a 1 L needed: add 17.5 g NaCl, 0.75 g KCl and 2.9 g CaCl&amp;#183;2H&lt;sub&gt;2&lt;/sub&gt;O; then add 0.41 g KH&lt;sub&gt;2&lt;/sub&gt;PO4, 0.412 g Na&lt;sub&gt;2&lt;/sub&gt;HPO4 anhydrous and 4.9 g MgSO&lt;sub&gt;4&lt;/sub&gt;&amp;#183;7H&lt;sub&gt;2&lt;/sub&gt;O.</td></tr><tr><td>1x EM</td><td></td><td></td><td>Dilute 20x EM in distilled water</td></tr><tr><td>AGAROSE G-10</td><td>Gene</td><td>121985</td><td>For preparing the 2% agar plates</td></tr><tr><td>Trizol Reagent</td><td>Invitrogen</td><td>15596-026</td><td>For RNA isolation</td></tr><tr><td>Meter glass</td><td>Shen Bo</td><td>250 ml</td><td>For preparing the 2% agar plates</td></tr><tr><td>Microwave Oven</td><td>Midea</td><td>M1-211A</td><td>For heating the AGAR</td></tr><tr><td>Tweezer DUMONT#5INOX</td><td>World Precision Instrument</td><td>500341</td><td>For dissection</td></tr><tr><td>Stereomicroscope</td><td>Motic</td><td>SMZ168</td><td>For dissection</td></tr><tr><td>Pure water equipment</td><td>Millipore</td><td></td><td></td></tr><tr><td>Ringer&amp;rsquo;s solution</td><td></td><td></td><td>For a 1 L needed: Add 6.78 g NaCl, 0.22 g KCl, 0.26 g CaCl&lt;sub&gt;2&lt;/sub&gt; and 1.19 g Hepes; then fill to 1 L; Adjust pH to 7.2. Sterilize by filtration and keep in an autoclaved clear polycarbonate container.</td></tr><tr><td>Transfer pipette</td><td>Samco</td><td>202, 204</td><td></td></tr><tr><td>Metal bath</td><td>QiLinbeier</td><td></td><td>Model GL-150</td></tr><tr><td>Microscope</td><td>Leica&amp;nbsp;</td><td>M205 FA</td><td>For photomicrograph</td></tr><tr><td>Centrifuge</td><td>Eppendorf</td><td>5417R</td><td></td></tr><tr><td>Micro Scale RNA Isolation Kit</td><td>Ambion</td><td>AM1931</td><td>For RNA isolation from gonad tissues</td></tr><tr><td>Dnase I</td><td>Sigma</td><td>AMPD1-1KT</td><td>For DNA digestion in the RNA solution</td></tr><tr><td>RevertAid First Strand cDNA Synthesis Kit</td><td>Thermo Scientific</td><td>#K1631</td><td>For first-strand cDNA synthesis</td></tr><tr><td>Rnase H</td><td>Thermo Scientific</td><td>#EN0202</td><td>For digesting the residual RNA in the cDNA solution.</td></tr><tr><td>SYBR Green Realtime PCR Master Mix</td><td>TOYOBO</td><td>QPK-201</td><td>This product is a Taq DNA polymerase-based 2x master mix for real-time PCR and&amp;nbsp; applicable for intercalation assay with SYBR Green I.</td></tr><tr><td>Spectrophotometer</td><td>Ne Drop</td><td>OD-2000+</td><td>Measuring the concentration of the total RNA</td></tr><tr><td>Mastercycler</td><td>Eppendorf</td><td>AG 22331 Hamburg</td><td>gene expression profiling</td></tr></tbody></table>

dissection of larval zebrafish gonadal tissue

Anche se zebrafish selvatici in possesso di un / ZW determinazione del sesso ZZ, zebrafish addomesticato hanno perso il cromosoma sessuale. Essi utilizzano un sistema di determinazione del sesso poligenica, in cui diversi geni distribuiti in tutto il genoma determinare collettivamente le identità sessuali di singoli pesci. Attualmente, i geni coinvolti nella regolazione dello sviluppo delle gonadi e come funzionano rimangono sfuggente. Normalmente, isolando tessuto gonadico è il primo passo per esaminare i processi di sviluppo del sesso. Qui vi presentiamo una procedura per isolare il tessuto gonadico da 17 dpf (giorni dopo la fecondazione) e 25 dpf larve di zebrafish. Il tessuto gonadico isolato può essere successivamente esaminati dalla morfologia e l&#39;espressione genica.

Dissezioni delle gonadi sono state effettuate su AB strain zebrafish larvale. La figura 1 mostra tessuto tipico gonadi di zebrafish larvale a 17 dpf e 25 dpf. In primo luogo, la pelle ei muscoli di un lato dell&#39;addome viene tagliato per esporre gli organi interni. Dopo aver rimosso la massa degli organi interni, la vescica natatoria insieme gonade rimangono nel bagagliaio. Gonade era attaccato alla faccia ventrale vescica natatoria (freccia in <strong cl...

Watch this Scientific Journal Video about Dissection of Larval Zebrafish Gonadal Tissue at JoVE.com

Dissection of Larval Zebrafish Gonadal Tissue

Qui, vi presentiamo un protocollo per isolare il tessuto gonadico di zebrafish larvale, che faciliterà le indagini della differenziazione sessuale zebrafish e manutenzione.

La dissezione del larvale Zebrafish gonadica Tissue

Although wild zebrafish possess a ZZ/ZW sex-determination system, domesticated zebrafish have lost the sex chromosome. They utilize a polygenic sex ...

dissection-of-larval-zebrafish-gonadal-tissue

Universidad de Cartagena UDEC

Research

JoVE Journal

Developmental Biology

10.2K Views.  Fudan University.  Qui, vi presentiamo un protocollo per isolare il tessuto gonadico di zebrafish larvale, che faciliterà le indagini della differenziazione sessuale zebrafish e manutenzione. 

Video: Dissection of Larval Zebrafish Gonadal Tissue

Dissection and Lateral Mounting of Zebrafish Embryos: Analysis of Spinal Cord Development

The zebrafish spinal cord is an effective investigative model for nervous system research for several reasons. First, genetic, transgenic and gene knockdown approaches can be utilized to examine the molecular mechanisms underlying nervous system development. Second, large clutches of developmentally synchronized embryos provide large experimental sample sizes. Third, the optical clarity of the zebrafish embryo permits researchers to visualize progenitor, glial, and neuronal populations. Although zebrafish embryos are transparent, specimen thickness can impede effective microscopic visualization. One reason for this is the tandem development of the spinal cord and overlying somite tissue. Another reason is the large yolk ball, which is still present during periods of early neurogenesis. In this article, we demonstrate microdissection and removal of the yolk in fixed embryos, which allows microscopic visualization while preserving surrounding somite tissue. We also demonstrate semipermanent mounting of zebrafish embryos. This permits observation of neurodevelopment in the dorso-ventral and anterior-posterior axes, as it preserves the three-dimensionality of the tissue.

Developmental processes such as proliferation, patterning, differentiation, and axon guidance can be readily modeled in the zebrafish spinal cord. In this article, we describe a mounting procedure for zebrafish embryos, which optimizes visualization of these events.

Dissezione e laterale Montaggio di embrioni di zebrafish: analisi dello sviluppo del midollo spinale

The zebrafish spinal cord is an effective investigative model for nervous system research for several reasons. First, genetic, transgenic and gene ...

Ricerca

Neuroscienze

Dissection of Organs from the Adult Zebrafish

Over the last 20 years, the zebrafish has become a powerful model organism for understanding vertebrate development and disease.  Although experimental analysis of the embryo and larva is extensive and the morphology has been well documented, descriptions of adult zebrafish anatomy and studies of development of the adult structures and organs, together with techniques for working with adults are lacking. The organs of the larva undergo significant changes in their overall structure, morphology, and anatomical location during the larval to adult transition.  Externally, the transparent larva develops its characteristic adult striped pigment pattern and paired pelvic fins, while internally, the organs undergo massive growth and remodeling.  In addition, the bipotential gonad primordium develops into either testis or ovary.  This protocol identifies many of the organs of the adult and demonstrates methods for dissection of the brain, gonads, gastrointestinal system, heart, and kidney of the adult zebrafish. The dissected organs can be used for in situ hybridization, immunohistochemistry, histology, RNA extraction, protein analysis, and other molecular techniques.  This protocol will assist in the broadening of studies in the zebrafish to include the remodeling of larval organs, the morphogenesis of organs specific to the adult and other investigations of the adult organ systems.

This protocol describes a procedure for identifying and dissecting organs from the adult zebrafish.

Dissezione di organi dal Zebrafish adulti

Over the last 20 years, the zebrafish has become a powerful model organism for understanding vertebrate development and disease.  Although experimental ...

Biologia

Spinal Cord Transection in the Larval Zebrafish

Mammals fail in sensory and motor recovery following spinal cord injury due to lack of axonal regrowth below the level of injury as well as an inability to reinitiate spinal neurogenesis. However, some anamniotes including the zebrafish Danio rerio exhibit both sensory and functional recovery even after complete transection of the spinal cord. The adult zebrafish is an established model organism for studying regeneration following spinal cord injury, with sensory and motor recovery by 6&#160;weeks post-injury. To take advantage of in vivo analysis of the regenerative process available in the transparent larval zebrafish as well as genetic tools not accessible in the adult, we use the larval zebrafish to study regeneration after spinal cord transection. Here we demonstrate a method for reproducibly and verifiably transecting the larval spinal cord. After transection, our data shows sensory recovery beginning at 2&#160;days post-injury (dpi), with the C-bend movement detectable by 3 dpi and resumption of free swimming by 5 dpi. Thus we propose the larval zebrafish as a companion tool to the adult zebrafish for the study of recovery after spinal cord injury.

After spinal transection, adult zebrafish have functional recovery by six weeks post-injury. To take advantage of larval transparency and faster recovery, we present a method for transecting the larval spinal cord. After transection, we observe sensory recovery beginning at 2&#160;days post-injury, and C-bend movement by 3 days post-injury.

Spinal Cord transezione nel larvale Zebrafish

Mammals fail in sensory and motor recovery following spinal cord injury due to lack of axonal regrowth below the level of injury as well as an inability ...

Dissection and Live-Imaging of the Late Embryonic Drosophila Gonad

The Drosophila melanogaster male embryonic gonad is an advantageous model to study various aspects of developmental biology including, but not limited to, germ cell development, piRNA biology, and niche formation. Here, we present a dissection technique to live-image the gonad ex vivo during a period when in vivo live-imaging is highly ineffective. This protocol outlines how to transfer embryos to an imaging dish, choose appropriately-staged male embryos, and dissect the gonad from its surrounding tissue while still maintaining its structural integrity. Following dissection, gonads can be imaged using a confocal microscope to visualize dynamic cellular processes. The dissection procedure requires precise timing and dexterity, but we provide insight on how to prevent common mistakes and how to overcome these challenges. To our knowledge this is the first dissection protocol for the Drosophila embryonic gonad, and will permit live-imaging during an otherwise inaccessible window of time. This technique can be combined with pharmacological or cell-type specific transgenic manipulations to study any dynamic processes occurring within or between the&#160;cells in their natural gonadal environment.

Dissection and Live-Imaging of the Late Embryonic Drosophila Gonad

Here, we provide a dissection protocol required to live-image the late embryonic Drosophila male gonad. This protocol will permit observation of dynamic cellular processes under normal conditions or after transgenic or pharmacological manipulation.

Dissezione e Live-Imaging della Drosophila Gonad embrionale tardiva

The Drosophila melanogaster male embryonic gonad is an advantageous model to study various aspects of developmental biology including, but not limited to, ...

Biologia dello sviluppo

Microdissection of Zebrafish Embryonic Eye Tissues

Zebrafish is a popular animal model for research on eye development because of its rapid ex utero development and good fecundity. By 3 days post fertilization (dpf), the larvae will show the first visual response. Many genes have been identified to control a proper eye development, but we are far from a complete understanding of the underlying genetic architecture. Whole genome gene expression profiling is a useful tool to elucidate genetic regulatory network for eye development. However, the small size of the embryonic eye in zebrafish makes it challenging to obtain intact and pure eye tissues for expression analysis. For example, the anterior-posterior length of the eye between day 2 and 3 is only approximately 200-300 &mu;m, while the diameter of the lens is less 100 &mu;m. Also, the retinal pigment epithelium (RPE) underlying the retina is just a single-layer epithelium. While gene expression profiles can be obtained from the whole embryo, they do not accurately represent the expression of these tissues. Therefore pure tissue must be obtained for a successful gene expression profiling of eye development. To address this issue, we have developed an approach to microdissect intact retina and retina with RPE attached from 1-3 dpf, which cover major stages of eye morphogenesis. All procedures can be done with fine forceps and general laboratory supplies under standard stereomicroscopes. For retinal dissection, the single-layer RPE is removed and peeled off by brushing action and the preferential adherence of the RPE remnants to the surface of the culture plate for dissection. For RPE-attached retinal dissection, the adherence of RPE to the dissection plate is removed before the dissection so that the RPE can be completely preserved with the retina. A careful lifting action of this tissue can efficiently separate the presumptive choroid and sclera. The lens can be removed in both cases by a chemically etched tungsten needle. In short, our approach can obtain intact eye tissues and has been successfully utilized to study tissue-specific expression profiles of zebrafish retina1, 2 and retinal pigment epithelium3.

This article describes an approach to microdissect zebrafish retinas with and without retinal pigment epithelium attached, from one to three days postfertilization embryos.

Microdissezione dei tessuti oculari Zebrafish embrionali

Zebrafish is a popular animal model for research on eye development because of its rapid ex utero development and good fecundity. By 3 days post ...

Eye Removal in Living Zebrafish Larvae to Examine Innervation-dependent Growth and Development of the Visual System

Zebrafish exhibit remarkable life-long growth and regenerative abilities. For example, specialized stem cell niches established during embryogenesis support continuous growth of the entire visual system, both in the eye and the brain. Coordinated growth between the retinae and the optic tectum ensures accurate retinotopic mapping as new neurons are added in the eyes and brain. To address whether retinal axons provide crucial information for regulating tectal stem and progenitor cell behaviors such as survival, proliferation, and/or differentiation, it is necessary to be able to compare innervated and denervated tectal lobes within the same animal and across animals. 
Surgical removal of one eye from living larval zebrafish followed by observation of the optic tectum achieves this goal. The accompanying video demonstrates how to anesthetize larvae, electrolytically sharpen tungsten needles, and use them to remove one eye. It next shows how to dissect brains from fixed zebrafish larvae. Finally, the video provides an overview of the protocol for immunohistochemistry and a demonstration of how to mount stained embryos in low-melting-point agarose for microscopy.

The article explains how to surgically remove eyes from living zebrafish larvae as the first step toward investigating how retinal input influences optic tectum growth and development. In addition, the article provides information about larval anesthetization, fixation, and brain dissection, followed by immunohistochemistry and confocal imaging.

Rimozione dell'occhio nelle larve di zebrafish viventi per esaminare la crescita dipendente dall'innervazione e lo sviluppo del sistema visivo

Zebrafish exhibit remarkable life-long growth and regenerative abilities. For example, specialized stem cell niches established during embryogenesis ...

Elaborazione di cellule intestinali da larve di pesce zebra per il sequenziamento dell'RNA a cellula singola

Gut Isolation from Zebrafish Larvae for Single-cell RNA Sequencing

The gastrointestinal (GI) tract performs a range of functions essential for life. Congenital defects affecting its development can lead to enteric neuromuscular disorders, highlighting the importance to understand the molecular mechanisms underlying GI development and dysfunction. In this study, we present a method for gut isolation from zebrafish larvae at 5 days post fertilization to obtain live,&#160;viable cells which can be used for single-cell RNA sequencing (scRNA-seq) analysis. This protocol is based on the manual dissection of the zebrafish intestine, followed by enzymatic dissociation with papain. Subsequently, cells are submitted to fluorescence-activated cell sorting, and viable cells are collected for scRNA-seq. With this method, we were able to successfully identify different intestinal cell types, including epithelial, stromal, blood, muscle, and immune cells, as well as enteric neurons and glia. Therefore, we consider it to be a valuable resource for studying the composition of the GI tract in health and disease, using the zebrafish.

Autore in primo piano: Isolamento e analisi delle cellule intestinali delle larve di zebrafish per lo studio degli aspetti trascrittomici dello sviluppo gastrointestinale 

Here, we describe a method for gut isolation from zebrafish larvae at 5 days post fertilization, for single-cell RNA sequencing analysis.

Isolamento intestinale da larve di pesce zebra per il sequenziamento dell'RNA a singola cellula

The gastrointestinal (GI) tract performs a range of functions essential for life. Congenital defects affecting its development can lead to enteric ...

Heart Dissection in Larval, Juvenile and Adult Zebrafish, Danio rerio

Zebrafish have become a beneficial and practical model organism for the study of embryonic heart development (see recent reviews1-6), however, work examining post-embryonic through adult cardiac development has been limited7-10. Examining the changing morphology of the maturing and aging heart are restricted by the lack of techniques available for staging and isolating juvenile and adult hearts. In order to analyze heart development over the fish's lifespan, we dissect zebrafish hearts at numerous stages and photograph them for further analysis11. The morphological features of the heart can easily be quantified and individual hearts can be further analyzed by a host of standard methods. Zebrafish grow at variable rates and maturation correlates better with fish size than age, thus, post-fixation, we photograph and measure fish length as a gauge of fish maturation. This protocol explains two distinct, size dependent dissection techniques for zebrafish, ranging from larvae 3.5mm standard length (SL) with hearts of 100&mu;m ventricle length (VL), to adults, with SL of 30mm and VL 1mm or larger. Larval and adult fish have quite distinct body and organ morphology. Larvae are not only significantly smaller, they have less pigment and each organ is visually very difficult to identify. For this reason, we use distinct dissection techniques.
We used pre-dissection fixation procedures, as we discovered that hearts dissected directly after euthanization have a more variable morphology, with very loose and balloon like atria compared with hearts removed following fixation. The fish fixed prior to dissection, retain in vivo morphology and chamber position (data not shown). In addition, for demonstration purposes, we take advantage of the heart (myocardial) specific GFP transgenic Tg(myl7:GFP)twu34 (12), which allows us to visualize the entire heart and is particularly useful at early stages in development when the cardiac morphology is less distinct from surrounding tissues. Dissection of the heart makes further analysis of the cell and molecular biology underlying heart development and maturation using in situ hybridization, immunohistochemistry, RNA extraction or other analytical methods easier in post-embryonic zebrafish. This protocol will provide a valuable technique for the study of cardiac development maturation and aging.

Heart Dissection in Larval, Juvenile and Adult Zebrafish, Danio rerio

A clear, standardized method for dissection and isolation of the zebrafish heart at multiple developmental stages are described. Annotation and quantification techniques are also discussed.

Dissezione di cuore in larvale, Zebrafish giovanile e degli adulti, Danio rerio</em

Zebrafish have become a beneficial and practical model organism for the study of embryonic heart development (see recent reviews1-6), however, work ...

La dissezione del larvale Zebrafish gonadica Tissue

Riepilogo

Esplora Altri Video

Capitoli in questo video

Dissezione e laterale Montaggio di embrioni di zebrafish: analisi dello sviluppo del midollo spinale

Dissezione di organi dal Zebrafish adulti

Spinal Cord transezione nel larvale Zebrafish

Dissezione e Live-Imaging della Drosophila Gonad embrionale tardiva

Microdissezione dei tessuti oculari Zebrafish embrionali

Rimozione dell'occhio nelle larve di zebrafish viventi per esaminare la crescita dipendente dall'innervazione e lo sviluppo del sistema visivo

Isolamento intestinale da larve di pesce zebra per il sequenziamento dell'RNA a singola cellula

Isolamento intestinale da larve di pesce zebra per il sequenziamento dell'RNA a singola cellula

Isolamento intestinale da larve di pesce zebra per il sequenziamento dell'RNA a singola cellula

Dissezione di cuore in larvale, Zebrafish giovanile e degli adulti, Danio rerio