Name: dissection of larval zebrafish gonadal tissue
Uploaded: 2017-04-26T14:00:00.000+00:00
Duration: 10 min 43 s
Description: Watch this Scientific Journal Video about Dissection of Larval Zebrafish Gonadal Tissue at JoVE.com

نشكر C تشانغ لرعاية الأسماك. وأيد هذا العمل من قبل مؤسسة العلوم الطبيعية الوطنية الصينية (31171074، 31371099 و31571067 لGP) ومشروع المواهب بوجيانج (09PJ1401900 لGP).

تمت الموافقة على التجارب الزرد من قبل لجنة رعاية الحيوان المؤسسية واستخدم جامعة فودان. وأثيرت الزرد ولدت وفقا للاجراءات المتبعة 20. 1. الاستعدادات <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> زراعة 17 DPF و 25 DPF الزرد اليرقات <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> نقل 2 ذكور و 2 إناث الزرد الكبار (صحية، 3-6 أشهر من العمر، والمختبرات أب سترين) إلى خزان المعبر في وقت متأخر بعد الظهر قبل يوم العبور. فصل الذكور والإناث مع الجدار. في صباح اليوم التالي، وتجديد خزان المياه وإزالة الحاجز للسماح لهم للتزاوج. جمع البيض في 100 ملم أطباق بتري 1-2 ساعة بعد الإخصاب. </li><li style=";text-align:right;direction:rtl"> والحفاظ على حوالي 40 الأجنة في لوحة 100 ملم مع 40 مل الجنين المتوسطة (EM) في 28.5 درجة مئوية خلال فترة النمو المبكر (4 أيام) وتحديث EM مرتين في اليوم. نقل اليرقات إلى 1 الدبابات L (40 اليرقات إلى 300 مل من الماء النظام) وتغذية مع الدوارات الحية (العرض الكامل، مرتين في اليوم) بعد 5 DPF.تغذية الأرتيميا العيش بدلا من اتباع نظام غذائي حيدة الخلية والروتيفر بعد 10 DPF. نقل الأسماك إلى تعميم-إعادة نظام المياه في 14 DPF 21. </li><li style=";text-align:right;direction:rtl"> رفع الزرد اليرقات في نظام المياه تعميم إعادة حتى 17 DPF أو 25 DPF. ضمان دورة الخفيفة / مظلمة هو 14/10 ساعة ودرجة الحموضة قيمة المياه النظام حوالي 7.2. قياس طول الجسم من 17 DPF (5،5-6،8 مم) و 25 DPF (8-11 ملم) يرقات 22. </li></ol></li><li style=";text-align:right;direction:rtl"> إعداد 2٪ لوحات أجار للتشريح. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> إضافة 4 ز أجار إلى 200 مل من الماء المعقم. تسخين الخليط في فرن الميكروويف حتى يتحول شفافة. </li><li style=";text-align:right;direction:rtl"> تبريد حل أجار لمدة 15 دقيقة، ثم سكبه في 60 مم أطباق بتري (حوالي 1/3 حجم لوحة). تخزين لوحات أجار طدت في 4 درجات مئوية. </li></ol></li></ol> 2. بروتوكول 1: تشريح الأنسجة الغدد التناسلية بين 17 و 25 يرقات DPF <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> إضافة الثلج المجروش في خزان لتخدير 17 يرقات DPF. نقلاليرقات تخدير إلى 100 ملم المبردة طبق بيتري مع حل 30 مل البرد رينغر. الحفاظ على الأسماك المحتضنة في حل رينغر مبردة لمدة 15 دقيقة على الأقل لتخدير كامل اليرقات. </li><li style=";text-align:right;direction:rtl"> نقل اليرقات إلى لوحة آغار precooled مع ملعقة صغيرة من البلاستيك. غمر جسم السمكة بالكامل في 10 مل المبردة حل قارع الأجراس ووضع برفق على جانبها. </li><li style=";text-align:right;direction:rtl"> هل العمليات التالية تحت مجال الرؤية من 25X المجهر ستيريو. المشبك جذع السمك مع ملاقط لتحقيق الاستقرار. مزق البطن طوليا من فتحة الشرج إلى القلب مع زوج آخر من الملقط. إزالة بلطف الجلد والعضلات على جانب واحد من الجسم لكشف الأعضاء الداخلية. </li><li style=";text-align:right;direction:rtl"> إزالة كتلة من أجهزة بطني إلى المثانة السباحة بعناية. تجنب إتلاف الغدد التناسلية تعلق على المثانة السباحة. </li><li style=";text-align:right;direction:rtl"> قطع الاتصال بين المثانة السباحة والجسم الأمامي. سحب المثانة السباحة بأكملها والأنسجة الغدد التناسلية بلطف. ملاحظة: في معظم الحالاتالصورة، أنسجة الغدد التناسلية في 17 DPF تحتوي المحيطة الأنسجة الطلائية وprotonephridium. لا ينفصلون بسهولة عن بعضها البعض، ولكن في 25 DPF يمكن فصلها بسهولة. توصيل الغدد التناسلية أيضا إلى فتحة الشرج. وهناك تقاطع مع الغدد التناسلية اليسار واليمين متصلة مع بعضها البعض في فتحة الشرج تكون مرئية بشكل واضح. </li><li style=";text-align:right;direction:rtl"> استخدام ملاقط لفصل بعناية أنسجة الغدد التناسلية من المثانة السباحة وتنظيف الأنسجة الدهنية المحيطة بها. </li><li style=";text-align:right;direction:rtl"> على الفور نقل أنسجة الغدد التناسلية معزولة إلى prechilled 1.5 مل أنبوب الطرد المركزي التي تحتوي على حل 200 ميكرولتر رينغر. الحفاظ على أنبوب على الجليد حتى يتم فصل جميع أنسجة الغدد التناسلية من اليرقات. </li><li style=";text-align:right;direction:rtl"> تشريح الغدد التناسلية من 25 يرقات DPF كما هو موضح في الخطوات 2،1-2،7. </li></ol> 3. بروتوكول 2: تحليل التعبير الجيني في أنسجة الغدد التناسلية المعزولة <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> استخراج الحمض النووي الريبي مجموع من أنسجة الغدد التناسلية اليرقات. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> نقل أنسجة الغدد التناسلية معزولة إلى ريبونوكلياز خالية الجديد 1.5 مل أنبوب وإزالة حل رينغر. إضافة 100 ميكرولتر حل تحلل. وهي lysed دوامة حتى الأنسجة تماما. </li><li style=";text-align:right;direction:rtl"> تنفيذ الإجراء مجموع استخراج الحمض النووي الريبي وفقا لتعليمات الشركة الصانعة. </li><li style=";text-align:right;direction:rtl"> إضافة 10/01 حجم 10X الدناز أنا العازلة و 1 ميكرولتر من الدناز الأول لهذا الحل RNA وتخلط بلطف. احتضان لمدة 20 دقيقة عند 37 درجة مئوية. </li><li style=";text-align:right;direction:rtl"> إضافة 10/01 حجم الدناز تعطيل كاشف إلى حل RNA. احتضان لمدة 10 دقيقة في 70 ° C. قياس تركيز الحمض النووي الريبي مجموع باستخدام مقياس الطيف الضوئي. تخزين في درجة حرارة -20 درجة مئوية. </li></ol></li><li style=";text-align:right;direction:rtl"> أداء التوليف [كدنا حبلا أولا <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> استخدام بنسبة ضئيلة (DT) -linker التمهيدي لأداء أول حبلا التوليف [كدنا بعد بروتوكول تصنيع. إضافة 1-2 ميكروغرام من الحمض النووي الريبي لإجمالي حجم رد الفعل إلى 20 ميكرولتر. </li><li style=";text-align:right;direction:rtl"> احتضان محلول التفاعل لمدة 90 دقيقة في 45 ° C. إنهاء رد فعل عن طريق التسخين عند 70 درجة مئوية لمدة 5 دقائق. </li><li style=";text-align:right;direction:rtl"> إضافة 1 ميكرولتر ريبونوكلياز H إلى [كدنا ذلكlution لإزالة RNA المتبقية. المزيج بلطف وأجهزة الطرد المركزي لمدة 10 ق في ~ 13000 ز س. احتضان لمدة 20 دقيقة عند 37 درجة مئوية. إضافة 20 ميكرولتر المياه مجانا نوكلياز. تخزين في -70 ° C. </li></ol></li><li style=";text-align:right;direction:rtl"> أداء الفلورسنت PCR الكمي <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> أداء QPCR على نظام cycler على مع صبغة الفلورسنت. استخدام الظروف الدراجات PCR التالية: 35 دورة في 95 درجة مئوية لمدة 15 ثانية، TM-5 درجة مئوية لمدة 15 ثانية، 68 درجة مئوية لمدة 30 ثانية. استخدام تسلسل التمهيدي على النحو التالي: AMH (إعادة توجيه: GTGGATGGCAGCAGTACGAC، مراجعة: GCGGAGAGGTGGAAGAGAGAATG)، cyp19a1a (إعادة توجيه: GTCCTGTTGTCTCCTACTGTCG، مراجعة: CATTTGAGTTGAATATGATGCCCTG)، nanos3 (إعادة توجيه: GCTCGGTGTACGCCAAATCAACAT، مراجعة: CCAAGTGAAAACACAACACCAGTGC)، الأوعية (إعادة توجيه: ATCGCATAGGAAGAACTGGACGCT، مراجعة: CCAAGTGAAAACACAACACCAGTGC) و β-الأكتين (إعادة توجيه: AGTGCGACGTGGACATCCGTA، مراجعة: GCACTTCCTGTGGACGATGGA) 19. </li></ol></li></ol>

<ol>
	<li>Wilson, C. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wild+sex+in+zebrafish:+loss+of+the+natural+sex+determinant+in+domesticated+strains.">Wild sex in zebrafish: loss of the natural sex determinant in domesticated strains.</a> Genetics. 198 (3), 1291-1308 (2014).</li><li>Liew, W. C., Orban, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zebrafish+sex:+a+complicated+affair.">Zebrafish sex: a complicated affair.</a> Genomics. 13 (2), 172-187 (2014).</li><li>Orban, L., Sreenivasan, R., Olsson, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long+and+winding+roads:+Testis+differentiation+in+zebrafish.">Long and winding roads: Testis differentiation in zebrafish.</a> Mol. Cell. Endocrinol. 312 (1-2), 35-41 (2009).</li><li>Blaser, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transition+from+non-motile+behaviour+to+directed+migration+during+early+PGC+development+in+zebrafish.">Transition from non-motile behaviour to directed migration during early PGC development in zebrafish.</a> J. Cell Sci. 118, 4027-4038 (2005).</li><li>Wang, X. G., Orban, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Anti-M&#252;llerian+hormone+and+11+&#946;-hydroxylase+show+reciprocal+expression+to+that+of+aromatase+in+the+transforming+gonad+of+zebrafish+males.">Anti-M&#252;llerian hormone and 11 &#946;-hydroxylase show reciprocal expression to that of aromatase in the transforming gonad of zebrafish males.</a> Dev. Dynam. 236 (5), 1329-1338 (2007).</li><li>Siegfried, K. R., N&#252;sslein-Volhard, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Germ+line+control+of+female+sex+determination+in+zebrafish.">Germ line control of female sex determination in zebrafish.</a> Dev. Biol. 324 (2), 277-287 (2008).</li><li>Uchida, D., Yamashita, M., Kitano, T., Iguchi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oocyte+apoptosis+during+the+transition+from+ovary-like+tissue+to+testes+during+sex+differentiation+of+juvenile+zebrafish.">Oocyte apoptosis during the transition from ovary-like tissue to testes during sex differentiation of juvenile zebrafish.</a> J. Exp. Biol. 205 (Pt 6), 711-718 (2002).</li><li>Groh, K. J., Sch&#246;nenberger, R., Eggen, R. I. L., Segner, H., Suter, M. J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+protein+expression+in+zebrafish+during+gonad+differentiation+by+targeted+proteomics.">Analysis of protein expression in zebrafish during gonad differentiation by targeted proteomics.</a> Gen. Comp. Endocr. 193, 210-220 (2013).</li><li>Siegfried, K. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+search+of+determinants:+gene+expression+during+gonadal+sex+differentiation.">In search of determinants: gene expression during gonadal sex differentiation.</a> J. Fish Biol. 76 (8), 1879-1902 (2010).</li><li>Small, C. M., Carney, G. E., Mo, Q., Vannucci, M., Jones, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+microarray+analysis+of+sex-+and+gonad-biased+gene+expression+in+the+zebrafish:+evidence+for+masculinization+of+the+transcriptome.">A microarray analysis of sex- and gonad-biased gene expression in the zebrafish: evidence for masculinization of the transcriptome.</a> BMC Genomics. 10, 579 (2009).</li><li>Chiang, E. F., Yan, Y. L., Guiguen, Y., Postlethwait, J., Chung, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+Cyp19+(P450+aromatase)+genes+on+duplicated+zebrafish+chromosomes+are+expressed+in+ovary+or+brain.">Two Cyp19 (P450 aromatase) genes on duplicated zebrafish chromosomes are expressed in ovary or brain.</a> Mol. Biol. Evol. 18 (4), 542-550 (2001).</li><li>Kishida, M., Callard, G. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+cytochrome+P450+aromatase+isoforms+in+zebrafish+(Danio+rerio)+brain+and+ovary+are+differentially+programmed+and+estrogen+regulated+during+early+development.">Distinct cytochrome P450 aromatase isoforms in zebrafish (Danio rerio) brain and ovary are differentially programmed and estrogen regulated during early development.</a> Endocrinology. 142 (2), 740-750 (2001).</li><li>Rodr&#237;guez-Mar&#237;, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+and+expression+pattern+of+zebrafish+anti-M&#252;llerian+hormone+(amh)+relative+to+sox9a,+sox9b,+and+cyp19a1a,+during+gonad+development.">Characterization and expression pattern of zebrafish anti-M&#252;llerian hormone (amh) relative to sox9a, sox9b, and cyp19a1a, during gonad development.</a> Gene Expr.Patterns. 5 (5), 655-667 (2005).</li><li>Krovel, A. V., Olsen, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+a+vas::EGFP+transgene+in+primordial+germ+cells+of+the+zebrafish.">Expression of a vas::EGFP transgene in primordial germ cells of the zebrafish.</a> Mech Dev. 116 (1-2), 141-150 (2002).</li><li>Krovel, A. V., Olsen, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sexual+dimorphic+expression+pattern+of+a+splice+variant+of+zebrafish+vasa+during+gonadal+development.">Sexual dimorphic expression pattern of a splice variant of zebrafish vasa during gonadal development.</a> Dev. Biol. 271 (1), 190-197 (2004).</li><li>Tzung, K. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Early+depletion+of+primordial+germ+cells+in+zebrafish+promotes+testis+formation.">Early depletion of primordial germ cells in zebrafish promotes testis formation.</a> Stem Cell Reports. 4 (1), 61-73 (2015).</li><li>Hsiao, C., Tsai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transgenic+zebrafish+with+fluorescent+germ+cell:+a+useful+tool+to+visualize+germ+cell+proliferation+and+juvenile+hermaphroditism+in+vivo.">Transgenic zebrafish with fluorescent germ cell: a useful tool to visualize germ cell proliferation and juvenile hermaphroditism in vivo.</a> Dev. Biol. 262 (2), 313-323 (2003).</li><li>Jorgensen, A., Nielsen, J. E., Morthorst, J. E., Bjerregaard, P., Leffers, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laser+capture+microdissection+of+gonads+from+juvenile+zebrafish.">Laser capture microdissection of gonads from juvenile zebrafish.</a> Reprod Biol Endocrinol. 7, 97 (2009).</li><li>Chen, S., Zhang, H., Wang, F., Zhang, W., Peng, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=nr0b1+(DAX1)+mutation+in+zebrafish+causes+female-to-male+sex+reversal+through+abnormal+gonadal+proliferation+and+differentiation.">nr0b1 (DAX1) mutation in zebrafish causes female-to-male sex reversal through abnormal gonadal proliferation and differentiation.</a> Mol. Cell. Endocrinol. 433, 105-116 (2016).</li><li>Westerfield, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The Zebrafish Book: A Guide for The Laboratory Use of Zebrafish (Danio rerio). , (2000).</li><li>Liew, W. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polygenic+sex+determination+system+in+zebrafish.">Polygenic sex determination system in zebrafish.</a> PLoS One. 7 (4), e34397 (2012).</li><li>Parichy, D. M., Elizondo, M. R., Mills, M. G., Gordon, T. N., Engeszer, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Normal+table+of+postembryonic+zebrafish+development:+staging+by+externally+visible+anatomy+of+the+living+fish.">Normal table of postembryonic zebrafish development: staging by externally visible anatomy of the living fish.</a> Dev Dyn. 238 (12), 2975-3015 (2009).</li><li>Gupta, T., Mullins, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+of+Organs+from+the+Adult+Zebrafish.">Dissection of Organs from the Adult Zebrafish.</a> J. Vis Exp. (37), (2010).</li><li>Arnaout, R., Reischauer, S., Stainier, D. Y. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recovery+of+Adult+Zebrafish+Hearts+for+High-throughput+Applications.">Recovery of Adult Zebrafish Hearts for High-throughput Applications.</a> J. Vis Exp. (94), (2014).</li><li>Gerlach, G. F., Schrader, L. N., Wingert, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+of+the+Adult+Zebrafish+Kidney.">Dissection of the Adult Zebrafish Kidney.</a> J. Vis Exp. (54), (2011).</li><li>Yoon, C., Kawakami, K., Hopkins, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zebrafish+vasa+homologue+RNA+is+localized+to+the+cleavage+planes+of+2-+and+4-cell-stage+embryos+and+is+expressed+in+the+primordial+germ+cells.">Zebrafish vasa homologue RNA is localized to the cleavage planes of 2- and 4-cell-stage embryos and is expressed in the primordial germ cells.</a> Development. 124 (16), 3157-3165 (1997).</li><li>Braat, A. K., Speksnijder, J. E., Zivkovic, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Germ+line+development+in+fishes.">Germ line development in fishes.</a> Int. J. Dev. Biol. 43 (7), 745-760 (1999).</li><li>Huang, H. Y., Ketting, R. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+zebrafish+gonads+for+RNA+isolation.">Isolation of zebrafish gonads for RNA isolation.</a> Methods Mol Biol. 1093, 183-194 (2014).</li></ol>

الكتاب تعلن أنه ليس لديهم مصالح مالية المتنافسة.

أصبح الزرد نموذج قوي ويستخدم على نطاق واسع في مجال التنمية والبحوث المتعلقة بالمرض. وقد الطرق لعزل الأجهزة في الزرد الكبار مثل المخ والقلب والغدد التناسلية، والكلى، وموثقة جيدا 23 و 24 و 25. نظرا لصغر حجم وإعادة الدينا?...

يتم فقدان المحدد الإناث رئيسيا في كروموسوم الزرد البرية 4 أو تعديلها في الزرد المستأنسة (أي سلالات مختبر المشتركة) 1. بدلا من ذلك، لديهم نظام تحديد الجنس عديدة الجينات يرافقه العوامل البيئية مثل درجة الحرارة ونقص الأكسجين، وتوافر الغذاء والكثافة السكانية. ليست مفهومة تماما آليات تفصيلية للتنمية الجنس الزرد. أسئلة أساسية مثل عندما يحدث تحديد الجنس الزرد، ما إشارة تحديد الجنس الابتدائية (ق) هو / هي، والجينات التي تنظم الخطوة الأولى من التحول الغدد التناسلية لا يزال يتعين الإجابة 2 و 3. في عملية التنمية الجنس الزرد، وقد تم الاعتراف عدة مراحل مهمة. في مرحلة مبكرة من التنمية، بدءا من 4 HPF (آخر ساعة الإخصاب) البدائية الجرثومية خلايا (بغتش) الخضوع لمواصفات، والهجرة إلى التلال الأعضاء التناسلية وتكاثر. أرقام PGC والتفاعلات المتبادلة بين الخلايا الجرثومية والخلايا الجسدية مهمة لالغدد التناسلية التمايز 4. في 13 DPF (أيام آخر الإخصاب)، والغدد التناسلية هي في مرحلة غير متمايزة. بنسبة 17 DPF، الغدد التناسلية تتطور إلى المبايض ثنائية محتملة في كل من الإناث والذكور في المستقبل. الانتقال التي تعتمد على الخلايا من المبيض إلى الخصية يبدأ في 21-25 DPF وقد يستمر لعدة أسابيع. بنسبة 35 DPF، وقد تم تحديد جنس الغدد التناسلية وإنتاج الأمشاج مصنفة حسب الجنس جار في كلا المبيضين والخصيتين 5 و 6 و 7. حتى الآن، وقد اقترحت الجينات وآليات تحديد الجنس مرشح متنوعة. وقد عزل البروتينات وتحليل transcriptomic العديد من الجينات مع التعبير ديمبرافيك جنسيا، وقد استخدمت هذه الجينات لدراسة التمايز بين الجنسين في الزرد 8، </sup&gt; 9 و 10. على سبيل المثال، في الزرد اليرقات، ويتم التعبير عن الجين cyp19a1a تحديدا في المبيض ولكن ليس في الخصية 11 و 12. وبالإضافة إلى ذلك، يتم التعبير عن الجينات AMH ضعيفة في خلايا بصيلات المحببة المبيض، ولكن بقوة في الخصية خلايا سيرتولي 13. في المقابل، أعرب الجينات الأوعية مستمر في الخلايا الجرثومية كل من الزرد الإناث والذكور، مما يجعل من الغدد التناسلية علامة مناسبة 14 و 15. بحثت العلاقة بين مستويات التعبير الجيني الغدد التناسلية أمر بالغ الأهمية لفهم الآلية الجزيئية لتحديد الجنس والتمايز خصوصا في مرحلة المبيض ثنائية إمكانيات 3 و 9. ومع ذلك، فإن صغر حجم الزرد اليرقات والغدد التناسلية صغيرة في المقابل تعقيد عزل gonadaالأنسجة ل لمزيد من التحليل الجزيئي. الدراسات السابقة المستخدمة تشريح منطقة الجذع بأكملها بين الغطاء الخيشومي والمسام الشرج 16. هذا التحضير، على الرغم من أن تحتوي على الغدد التناسلية، ويتكون من الأنسجة والأعضاء متعددة. بدلا من ذلك، والحيوانات المعدلة وراثيا مع التعبير GFP-الغدد التناسلية معين مثل الأوعية: استخدمت EGFP لعزل الأنسجة الغدد التناسلية عن طريق مضان خلية تنشيط الفرز (FACS) والقبض على الليزر الجزئي تشريح 17 و 18. لكن تطبيقها على نطاق واسع محدودة. هنا، نحن تصف إجراء بسيط لعزل الأنسجة الغدد التناسلية من الزرد اليرقات في 17 DPF و 25 DPF. نحن لشرح موقف الغدد التناسلية فيما يتعلق الأجهزة الأخرى وعزل الغدد التناسلية سليمة شكليا من الأنسجة المحيطة بها. علينا مواصلة تظهر الجينات الغدد التناسلية معين مثل الأوعية وcyp19a1a يتم التعبير عنها بشكل كبير في الغدد التناسلية معزولة مقارنة مع الأنسجة جذع من خلال PCR الكمي (QPCR) التحليل. يسمح هذا البروتوكول تحديد الهوية، والعزلة، وتنقية RNA والتضخيم من جينات معينة الغدد التناسلية من الزرد اليرقات، وبالتالي تمكين التحليل الجزيئي لاحق من أنسجة الغدد التناسلية (19).

<table><tbody><tr><td>Cell culture dish 100 mm</td><td>Corning</td><td>430167</td><td>For embryo incubation</td></tr><tr><td>20x EM</td><td></td><td></td><td>For a 1 L needed: add 17.5 g NaCl, 0.75 g KCl and 2.9 g CaCl&amp;#183;2H&lt;sub&gt;2&lt;/sub&gt;O; then add 0.41 g KH&lt;sub&gt;2&lt;/sub&gt;PO4, 0.412 g Na&lt;sub&gt;2&lt;/sub&gt;HPO4 anhydrous and 4.9 g MgSO&lt;sub&gt;4&lt;/sub&gt;&amp;#183;7H&lt;sub&gt;2&lt;/sub&gt;O.</td></tr><tr><td>1x EM</td><td></td><td></td><td>Dilute 20x EM in distilled water</td></tr><tr><td>AGAROSE G-10</td><td>Gene</td><td>121985</td><td>For preparing the 2% agar plates</td></tr><tr><td>Trizol Reagent</td><td>Invitrogen</td><td>15596-026</td><td>For RNA isolation</td></tr><tr><td>Meter glass</td><td>Shen Bo</td><td>250 ml</td><td>For preparing the 2% agar plates</td></tr><tr><td>Microwave Oven</td><td>Midea</td><td>M1-211A</td><td>For heating the AGAR</td></tr><tr><td>Tweezer DUMONT#5INOX</td><td>World Precision Instrument</td><td>500341</td><td>For dissection</td></tr><tr><td>Stereomicroscope</td><td>Motic</td><td>SMZ168</td><td>For dissection</td></tr><tr><td>Pure water equipment</td><td>Millipore</td><td></td><td></td></tr><tr><td>Ringer&amp;rsquo;s solution</td><td></td><td></td><td>For a 1 L needed: Add 6.78 g NaCl, 0.22 g KCl, 0.26 g CaCl&lt;sub&gt;2&lt;/sub&gt; and 1.19 g Hepes; then fill to 1 L; Adjust pH to 7.2. Sterilize by filtration and keep in an autoclaved clear polycarbonate container.</td></tr><tr><td>Transfer pipette</td><td>Samco</td><td>202, 204</td><td></td></tr><tr><td>Metal bath</td><td>QiLinbeier</td><td></td><td>Model GL-150</td></tr><tr><td>Microscope</td><td>Leica&amp;nbsp;</td><td>M205 FA</td><td>For photomicrograph</td></tr><tr><td>Centrifuge</td><td>Eppendorf</td><td>5417R</td><td></td></tr><tr><td>Micro Scale RNA Isolation Kit</td><td>Ambion</td><td>AM1931</td><td>For RNA isolation from gonad tissues</td></tr><tr><td>Dnase I</td><td>Sigma</td><td>AMPD1-1KT</td><td>For DNA digestion in the RNA solution</td></tr><tr><td>RevertAid First Strand cDNA Synthesis Kit</td><td>Thermo Scientific</td><td>#K1631</td><td>For first-strand cDNA synthesis</td></tr><tr><td>Rnase H</td><td>Thermo Scientific</td><td>#EN0202</td><td>For digesting the residual RNA in the cDNA solution.</td></tr><tr><td>SYBR Green Realtime PCR Master Mix</td><td>TOYOBO</td><td>QPK-201</td><td>This product is a Taq DNA polymerase-based 2x master mix for real-time PCR and&amp;nbsp; applicable for intercalation assay with SYBR Green I.</td></tr><tr><td>Spectrophotometer</td><td>Ne Drop</td><td>OD-2000+</td><td>Measuring the concentration of the total RNA</td></tr><tr><td>Mastercycler</td><td>Eppendorf</td><td>AG 22331 Hamburg</td><td>gene expression profiling</td></tr></tbody></table>

dissection of larval zebrafish gonadal tissue

وعلى الرغم من الزرد البرية امتلاك / ZW نظام تحديد الجنس ZZ، فقد الزرد المستأنسة كروموسوم الجنس. وهي تستخدم نظام تحديد الجنس عديدة الجينات، حيث وزعت عدة جينات في جميع أنحاء الجينوم تحدد بشكل جماعي هويات جنس الأسماك الفردية. حاليا، فإن الجينات المسؤولة عن تنظيم تطوير الغدد التناسلية وكيفية عملها يبقى بعيد المنال. عادة، عزل الأنسجة الغدد التناسلية هي الخطوة الأولى لدراسة العمليات التنموية الجنس. هنا، نقدم إجراء لعزل الأنسجة الغدد التناسلية من 17 DPF (أيام آخر الإخصاب) و 25 يرقات DPF الزرد. الأنسجة الغدد التناسلية معزولة ويمكن الاطلاع في وقت لاحق من قبل التشكل والتعبير الجيني التنميط.

تم إجراء تشريح الغدد التناسلية على أب سترين الزرد اليرقات. ويبين الشكل 1 أنسجة الغدد التناسلية نموذجية من الزرد اليرقات في 17 DPF و 25 DPF. أولا، يتم قطع الجلد والعضلات من جانب واحد من البطن لكشف الأعضاء الداخلية. بعد إزالة كتلة من الأعضاء ...

Watch this Scientific Journal Video about Dissection of Larval Zebrafish Gonadal Tissue at JoVE.com

Dissection of Larval Zebrafish Gonadal Tissue

هنا، نقدم بروتوكول لعزل الأنسجة الغدد التناسلية من الزرد اليرقات، التي من شأنها تسهيل التحقيقات في التفرقة بين جنس الزرد والصيانة.

تشريح اليرقات الزرد الغدد التناسلية الأنسجة

Although wild zebrafish possess a ZZ/ZW sex-determination system, domesticated zebrafish have lost the sex chromosome. They utilize a polygenic sex ...

dissection-of-larval-zebrafish-gonadal-tissue

Research

JoVE Journal

Developmental Biology

10.2K Views.  Fudan University.  هنا، نقدم بروتوكول لعزل الأنسجة الغدد التناسلية من الزرد اليرقات، التي من شأنها تسهيل التحقيقات في التفرقة بين جنس الزرد والصيانة. 

Video: Dissection of Larval Zebrafish Gonadal Tissue

Dissection and Lateral Mounting of Zebrafish Embryos: Analysis of Spinal Cord Development

The zebrafish spinal cord is an effective investigative model for nervous system research for several reasons. First, genetic, transgenic and gene knockdown approaches can be utilized to examine the molecular mechanisms underlying nervous system development. Second, large clutches of developmentally synchronized embryos provide large experimental sample sizes. Third, the optical clarity of the zebrafish embryo permits researchers to visualize progenitor, glial, and neuronal populations. Although zebrafish embryos are transparent, specimen thickness can impede effective microscopic visualization. One reason for this is the tandem development of the spinal cord and overlying somite tissue. Another reason is the large yolk ball, which is still present during periods of early neurogenesis. In this article, we demonstrate microdissection and removal of the yolk in fixed embryos, which allows microscopic visualization while preserving surrounding somite tissue. We also demonstrate semipermanent mounting of zebrafish embryos. This permits observation of neurodevelopment in the dorso-ventral and anterior-posterior axes, as it preserves the three-dimensionality of the tissue.

Developmental processes such as proliferation, patterning, differentiation, and axon guidance can be readily modeled in the zebrafish spinal cord. In this article, we describe a mounting procedure for zebrafish embryos, which optimizes visualization of these events.

تشريح والتركيب الجانبي من اسماك الزرد الأجنة: تحليل التنمية الحبل الشوكي

The zebrafish spinal cord is an effective investigative model for nervous system research for several reasons. First, genetic, transgenic and gene ...

Neuroscience

Dissection of Organs from the Adult Zebrafish

Over the last 20 years, the zebrafish has become a powerful model organism for understanding vertebrate development and disease.  Although experimental analysis of the embryo and larva is extensive and the morphology has been well documented, descriptions of adult zebrafish anatomy and studies of development of the adult structures and organs, together with techniques for working with adults are lacking. The organs of the larva undergo significant changes in their overall structure, morphology, and anatomical location during the larval to adult transition.  Externally, the transparent larva develops its characteristic adult striped pigment pattern and paired pelvic fins, while internally, the organs undergo massive growth and remodeling.  In addition, the bipotential gonad primordium develops into either testis or ovary.  This protocol identifies many of the organs of the adult and demonstrates methods for dissection of the brain, gonads, gastrointestinal system, heart, and kidney of the adult zebrafish. The dissected organs can be used for in situ hybridization, immunohistochemistry, histology, RNA extraction, protein analysis, and other molecular techniques.  This protocol will assist in the broadening of studies in the zebrafish to include the remodeling of larval organs, the morphogenesis of organs specific to the adult and other investigations of the adult organ systems.

This protocol describes a procedure for identifying and dissecting organs from the adult zebrafish.

تشريح هيئات من اسماك الزرد الكبار

Over the last 20 years, the zebrafish has become a powerful model organism for understanding vertebrate development and disease.  Although experimental ...

Biology

Spinal Cord Transection in the Larval Zebrafish

Mammals fail in sensory and motor recovery following spinal cord injury due to lack of axonal regrowth below the level of injury as well as an inability to reinitiate spinal neurogenesis. However, some anamniotes including the zebrafish Danio rerio exhibit both sensory and functional recovery even after complete transection of the spinal cord. The adult zebrafish is an established model organism for studying regeneration following spinal cord injury, with sensory and motor recovery by 6&#160;weeks post-injury. To take advantage of in vivo analysis of the regenerative process available in the transparent larval zebrafish as well as genetic tools not accessible in the adult, we use the larval zebrafish to study regeneration after spinal cord transection. Here we demonstrate a method for reproducibly and verifiably transecting the larval spinal cord. After transection, our data shows sensory recovery beginning at 2&#160;days post-injury (dpi), with the C-bend movement detectable by 3 dpi and resumption of free swimming by 5 dpi. Thus we propose the larval zebrafish as a companion tool to the adult zebrafish for the study of recovery after spinal cord injury.

After spinal transection, adult zebrafish have functional recovery by six weeks post-injury. To take advantage of larval transparency and faster recovery, we present a method for transecting the larval spinal cord. After transection, we observe sensory recovery beginning at 2&#160;days post-injury, and C-bend movement by 3 days post-injury.

Transection الحبل الشوكي في اليرقات الزرد

Mammals fail in sensory and motor recovery following spinal cord injury due to lack of axonal regrowth below the level of injury as well as an inability ...

Dissection and Live-Imaging of the Late Embryonic Drosophila Gonad

The Drosophila melanogaster male embryonic gonad is an advantageous model to study various aspects of developmental biology including, but not limited to, germ cell development, piRNA biology, and niche formation. Here, we present a dissection technique to live-image the gonad ex vivo during a period when in vivo live-imaging is highly ineffective. This protocol outlines how to transfer embryos to an imaging dish, choose appropriately-staged male embryos, and dissect the gonad from its surrounding tissue while still maintaining its structural integrity. Following dissection, gonads can be imaged using a confocal microscope to visualize dynamic cellular processes. The dissection procedure requires precise timing and dexterity, but we provide insight on how to prevent common mistakes and how to overcome these challenges. To our knowledge this is the first dissection protocol for the Drosophila embryonic gonad, and will permit live-imaging during an otherwise inaccessible window of time. This technique can be combined with pharmacological or cell-type specific transgenic manipulations to study any dynamic processes occurring within or between the&#160;cells in their natural gonadal environment.

Dissection and Live-Imaging of the Late Embryonic Drosophila Gonad

Here, we provide a dissection protocol required to live-image the late embryonic Drosophila male gonad. This protocol will permit observation of dynamic cellular processes under normal conditions or after transgenic or pharmacological manipulation.

تشريح وتصوير حي للغدد التناسلية ذبابة الفاكهة الجنينية المتأخرة

The Drosophila melanogaster male embryonic gonad is an advantageous model to study various aspects of developmental biology including, but not limited to, ...

Microdissection of Zebrafish Embryonic Eye Tissues

Zebrafish is a popular animal model for research on eye development because of its rapid ex utero development and good fecundity. By 3 days post fertilization (dpf), the larvae will show the first visual response. Many genes have been identified to control a proper eye development, but we are far from a complete understanding of the underlying genetic architecture. Whole genome gene expression profiling is a useful tool to elucidate genetic regulatory network for eye development. However, the small size of the embryonic eye in zebrafish makes it challenging to obtain intact and pure eye tissues for expression analysis. For example, the anterior-posterior length of the eye between day 2 and 3 is only approximately 200-300 &mu;m, while the diameter of the lens is less 100 &mu;m. Also, the retinal pigment epithelium (RPE) underlying the retina is just a single-layer epithelium. While gene expression profiles can be obtained from the whole embryo, they do not accurately represent the expression of these tissues. Therefore pure tissue must be obtained for a successful gene expression profiling of eye development. To address this issue, we have developed an approach to microdissect intact retina and retina with RPE attached from 1-3 dpf, which cover major stages of eye morphogenesis. All procedures can be done with fine forceps and general laboratory supplies under standard stereomicroscopes. For retinal dissection, the single-layer RPE is removed and peeled off by brushing action and the preferential adherence of the RPE remnants to the surface of the culture plate for dissection. For RPE-attached retinal dissection, the adherence of RPE to the dissection plate is removed before the dissection so that the RPE can be completely preserved with the retina. A careful lifting action of this tissue can efficiently separate the presumptive choroid and sclera. The lens can be removed in both cases by a chemically etched tungsten needle. In short, our approach can obtain intact eye tissues and has been successfully utilized to study tissue-specific expression profiles of zebrafish retina1, 2 and retinal pigment epithelium3.

This article describes an approach to microdissect zebrafish retinas with and without retinal pigment epithelium attached, from one to three days postfertilization embryos.

Microdissection من الأنسجة الجنينية العين اسماك الزرد

Zebrafish is a popular animal model for research on eye development because of its rapid ex utero development and good fecundity. By 3 days post ...

Eye Removal in Living Zebrafish Larvae to Examine Innervation-dependent Growth and Development of the Visual System

Zebrafish exhibit remarkable life-long growth and regenerative abilities. For example, specialized stem cell niches established during embryogenesis support continuous growth of the entire visual system, both in the eye and the brain. Coordinated growth between the retinae and the optic tectum ensures accurate retinotopic mapping as new neurons are added in the eyes and brain. To address whether retinal axons provide crucial information for regulating tectal stem and progenitor cell behaviors such as survival, proliferation, and/or differentiation, it is necessary to be able to compare innervated and denervated tectal lobes within the same animal and across animals. 
Surgical removal of one eye from living larval zebrafish followed by observation of the optic tectum achieves this goal. The accompanying video demonstrates how to anesthetize larvae, electrolytically sharpen tungsten needles, and use them to remove one eye. It next shows how to dissect brains from fixed zebrafish larvae. Finally, the video provides an overview of the protocol for immunohistochemistry and a demonstration of how to mount stained embryos in low-melting-point agarose for microscopy.

The article explains how to surgically remove eyes from living zebrafish larvae as the first step toward investigating how retinal input influences optic tectum growth and development. In addition, the article provides information about larval anesthetization, fixation, and brain dissection, followed by immunohistochemistry and confocal imaging.

إزالة العين في يرقات الزرد الحية لفحص النمو والتطور المعتمد على التعصيب للنظام البصري

Zebrafish exhibit remarkable life-long growth and regenerative abilities. For example, specialized stem cell niches established during embryogenesis ...

معالجة خلايا الأمعاء من يرقات الزرد لتسلسل الحمض النووي الريبي أحادي الخلية

Gut Isolation from Zebrafish Larvae for Single-cell RNA Sequencing

The gastrointestinal (GI) tract performs a range of functions essential for life. Congenital defects affecting its development can lead to enteric neuromuscular disorders, highlighting the importance to understand the molecular mechanisms underlying GI development and dysfunction. In this study, we present a method for gut isolation from zebrafish larvae at 5 days post fertilization to obtain live,&#160;viable cells which can be used for single-cell RNA sequencing (scRNA-seq) analysis. This protocol is based on the manual dissection of the zebrafish intestine, followed by enzymatic dissociation with papain. Subsequently, cells are submitted to fluorescence-activated cell sorting, and viable cells are collected for scRNA-seq. With this method, we were able to successfully identify different intestinal cell types, including epithelial, stromal, blood, muscle, and immune cells, as well as enteric neurons and glia. Therefore, we consider it to be a valuable resource for studying the composition of the GI tract in health and disease, using the zebrafish.

تسليط الضوء على المؤلف: عزل وتحليل الخلايا المعوية ليرقات الزرد للتحقيق في الجوانب النسخية لتطور الجهاز الهضمي 

Here, we describe a method for gut isolation from zebrafish larvae at 5 days post fertilization, for single-cell RNA sequencing analysis.

عزل الأمعاء من يرقات الزرد لتسلسل الحمض النووي الريبي أحادي الخلية

The gastrointestinal (GI) tract performs a range of functions essential for life. Congenital defects affecting its development can lead to enteric ...

Heart Dissection in Larval, Juvenile and Adult Zebrafish, Danio rerio

Zebrafish have become a beneficial and practical model organism for the study of embryonic heart development (see recent reviews1-6), however, work examining post-embryonic through adult cardiac development has been limited7-10. Examining the changing morphology of the maturing and aging heart are restricted by the lack of techniques available for staging and isolating juvenile and adult hearts. In order to analyze heart development over the fish's lifespan, we dissect zebrafish hearts at numerous stages and photograph them for further analysis11. The morphological features of the heart can easily be quantified and individual hearts can be further analyzed by a host of standard methods. Zebrafish grow at variable rates and maturation correlates better with fish size than age, thus, post-fixation, we photograph and measure fish length as a gauge of fish maturation. This protocol explains two distinct, size dependent dissection techniques for zebrafish, ranging from larvae 3.5mm standard length (SL) with hearts of 100&mu;m ventricle length (VL), to adults, with SL of 30mm and VL 1mm or larger. Larval and adult fish have quite distinct body and organ morphology. Larvae are not only significantly smaller, they have less pigment and each organ is visually very difficult to identify. For this reason, we use distinct dissection techniques.
We used pre-dissection fixation procedures, as we discovered that hearts dissected directly after euthanization have a more variable morphology, with very loose and balloon like atria compared with hearts removed following fixation. The fish fixed prior to dissection, retain in vivo morphology and chamber position (data not shown). In addition, for demonstration purposes, we take advantage of the heart (myocardial) specific GFP transgenic Tg(myl7:GFP)twu34 (12), which allows us to visualize the entire heart and is particularly useful at early stages in development when the cardiac morphology is less distinct from surrounding tissues. Dissection of the heart makes further analysis of the cell and molecular biology underlying heart development and maturation using in situ hybridization, immunohistochemistry, RNA extraction or other analytical methods easier in post-embryonic zebrafish. This protocol will provide a valuable technique for the study of cardiac development maturation and aging.

Heart Dissection in Larval, Juvenile and Adult Zebrafish, Danio rerio

A clear, standardized method for dissection and isolation of the zebrafish heart at multiple developmental stages are described. Annotation and quantification techniques are also discussed.

تشريح القلب في اليرقات ، اسماك الزرد الأحداث والكبار ، دانيو rerio</em

Zebrafish have become a beneficial and practical model organism for the study of embryonic heart development (see recent reviews1-6), however, work ...

تشريح اليرقات الزرد الغدد التناسلية الأنسجة

Summary

Explore More Videos

Chapters in this video

تشريح والتركيب الجانبي من اسماك الزرد الأجنة: تحليل التنمية الحبل الشوكي

تشريح هيئات من اسماك الزرد الكبار

Transection الحبل الشوكي في اليرقات الزرد

تشريح وتصوير حي للغدد التناسلية ذبابة الفاكهة الجنينية المتأخرة

Microdissection من الأنسجة الجنينية العين اسماك الزرد

إزالة العين في يرقات الزرد الحية لفحص النمو والتطور المعتمد على التعصيب للنظام البصري

عزل الأمعاء من يرقات الزرد لتسلسل الحمض النووي الريبي أحادي الخلية

عزل الأمعاء من يرقات الزرد لتسلسل الحمض النووي الريبي أحادي الخلية

عزل الأمعاء من يرقات الزرد لتسلسل الحمض النووي الريبي أحادي الخلية

تشريح القلب في اليرقات ، اسماك الزرد الأحداث والكبار ، دانيو rerio