Name: dissection of larval zebrafish gonadal tissue
Uploaded: 2017-04-26T14:00:00.000+00:00
Duration: 10 min 43 s
Description: Watch this Scientific Journal Video about Dissection of Larval Zebrafish Gonadal Tissue at JoVE.com

Agradecemos a C Zhang para el cuidado de los peces. Este trabajo fue apoyado por la Fundación Nacional de Ciencias Naturales de China (31171074, 31371099 y 31571067 a GP) y por el Proyecto Talento Pujiang (09PJ1401900 a GP).

experimentos de pez cebra fueron aprobados por el Comité Institucional de Cuidado y Uso de Animales de la Universidad de Fudan. El pez cebra se plantearon y criado de acuerdo con procedimientos estándar de 20. 1. Preparativos <ol><li> Cultivar 17 dpf y 25 dpf larvas de pez cebra <ol><li> Transfer 2 hombres y 2 mujeres adultos de pez cebra (sana, de 3 a 6 meses de edad, de laboratorio AB strain) a un tanque de cruce en la tarde antes del día de travesía. Separar los machos y las hembras con una barrera. A la mañana siguiente, refrescar el agua del tanque y eliminar la barrera para que puedan aparearse. Recoger los huevos en 100 mm placas de Petri de 1 a 2 horas después de la fertilización. </li><li> Mantener aproximadamente 40 embriones en una placa de 100 mm con 40 ml de medio de embrión (EM) a 28,5 ° C durante el período de desarrollo de la primera (4 días) y actualizar la EM dos veces al día. Transferencia de las larvas a 1 tanques de L (40 larvas a 300 ml de agua del sistema) y alimentar con rotíferos vivos (suministro completo, dos veces al día) después de 5 dpf.Alimentar artemia viva en lugar de la dieta de rotíferos después de 10 dpf. Transferir el pescado en recirculante sistema de agua a 14 dpf 21. </li><li> Elevar larvas de pez cebra en el sistema de recirculación de agua hasta 17 dpf o 25 dpf. Asegúrese de que el ciclo de luz / oscuridad es 14/10 h y pH valor de agua del sistema es de aproximadamente 7,2. Medir la longitud corporal de 17 dpf (5.5 hasta 6.8 mm) y 25 dpf (8 a 11 mm) larvas 22. </li></ol></li><li> Preparar 2% placas de agar para la disección. <ol><li> Añadir 4 g de agar a 200 ml de agua estéril. Calentar la mezcla en un horno microondas hasta que se vuelve transparente. </li><li> Se enfría la solución de agar durante aproximadamente 15 min, luego se vierte en 60 mm de diámetro placas de Petri (aproximadamente 1/3 de volumen de la placa). Almacenar las placas de agar solidificado a 4 ° C. </li></ol></li></ol> 2. Protocolo 1: diseccionar el tejido gonadal de 17 y 25 dpf larvas <ol><li> Añadir hielo picado en el tanque para anestesiar a 17 larvas dpf. la transferencia de lalarvas anestesiado a un 100 mm refrigerados placa de Petri con una solución de 30 ml de Ringer frío. Mantener el pescado se incubaron en la solución de Ringer enfriada durante al menos 15 min para anestesiar completamente las larvas. </li><li> Transferir las larvas a una placa de agar previamente enfriada con una pequeña cuchara de plástico. Sumergir todo el cuerpo de los peces en 10 ml refrigerados solución de Ringer y suavemente ponerla en su lado. </li><li> Realizar las siguientes operaciones bajo el campo de visión del microscopio estereoscópico 25X. Sujetar el cuerpo del pez con pinzas para la estabilización. Rip el abdomen longitudinalmente desde el ano hasta el corazón con otro par de pinzas. eliminar suavemente la piel y los músculos de un lado del cuerpo para exponer los órganos internos. </li><li> Retire la masa de órganos ventrales a la vejiga natatoria con cuidado. Evitar daños en la gónada unido a la vejiga natatoria. </li><li> Cortar la conexión entre la vejiga natatoria y la parte anterior del cuerpo. Tire de toda la vejiga natatoria y el tejido gonadal suavemente. NOTA: En la mayoría de casoss, el tejido gonadal en 17 dpf contiene tejido circundante epitelial y protonephridium. Ellos no se separan fácilmente unos de otros, pero a 25 dpf que se pueden separar fácilmente. La gónada también está conectado con el ano. Una unión con las gónadas izquierda y derecha conectadas entre sí en el ano será claramente visible. </li><li> Use pinzas para separar cuidadosamente el tejido gonadal de la vejiga natatoria y limpiar los tejidos adiposos de los alrededores. </li><li> Transferir inmediatamente el tejido gonadal aislado a un tubo de centrífuga preenfriado 1,5 ml que contenía la solución de 200 l Ringer. Mantenga el tubo en hielo hasta que todos los tejidos gonadales se separan de las larvas. </li><li> Diseccionar las gónadas de 25 dpf larvas como se describe en los pasos 2.1 - 2.7. </li></ol> 3. Protocolo 2: analizar la expresión génica de los tejidos gonadales aislados <ol><li> Extraer el ARN total de los tejidos gonadales larvales. <ol><li> La transferencia de los tejidos gonadales aislados a un nuevo libre de RNasa 1.5 ml tubo y remover la solución de Ringer. Añadir 100 l solución de lisis. Vortex hasta que los tejidos están completamente lisadas. </li><li> Realice el procedimiento de extracción de RNA total de acuerdo con las instrucciones del fabricante. </li><li> Añadir 1/10 volumen de 10x DNasa I buffer y 1 l de DNasa I a la solución de ARN y mezclar suavemente. Incubar durante 20 min a 37 ° C. </li><li> Añadir reactivo DNasa inactivación 1/10 de volumen a la solución de ARN. Incubar durante 10 min a 70 ° C. Medir la concentración del ARN total usando un espectrofotómetro. Almacenar a -20 ° C. </li></ol></li><li> Realizar la síntesis de ADNc de primera cadena <ol><li> Utilice un oligo (dT) primer enlazador para llevar a cabo la síntesis de primera cadena de ADNc siguiendo el protocolo del fabricante. Añadir 1 a 2 g de ARN hasta un volumen total de reacción de 20! L. </li><li> Incubar la solución de reacción durante 90 min a 45 ° C. Terminar la reacción por calentamiento a 70 ° C durante 5 min. </li><li> Añadir 1 l de RNasa H a la cDNA tanlución para eliminar el ARN residual. Mezclar suavemente y centrifugar durante 10 s a ~ 13.000 x g. Incubar durante 20 min a 37 ° C. Añadir 20 l de agua libre de nucleasa. Almacenar a -70 ° C. </li></ol></li><li> Realizar PCR cuantitativa fluorescente <ol><li> Realizar qPCR en un sistema ciclador con un colorante fluorescente. Use las siguientes condiciones de ciclado de PCR: 35 ciclos a 95 ° C durante 15 s, Tm-5 ° C durante 15 s, 68 ° C durante 30 s. Utilice secuencias de los cebadores de la siguiente manera: AMH (fwd: GTGGATGGCAGCAGTACGAC; rev: GCGGAGAGGTGGAAGAGAGAATG), cyp19a1a (fwd: GTCCTGTTGTCTCCTACTGTCG; rev: CATTTGAGTTGAATATGATGCCCTG), nanos3 (fwd: GCTCGGTGTACGCCAAATCAACAT; rev: CCAAGTGAAAACACAACACCAGTGC), vasa (fwd: ATCGCATAGGAAGAACTGGACGCT; rev: CCAAGTGAAAACACAACACCAGTGC) y β-actina (fwd: AGTGCGACGTGGACATCCGTA; rev: GCACTTCCTGTGGACGATGGA) 19. </li></ol></li></ol>

<ol>
	<li>Wilson, C. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wild+sex+in+zebrafish:+loss+of+the+natural+sex+determinant+in+domesticated+strains.">Wild sex in zebrafish: loss of the natural sex determinant in domesticated strains.</a> Genetics. 198 (3), 1291-1308 (2014).</li><li>Liew, W. C., Orban, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zebrafish+sex:+a+complicated+affair.">Zebrafish sex: a complicated affair.</a> Genomics. 13 (2), 172-187 (2014).</li><li>Orban, L., Sreenivasan, R., Olsson, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long+and+winding+roads:+Testis+differentiation+in+zebrafish.">Long and winding roads: Testis differentiation in zebrafish.</a> Mol. Cell. Endocrinol. 312 (1-2), 35-41 (2009).</li><li>Blaser, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transition+from+non-motile+behaviour+to+directed+migration+during+early+PGC+development+in+zebrafish.">Transition from non-motile behaviour to directed migration during early PGC development in zebrafish.</a> J. Cell Sci. 118, 4027-4038 (2005).</li><li>Wang, X. G., Orban, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Anti-M&#252;llerian+hormone+and+11+&#946;-hydroxylase+show+reciprocal+expression+to+that+of+aromatase+in+the+transforming+gonad+of+zebrafish+males.">Anti-M&#252;llerian hormone and 11 &#946;-hydroxylase show reciprocal expression to that of aromatase in the transforming gonad of zebrafish males.</a> Dev. Dynam. 236 (5), 1329-1338 (2007).</li><li>Siegfried, K. R., N&#252;sslein-Volhard, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Germ+line+control+of+female+sex+determination+in+zebrafish.">Germ line control of female sex determination in zebrafish.</a> Dev. Biol. 324 (2), 277-287 (2008).</li><li>Uchida, D., Yamashita, M., Kitano, T., Iguchi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oocyte+apoptosis+during+the+transition+from+ovary-like+tissue+to+testes+during+sex+differentiation+of+juvenile+zebrafish.">Oocyte apoptosis during the transition from ovary-like tissue to testes during sex differentiation of juvenile zebrafish.</a> J. Exp. Biol. 205 (Pt 6), 711-718 (2002).</li><li>Groh, K. J., Sch&#246;nenberger, R., Eggen, R. I. L., Segner, H., Suter, M. J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+protein+expression+in+zebrafish+during+gonad+differentiation+by+targeted+proteomics.">Analysis of protein expression in zebrafish during gonad differentiation by targeted proteomics.</a> Gen. Comp. Endocr. 193, 210-220 (2013).</li><li>Siegfried, K. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+search+of+determinants:+gene+expression+during+gonadal+sex+differentiation.">In search of determinants: gene expression during gonadal sex differentiation.</a> J. Fish Biol. 76 (8), 1879-1902 (2010).</li><li>Small, C. M., Carney, G. E., Mo, Q., Vannucci, M., Jones, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+microarray+analysis+of+sex-+and+gonad-biased+gene+expression+in+the+zebrafish:+evidence+for+masculinization+of+the+transcriptome.">A microarray analysis of sex- and gonad-biased gene expression in the zebrafish: evidence for masculinization of the transcriptome.</a> BMC Genomics. 10, 579 (2009).</li><li>Chiang, E. F., Yan, Y. L., Guiguen, Y., Postlethwait, J., Chung, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+Cyp19+(P450+aromatase)+genes+on+duplicated+zebrafish+chromosomes+are+expressed+in+ovary+or+brain.">Two Cyp19 (P450 aromatase) genes on duplicated zebrafish chromosomes are expressed in ovary or brain.</a> Mol. Biol. Evol. 18 (4), 542-550 (2001).</li><li>Kishida, M., Callard, G. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+cytochrome+P450+aromatase+isoforms+in+zebrafish+(Danio+rerio)+brain+and+ovary+are+differentially+programmed+and+estrogen+regulated+during+early+development.">Distinct cytochrome P450 aromatase isoforms in zebrafish (Danio rerio) brain and ovary are differentially programmed and estrogen regulated during early development.</a> Endocrinology. 142 (2), 740-750 (2001).</li><li>Rodr&#237;guez-Mar&#237;, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+and+expression+pattern+of+zebrafish+anti-M&#252;llerian+hormone+(amh)+relative+to+sox9a,+sox9b,+and+cyp19a1a,+during+gonad+development.">Characterization and expression pattern of zebrafish anti-M&#252;llerian hormone (amh) relative to sox9a, sox9b, and cyp19a1a, during gonad development.</a> Gene Expr.Patterns. 5 (5), 655-667 (2005).</li><li>Krovel, A. V., Olsen, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+a+vas::EGFP+transgene+in+primordial+germ+cells+of+the+zebrafish.">Expression of a vas::EGFP transgene in primordial germ cells of the zebrafish.</a> Mech Dev. 116 (1-2), 141-150 (2002).</li><li>Krovel, A. V., Olsen, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sexual+dimorphic+expression+pattern+of+a+splice+variant+of+zebrafish+vasa+during+gonadal+development.">Sexual dimorphic expression pattern of a splice variant of zebrafish vasa during gonadal development.</a> Dev. Biol. 271 (1), 190-197 (2004).</li><li>Tzung, K. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Early+depletion+of+primordial+germ+cells+in+zebrafish+promotes+testis+formation.">Early depletion of primordial germ cells in zebrafish promotes testis formation.</a> Stem Cell Reports. 4 (1), 61-73 (2015).</li><li>Hsiao, C., Tsai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transgenic+zebrafish+with+fluorescent+germ+cell:+a+useful+tool+to+visualize+germ+cell+proliferation+and+juvenile+hermaphroditism+in+vivo.">Transgenic zebrafish with fluorescent germ cell: a useful tool to visualize germ cell proliferation and juvenile hermaphroditism in vivo.</a> Dev. Biol. 262 (2), 313-323 (2003).</li><li>Jorgensen, A., Nielsen, J. E., Morthorst, J. E., Bjerregaard, P., Leffers, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laser+capture+microdissection+of+gonads+from+juvenile+zebrafish.">Laser capture microdissection of gonads from juvenile zebrafish.</a> Reprod Biol Endocrinol. 7, 97 (2009).</li><li>Chen, S., Zhang, H., Wang, F., Zhang, W., Peng, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=nr0b1+(DAX1)+mutation+in+zebrafish+causes+female-to-male+sex+reversal+through+abnormal+gonadal+proliferation+and+differentiation.">nr0b1 (DAX1) mutation in zebrafish causes female-to-male sex reversal through abnormal gonadal proliferation and differentiation.</a> Mol. Cell. Endocrinol. 433, 105-116 (2016).</li><li>Westerfield, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The Zebrafish Book: A Guide for The Laboratory Use of Zebrafish (Danio rerio). , (2000).</li><li>Liew, W. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polygenic+sex+determination+system+in+zebrafish.">Polygenic sex determination system in zebrafish.</a> PLoS One. 7 (4), e34397 (2012).</li><li>Parichy, D. M., Elizondo, M. R., Mills, M. G., Gordon, T. N., Engeszer, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Normal+table+of+postembryonic+zebrafish+development:+staging+by+externally+visible+anatomy+of+the+living+fish.">Normal table of postembryonic zebrafish development: staging by externally visible anatomy of the living fish.</a> Dev Dyn. 238 (12), 2975-3015 (2009).</li><li>Gupta, T., Mullins, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+of+Organs+from+the+Adult+Zebrafish.">Dissection of Organs from the Adult Zebrafish.</a> J. Vis Exp. (37), (2010).</li><li>Arnaout, R., Reischauer, S., Stainier, D. Y. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recovery+of+Adult+Zebrafish+Hearts+for+High-throughput+Applications.">Recovery of Adult Zebrafish Hearts for High-throughput Applications.</a> J. Vis Exp. (94), (2014).</li><li>Gerlach, G. F., Schrader, L. N., Wingert, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+of+the+Adult+Zebrafish+Kidney.">Dissection of the Adult Zebrafish Kidney.</a> J. Vis Exp. (54), (2011).</li><li>Yoon, C., Kawakami, K., Hopkins, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zebrafish+vasa+homologue+RNA+is+localized+to+the+cleavage+planes+of+2-+and+4-cell-stage+embryos+and+is+expressed+in+the+primordial+germ+cells.">Zebrafish vasa homologue RNA is localized to the cleavage planes of 2- and 4-cell-stage embryos and is expressed in the primordial germ cells.</a> Development. 124 (16), 3157-3165 (1997).</li><li>Braat, A. K., Speksnijder, J. E., Zivkovic, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Germ+line+development+in+fishes.">Germ line development in fishes.</a> Int. J. Dev. Biol. 43 (7), 745-760 (1999).</li><li>Huang, H. Y., Ketting, R. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+zebrafish+gonads+for+RNA+isolation.">Isolation of zebrafish gonads for RNA isolation.</a> Methods Mol Biol. 1093, 183-194 (2014).</li></ol>

Los autores declaran que no tienen intereses financieros en competencia.

El pez cebra se ha convertido en un modelo de gran alcance y se utiliza ampliamente en el desarrollo y la investigación relacionada con la enfermedad. Los métodos para el aislamiento de los órganos en el pez cebra adultos, tales como cerebro, corazón, gónadas, y el riñón, se han documentado bien 23, 24, 25. Debido al pequeño tamaño y remodelación dinámica de los tejidos gonadales en el larvas de pez cebra, el aislami...

El principal determinante del sexo femenino en salvaje cromosoma pez cebra 4 se pierde o se modifica en el pez cebra domesticado (es decir, las cepas de laboratorio comunes) 1. En cambio, tienen un sistema de determinación del sexo poligénica acompañado por factores ambientales como la temperatura, la hipoxia, la disponibilidad de alimentos y la densidad de población. Los mecanismos detallados del desarrollo sexual del pez cebra no se entienden completamente. Las preguntas fundamentales tales como cuando se produce la determinación del sexo de pez cebra, lo que es la señal de la determinación del sexo primario (s) / son, y que los genes regulan la primera etapa de transformación gónada siguen sin respuesta 2, 3. En el proceso del desarrollo sexual de pez cebra, varias etapas importantes han sido reconocidos. En la etapa temprana de desarrollo, a partir de 4 hpf (horas después de la fecundación) germinales células primordiales (PGCs) someterse especificación, la migración a cresta genital yproliferación. Números PGC y las interacciones recíprocas entre las células germinales y las células somáticas son importantes para la diferenciación de las gónadas 4. A los 13 dpf (días después de la fertilización), las gónadas están en la etapa indiferenciada. Por 17 dpf, las gónadas se desarrollan en los ovarios bi-potenciales en las hembras y los machos futuras. La transición apoptosis dependiente de ovario al testículo comienzan a las 21 a 25 dpf y puede continuar durante varias semanas. Por 35 dpf, el sexo de la gónada se ha determinado y la producción de gametos específico del sexo está en marcha en ambos ovarios y testículos 5, 6, 7. Hasta la fecha, se han propuesto diversos genes y mecanismos de determinación del sexo candidatos. Proteómica y análisis transcriptomic han aislado muchos genes con expresión dimorfismo sexual y estos genes se han utilizado para estudiar la diferenciación sexual en el pez cebra 8, </sup&gt; 9, 10. Por ejemplo, en larvas de pez cebra, el gen cyp19a1a se expresa específicamente en el ovario pero no en el testículo 11, 12. Además, el gen AMH se expresa débilmente en las células del folículo de la granulosa de ovarios, pero fuertemente en los testículos células de Sertoli 13. En contraste, el gen vasa se expresa continuamente en las células germinales de ambos pez cebra hembra y macho, por lo que es un marcador gónada adecuado 14, 15. Investigando gonadales niveles de expresión génica es fundamental para comprender el mecanismo molecular de la determinación del sexo y diferenciación especialmente en la etapa de ovario bi-potencial 3, 9. Sin embargo, el pequeño tamaño de larvas de pez cebra y correspondientemente pequeñas gónadas complicar el aislamiento de gónadal de tejido para análisis molecular más. Estudios previos utilizados diseccionaron región del tronco entero entre los opérculos y poro anal 16. Esta preparación, aunque gónadas contienen, consiste en múltiples tejidos y órganos. Alternativamente, los animales transgénicos con la expresión de GFP-gónada específica tales como vasa: EGFP se utilizaron para el aislamiento de tejido gonadal a través de células activadas por fluorescencia (FACS) y captura por láser micro-disección 17, 18. Sin embargo, su aplicación generalizada es limitado. A continuación, describimos un procedimiento simple para aislar el tejido gonadal de larvas de pez cebra a las 17 dpf y 25 dpf. Se demuestra la posición de las gónadas con respecto a otros órganos y aislar las gónadas morfológicamente intactas de los tejidos circundantes. Además, muestran los genes-gónadas específicos tales como vasa y cyp19a1a son altamente expresado en las gónadas aisladas en comparación con el tejido del tronco a través de PCR cuantitativa (qPCR) análisis. El presente protocolo permite la identificación, aislamiento, purificación de ARN y amplificación de genes específicos gonadales de larvas de pez cebra, permitiendo de este modo posterior análisis molecular de tejido gonadal 19.

<table><tbody><tr><td>Cell culture dish 100 mm</td><td>Corning</td><td>430167</td><td>For embryo incubation</td></tr><tr><td>20x EM</td><td></td><td></td><td>For a 1 L needed: add 17.5 g NaCl, 0.75 g KCl and 2.9 g CaCl&amp;#183;2H&lt;sub&gt;2&lt;/sub&gt;O; then add 0.41 g KH&lt;sub&gt;2&lt;/sub&gt;PO4, 0.412 g Na&lt;sub&gt;2&lt;/sub&gt;HPO4 anhydrous and 4.9 g MgSO&lt;sub&gt;4&lt;/sub&gt;&amp;#183;7H&lt;sub&gt;2&lt;/sub&gt;O.</td></tr><tr><td>1x EM</td><td></td><td></td><td>Dilute 20x EM in distilled water</td></tr><tr><td>AGAROSE G-10</td><td>Gene</td><td>121985</td><td>For preparing the 2% agar plates</td></tr><tr><td>Trizol Reagent</td><td>Invitrogen</td><td>15596-026</td><td>For RNA isolation</td></tr><tr><td>Meter glass</td><td>Shen Bo</td><td>250 ml</td><td>For preparing the 2% agar plates</td></tr><tr><td>Microwave Oven</td><td>Midea</td><td>M1-211A</td><td>For heating the AGAR</td></tr><tr><td>Tweezer DUMONT#5INOX</td><td>World Precision Instrument</td><td>500341</td><td>For dissection</td></tr><tr><td>Stereomicroscope</td><td>Motic</td><td>SMZ168</td><td>For dissection</td></tr><tr><td>Pure water equipment</td><td>Millipore</td><td></td><td></td></tr><tr><td>Ringer&amp;rsquo;s solution</td><td></td><td></td><td>For a 1 L needed: Add 6.78 g NaCl, 0.22 g KCl, 0.26 g CaCl&lt;sub&gt;2&lt;/sub&gt; and 1.19 g Hepes; then fill to 1 L; Adjust pH to 7.2. Sterilize by filtration and keep in an autoclaved clear polycarbonate container.</td></tr><tr><td>Transfer pipette</td><td>Samco</td><td>202, 204</td><td></td></tr><tr><td>Metal bath</td><td>QiLinbeier</td><td></td><td>Model GL-150</td></tr><tr><td>Microscope</td><td>Leica&amp;nbsp;</td><td>M205 FA</td><td>For photomicrograph</td></tr><tr><td>Centrifuge</td><td>Eppendorf</td><td>5417R</td><td></td></tr><tr><td>Micro Scale RNA Isolation Kit</td><td>Ambion</td><td>AM1931</td><td>For RNA isolation from gonad tissues</td></tr><tr><td>Dnase I</td><td>Sigma</td><td>AMPD1-1KT</td><td>For DNA digestion in the RNA solution</td></tr><tr><td>RevertAid First Strand cDNA Synthesis Kit</td><td>Thermo Scientific</td><td>#K1631</td><td>For first-strand cDNA synthesis</td></tr><tr><td>Rnase H</td><td>Thermo Scientific</td><td>#EN0202</td><td>For digesting the residual RNA in the cDNA solution.</td></tr><tr><td>SYBR Green Realtime PCR Master Mix</td><td>TOYOBO</td><td>QPK-201</td><td>This product is a Taq DNA polymerase-based 2x master mix for real-time PCR and&amp;nbsp; applicable for intercalation assay with SYBR Green I.</td></tr><tr><td>Spectrophotometer</td><td>Ne Drop</td><td>OD-2000+</td><td>Measuring the concentration of the total RNA</td></tr><tr><td>Mastercycler</td><td>Eppendorf</td><td>AG 22331 Hamburg</td><td>gene expression profiling</td></tr></tbody></table>

dissection of larval zebrafish gonadal tissue

Aunque el pez cebra salvaje poseen un sistema de determinación del sexo / ZW ZZ, pez cebra domesticado han perdido el cromosoma sexual. Ellos utilizan un sistema de determinación del sexo poligénica, donde varios genes distribuidos en todo el genoma determinar colectivamente las identidades sexuales de peces individuales. Actualmente, los genes implicados en la regulación del desarrollo de las gónadas y cómo funcionan siendo difícil de alcanzar. Normalmente, el aislamiento de tejido gonadal es el primer paso para examinar los procesos de desarrollo de sexo. A continuación, presentamos un procedimiento para aislar el tejido gonadal de 17 dpf (días después de la fertilización) y 25 dpf larvas de pez cebra. El tejido gonadal aislado puede ser examinada posteriormente por la morfología y la expresión de genes de perfiles.

Las disecciones de las gónadas se realizaron en AB strain larvas de pez cebra. La figura 1 muestra de tejido gonadal típico de larvas de pez cebra a las 17 dpf y 25 dpf. En primer lugar, la piel y los músculos de un lado del abdomen se corta para exponer los órganos internos. Después de retirar la masa de los órganos internos, la vejiga natatoria, junto con la gónada permanecen en el maletero. La gónada estaba unido a la parte ventral de vejiga natat...

Watch this Scientific Journal Video about Dissection of Larval Zebrafish Gonadal Tissue at JoVE.com

Dissection of Larval Zebrafish Gonadal Tissue

Aquí, se presenta un protocolo para el aislamiento de tejido gonadal de larvas de pez cebra, que facilitará las investigaciones de la diferenciación sexual de pez cebra y el mantenimiento.

La disección de las larvas de pez cebra de tejidos gonadales

Although wild zebrafish possess a ZZ/ZW sex-determination system, domesticated zebrafish have lost the sex chromosome. They utilize a polygenic sex ...

dissection-of-larval-zebrafish-gonadal-tissue

Universidad de Cartagena UDEC

Research

JoVE Journal

Developmental Biology

10.2K vistas.  Fudan University.  Aquí, se presenta un protocolo para el aislamiento de tejido gonadal de larvas de pez cebra, que facilitará las investigaciones de la diferenciación sexual de pez cebra y el mantenimiento. 

Video: Dissection of Larval Zebrafish Gonadal Tissue

Dissection and Lateral Mounting of Zebrafish Embryos: Analysis of Spinal Cord Development

The zebrafish spinal cord is an effective investigative model for nervous system research for several reasons. First, genetic, transgenic and gene knockdown approaches can be utilized to examine the molecular mechanisms underlying nervous system development. Second, large clutches of developmentally synchronized embryos provide large experimental sample sizes. Third, the optical clarity of the zebrafish embryo permits researchers to visualize progenitor, glial, and neuronal populations. Although zebrafish embryos are transparent, specimen thickness can impede effective microscopic visualization. One reason for this is the tandem development of the spinal cord and overlying somite tissue. Another reason is the large yolk ball, which is still present during periods of early neurogenesis. In this article, we demonstrate microdissection and removal of the yolk in fixed embryos, which allows microscopic visualization while preserving surrounding somite tissue. We also demonstrate semipermanent mounting of zebrafish embryos. This permits observation of neurodevelopment in the dorso-ventral and anterior-posterior axes, as it preserves the three-dimensionality of the tissue.

Developmental processes such as proliferation, patterning, differentiation, and axon guidance can be readily modeled in the zebrafish spinal cord. In this article, we describe a mounting procedure for zebrafish embryos, which optimizes visualization of these events.

La disección y de montaje lateral de embriones de pez cebra: Análisis para el Desarrollo de la médula espinal

The zebrafish spinal cord is an effective investigative model for nervous system research for several reasons. First, genetic, transgenic and gene ...

Investigación

Neurociencias

Dissection of Organs from the Adult Zebrafish

Over the last 20 years, the zebrafish has become a powerful model organism for understanding vertebrate development and disease.  Although experimental analysis of the embryo and larva is extensive and the morphology has been well documented, descriptions of adult zebrafish anatomy and studies of development of the adult structures and organs, together with techniques for working with adults are lacking. The organs of the larva undergo significant changes in their overall structure, morphology, and anatomical location during the larval to adult transition.  Externally, the transparent larva develops its characteristic adult striped pigment pattern and paired pelvic fins, while internally, the organs undergo massive growth and remodeling.  In addition, the bipotential gonad primordium develops into either testis or ovary.  This protocol identifies many of the organs of the adult and demonstrates methods for dissection of the brain, gonads, gastrointestinal system, heart, and kidney of the adult zebrafish. The dissected organs can be used for in situ hybridization, immunohistochemistry, histology, RNA extraction, protein analysis, and other molecular techniques.  This protocol will assist in the broadening of studies in the zebrafish to include the remodeling of larval organs, the morphogenesis of organs specific to the adult and other investigations of the adult organ systems.

This protocol describes a procedure for identifying and dissecting organs from the adult zebrafish.

La disección de los órganos del pez cebra adultos

Over the last 20 years, the zebrafish has become a powerful model organism for understanding vertebrate development and disease.  Although experimental ...

Biología

Spinal Cord Transection in the Larval Zebrafish

Mammals fail in sensory and motor recovery following spinal cord injury due to lack of axonal regrowth below the level of injury as well as an inability to reinitiate spinal neurogenesis. However, some anamniotes including the zebrafish Danio rerio exhibit both sensory and functional recovery even after complete transection of the spinal cord. The adult zebrafish is an established model organism for studying regeneration following spinal cord injury, with sensory and motor recovery by 6&#160;weeks post-injury. To take advantage of in vivo analysis of the regenerative process available in the transparent larval zebrafish as well as genetic tools not accessible in the adult, we use the larval zebrafish to study regeneration after spinal cord transection. Here we demonstrate a method for reproducibly and verifiably transecting the larval spinal cord. After transection, our data shows sensory recovery beginning at 2&#160;days post-injury (dpi), with the C-bend movement detectable by 3 dpi and resumption of free swimming by 5 dpi. Thus we propose the larval zebrafish as a companion tool to the adult zebrafish for the study of recovery after spinal cord injury.

After spinal transection, adult zebrafish have functional recovery by six weeks post-injury. To take advantage of larval transparency and faster recovery, we present a method for transecting the larval spinal cord. After transection, we observe sensory recovery beginning at 2&#160;days post-injury, and C-bend movement by 3 days post-injury.

La transección de la médula espinal en el pez cebra larval

Mammals fail in sensory and motor recovery following spinal cord injury due to lack of axonal regrowth below the level of injury as well as an inability ...

Dissection and Live-Imaging of the Late Embryonic Drosophila Gonad

The Drosophila melanogaster male embryonic gonad is an advantageous model to study various aspects of developmental biology including, but not limited to, germ cell development, piRNA biology, and niche formation. Here, we present a dissection technique to live-image the gonad ex vivo during a period when in vivo live-imaging is highly ineffective. This protocol outlines how to transfer embryos to an imaging dish, choose appropriately-staged male embryos, and dissect the gonad from its surrounding tissue while still maintaining its structural integrity. Following dissection, gonads can be imaged using a confocal microscope to visualize dynamic cellular processes. The dissection procedure requires precise timing and dexterity, but we provide insight on how to prevent common mistakes and how to overcome these challenges. To our knowledge this is the first dissection protocol for the Drosophila embryonic gonad, and will permit live-imaging during an otherwise inaccessible window of time. This technique can be combined with pharmacological or cell-type specific transgenic manipulations to study any dynamic processes occurring within or between the&#160;cells in their natural gonadal environment.

Dissection and Live-Imaging of the Late Embryonic Drosophila Gonad

Here, we provide a dissection protocol required to live-image the late embryonic Drosophila male gonad. This protocol will permit observation of dynamic cellular processes under normal conditions or after transgenic or pharmacological manipulation.

Disección e imágenes en vivo de la Drosophila gonad embrionaria tardía

The Drosophila melanogaster male embryonic gonad is an advantageous model to study various aspects of developmental biology including, but not limited to, ...

Biología del Desarrollo

Microdissection of Zebrafish Embryonic Eye Tissues

Zebrafish is a popular animal model for research on eye development because of its rapid ex utero development and good fecundity. By 3 days post fertilization (dpf), the larvae will show the first visual response. Many genes have been identified to control a proper eye development, but we are far from a complete understanding of the underlying genetic architecture. Whole genome gene expression profiling is a useful tool to elucidate genetic regulatory network for eye development. However, the small size of the embryonic eye in zebrafish makes it challenging to obtain intact and pure eye tissues for expression analysis. For example, the anterior-posterior length of the eye between day 2 and 3 is only approximately 200-300 &mu;m, while the diameter of the lens is less 100 &mu;m. Also, the retinal pigment epithelium (RPE) underlying the retina is just a single-layer epithelium. While gene expression profiles can be obtained from the whole embryo, they do not accurately represent the expression of these tissues. Therefore pure tissue must be obtained for a successful gene expression profiling of eye development. To address this issue, we have developed an approach to microdissect intact retina and retina with RPE attached from 1-3 dpf, which cover major stages of eye morphogenesis. All procedures can be done with fine forceps and general laboratory supplies under standard stereomicroscopes. For retinal dissection, the single-layer RPE is removed and peeled off by brushing action and the preferential adherence of the RPE remnants to the surface of the culture plate for dissection. For RPE-attached retinal dissection, the adherence of RPE to the dissection plate is removed before the dissection so that the RPE can be completely preserved with the retina. A careful lifting action of this tissue can efficiently separate the presumptive choroid and sclera. The lens can be removed in both cases by a chemically etched tungsten needle. In short, our approach can obtain intact eye tissues and has been successfully utilized to study tissue-specific expression profiles of zebrafish retina1, 2 and retinal pigment epithelium3.

This article describes an approach to microdissect zebrafish retinas with and without retinal pigment epithelium attached, from one to three days postfertilization embryos.

Microdisección de los tejidos del ojo de pez cebra embrionarias

Zebrafish is a popular animal model for research on eye development because of its rapid ex utero development and good fecundity. By 3 days post ...

Eye Removal in Living Zebrafish Larvae to Examine Innervation-dependent Growth and Development of the Visual System

Zebrafish exhibit remarkable life-long growth and regenerative abilities. For example, specialized stem cell niches established during embryogenesis support continuous growth of the entire visual system, both in the eye and the brain. Coordinated growth between the retinae and the optic tectum ensures accurate retinotopic mapping as new neurons are added in the eyes and brain. To address whether retinal axons provide crucial information for regulating tectal stem and progenitor cell behaviors such as survival, proliferation, and/or differentiation, it is necessary to be able to compare innervated and denervated tectal lobes within the same animal and across animals. 
Surgical removal of one eye from living larval zebrafish followed by observation of the optic tectum achieves this goal. The accompanying video demonstrates how to anesthetize larvae, electrolytically sharpen tungsten needles, and use them to remove one eye. It next shows how to dissect brains from fixed zebrafish larvae. Finally, the video provides an overview of the protocol for immunohistochemistry and a demonstration of how to mount stained embryos in low-melting-point agarose for microscopy.

The article explains how to surgically remove eyes from living zebrafish larvae as the first step toward investigating how retinal input influences optic tectum growth and development. In addition, the article provides information about larval anesthetization, fixation, and brain dissection, followed by immunohistochemistry and confocal imaging.

Extirpación de ojos en larvas vivas de pez cebra para examinar el crecimiento dependiente de la inervación y el desarrollo del sistema visual

Zebrafish exhibit remarkable life-long growth and regenerative abilities. For example, specialized stem cell niches established during embryogenesis ...

Procesamiento de células intestinales de larvas de pez cebra para la secuenciación de ARN unicelular

Gut Isolation from Zebrafish Larvae for Single-cell RNA Sequencing

The gastrointestinal (GI) tract performs a range of functions essential for life. Congenital defects affecting its development can lead to enteric neuromuscular disorders, highlighting the importance to understand the molecular mechanisms underlying GI development and dysfunction. In this study, we present a method for gut isolation from zebrafish larvae at 5 days post fertilization to obtain live,&#160;viable cells which can be used for single-cell RNA sequencing (scRNA-seq) analysis. This protocol is based on the manual dissection of the zebrafish intestine, followed by enzymatic dissociation with papain. Subsequently, cells are submitted to fluorescence-activated cell sorting, and viable cells are collected for scRNA-seq. With this method, we were able to successfully identify different intestinal cell types, including epithelial, stromal, blood, muscle, and immune cells, as well as enteric neurons and glia. Therefore, we consider it to be a valuable resource for studying the composition of the GI tract in health and disease, using the zebrafish.

Autor destacado: Aislamiento y análisis de células intestinales de larvas de pez cebra para investigar los aspectos transcriptómicos del desarrollo gastrointestinal 

Here, we describe a method for gut isolation from zebrafish larvae at 5 days post fertilization, for single-cell RNA sequencing analysis.

Aislamiento intestinal de larvas de pez cebra para la secuenciación de ARN de una sola célula

The gastrointestinal (GI) tract performs a range of functions essential for life. Congenital defects affecting its development can lead to enteric ...

Heart Dissection in Larval, Juvenile and Adult Zebrafish, Danio rerio

Zebrafish have become a beneficial and practical model organism for the study of embryonic heart development (see recent reviews1-6), however, work examining post-embryonic through adult cardiac development has been limited7-10. Examining the changing morphology of the maturing and aging heart are restricted by the lack of techniques available for staging and isolating juvenile and adult hearts. In order to analyze heart development over the fish's lifespan, we dissect zebrafish hearts at numerous stages and photograph them for further analysis11. The morphological features of the heart can easily be quantified and individual hearts can be further analyzed by a host of standard methods. Zebrafish grow at variable rates and maturation correlates better with fish size than age, thus, post-fixation, we photograph and measure fish length as a gauge of fish maturation. This protocol explains two distinct, size dependent dissection techniques for zebrafish, ranging from larvae 3.5mm standard length (SL) with hearts of 100&mu;m ventricle length (VL), to adults, with SL of 30mm and VL 1mm or larger. Larval and adult fish have quite distinct body and organ morphology. Larvae are not only significantly smaller, they have less pigment and each organ is visually very difficult to identify. For this reason, we use distinct dissection techniques.
We used pre-dissection fixation procedures, as we discovered that hearts dissected directly after euthanization have a more variable morphology, with very loose and balloon like atria compared with hearts removed following fixation. The fish fixed prior to dissection, retain in vivo morphology and chamber position (data not shown). In addition, for demonstration purposes, we take advantage of the heart (myocardial) specific GFP transgenic Tg(myl7:GFP)twu34 (12), which allows us to visualize the entire heart and is particularly useful at early stages in development when the cardiac morphology is less distinct from surrounding tissues. Dissection of the heart makes further analysis of the cell and molecular biology underlying heart development and maturation using in situ hybridization, immunohistochemistry, RNA extraction or other analytical methods easier in post-embryonic zebrafish. This protocol will provide a valuable technique for the study of cardiac development maturation and aging.

Heart Dissection in Larval, Juvenile and Adult Zebrafish, Danio rerio

A clear, standardized method for dissection and isolation of the zebrafish heart at multiple developmental stages are described. Annotation and quantification techniques are also discussed.

La disección del corazón en las larvas, juveniles y adultos de pez cebra, Danio rerio</em

Zebrafish have become a beneficial and practical model organism for the study of embryonic heart development (see recent reviews1-6), however, work ...

La disección de las larvas de pez cebra de tejidos gonadales

Resumen

Explorar más videos

Capítulos en este video

La disección y de montaje lateral de embriones de pez cebra: Análisis para el Desarrollo de la médula espinal

La disección de los órganos del pez cebra adultos

La transección de la médula espinal en el pez cebra larval

Disección e imágenes en vivo de la Drosophila gonad embrionaria tardía

Microdisección de los tejidos del ojo de pez cebra embrionarias

Extirpación de ojos en larvas vivas de pez cebra para examinar el crecimiento dependiente de la inervación y el desarrollo del sistema visual

Aislamiento intestinal de larvas de pez cebra para la secuenciación de ARN de una sola célula

Aislamiento intestinal de larvas de pez cebra para la secuenciación de ARN de una sola célula

Aislamiento intestinal de larvas de pez cebra para la secuenciación de ARN de una sola célula

La disección del corazón en las larvas, juveniles y adultos de pez cebra, Danio rerio