우리는 물고기 케어 C 장 감사합니다. 이 작품은 중국 국가 자연 과학 재단 (GP로 31171074, 31371099 및 31571067)에 의해 그리고 포강 인재 프로젝트 (GP에 09PJ1401900)에 의해 지원되었다.

Zebrafish의 실험은 복단 대학 기관 동물 관리 및 사용위원회에 의해 승인되었습니다. Zebrafish의 표준 절차 (20)에 따라 상승과 사육되었다. 1. 준비 <ol><li> 애벌레 zebrafish의 DPF (17) DPF 25 육성 <ol><li> 교차 전날 늦은 오후에 건너 탱크로 전송이 남성과 두 여성 성인 제브라 피쉬 (건강, 기존 3 개월에서 6 개월, 실험실 앱 스트레인). 장벽으로 남성과 여성을 분리합니다. 다음 날 아침, 탱크의 물을 새로하고 그들이 짝짓기를 할 수 있도록 장벽을 제거합니다. 100mm 배양 접시 수정 후 1 ~ 2 시간에서 계란을 수집합니다. </li><li> 초기 개발 시간 (4 일) 동안 285 ° C에서 40 mL의 배아 매체 (EM)가 100mm의 접시에 약 40 배아를 유지하고 하루 두번 EM을 새로. 1 L 탱크 (300 mL의 시스템 물 (40) 유충)에 유충을 전송하고 5 DPF 후 라이브 로티퍼 (전체 공급, 하루에 두 번)로 공급.10 DPF 후 대신 로티퍼 다이어트의 라이브 소금물 새우 피드. 21 DPF (14)에 다시 물 순환 시스템에 물고기를 전송합니다. </li><li> DPF (17) 또는 DPF (25)까지 다시 순환 시스템 유충 제브라 올리기. 광 / 암 사이클을 보장하는 시스템 물 10분의 14 H하여 pH 값은 약 7.2이다. DPF (17) (5.5 ~ 6.8 mm) 및 DPF (25) 유충 22 (8 mm 내지 11)의 본체의 길이를 측정한다. </li></ol></li><li> 해부 2 % 한천 플레이트를 준비합니다. <ol><li> 200 ㎖의 멸균 수에 4g 한천 추가. 이 투명 될 때까지 전자 레인지에 가열하여 혼합합니다. </li><li> 다음, 직경 60mm 페트리 접시 (플레이트의 약 1/3 부피)에 부어 약 15 분 동안 한천 용액을 냉각. 4 ℃에서 응고 한천 플레이트를 저장합니다. </li></ol></li></ol> 2. 프로토콜 : 1 애벌레 DPF 성선의 (17)의 조직과 25 해부 <ol><li> 17 DPF의 애벌레를 마취 탱크에 얼음 조각을 추가합니다. 전송할30 mL의 차가운 링어의 솔루션 페트리 접시 차게 100 mm의 마취 유충. 완전히 유충을 마취 적어도 15 분 동안 냉각 링거액 배양 물고기를 유지합니다. </li><li> 작은 플라스틱 스푼으로 미리 냉각 된 한천 플레이트에 유충을 전송합니다. 링거액을 차게 10 mL에 전체 물고기의 몸을 담그고 부드럽게 옆으로 누워. </li><li> 25X 스테레오 현미경의 비전 필드에서 다음 작업을 수행합니다. 안정화를위한 핀셋 물고기 몸통을 클램프. 핀셋의 또 다른 쌍의 심장으로 항문에서 길이 방향으로 복부를 추출. 부드럽게 내부 장기를 노출 신체의 한쪽에 피부와 근육을 제거합니다. </li><li> 주의 부레에 복부 장기의 질량을 제거합니다. 부레에 부착 된 생식선의 손상을 방지. </li><li> 수영 방광과 전방 몸 사이의 연결을 잘라. 전체 부레 부드럽게 성선 조직을 잡아 당깁니다. 참고 : 대부분의 경우S는, DPF (17)의 생식선 조직은 상피 조직과 주변 protonephridium 포함한다. 그들은 쉽게 서로 분리되지 않지만, 25 그것은 쉽게 분리 할 수 ​​DPF. 생식소는 항문에 연결되어 있습니다. 항문에서 서로 접속 좌우 생식선과 접합 명확히 표시 될 것이다. </li><li> 주의 부레에서 성선 조직을 분리하고 주변의 지방 조직을 정리 핀셋을 사용합니다. </li><li> 즉시 200 μL 링거액을 함유하는 예냉 1.5 mL의 원심 분리 튜브로 절연 생식선 조직 옮긴다. 모든 성선 조직이 유충에서 분리 될 때까지 얼음에 튜브를 유지합니다. </li><li> 2.7 - 단계 2.1에 설명 된대로 유충 DPF (25)의 생식선을 해부하다. </li></ol> 3. 프로토콜 2 : 절연 성선 조직의 유전자 발현 분석 <ol><li> 애벌레 성선 조직에서 총 RNA를 추출합니다. <ol><li> 새의 RNase없는 일에 고립 된 성선 조직을 전송합니다.5 ㎖의 튜브는 링거액을 제거합니다. 100 μL 용해 솔루션을 추가합니다. 조직까지 소용돌이가 완전히 용해된다. </li><li> 제조업체의 지침에 따라 총 RNA 추출 절차를 수행합니다. </li><li> 내가 버퍼 10 배의 DNase의 1/10 볼륨과 RNA 솔루션의 DNase I의 1 μL를 추가하고 부드럽게 섞는다. 37 ° C에서 20 분 동안 인큐베이션. </li><li> RNA의 솔루션에 1/10 볼륨 DNase의 불 활성화 시약을 추가합니다. 70 ° C에서 10 분 동안 인큐베이션. 분광 광도계를 사용하여 전체 RNA의 농도를 측정한다. -20 ° C에서 보관하십시오. </li></ol></li><li> 첫 번째 가닥 cDNA 합성을 수행 <ol><li> 제조의 프로토콜 다음 첫 번째 가닥 cDNA 합성을 수행 할 올리고 (DT) -linker 프라이머를 사용합니다. 20 μL에 총 반응 볼륨 1 RNA의 μg의 2를 추가합니다. </li><li> 45 ° C에서 90 분 동안 반응 액을 인큐베이션. 5 분 동안 70 ℃에서 가열하여 반응을 정지. </li><li> cDNA를 1 μL의 RNase H를 추가하기 때문에기술인 것 잔류 RNA를 제거합니다. ~ 13,000 X g에서 10 초 동안 부드럽게 원심 분리기 섞는다. 37 ° C에서 20 분 동안 인큐베이션. 20 μL 뉴 클레아없는 물을 추가합니다. -70 ° C에서 보관하십시오. </li></ol></li><li> 형광 정량 PCR을 수행 <ol><li> 형광 염료와 자전거 타는 시스템에 qPCR을 수행합니다. 15 초, 30 초 동안 68 ° C를 들어, 15 초 동안 95 ° C에서 Tm은 -5 ℃로 35주기 다음 PCR 사이클링 조건을 사용한다. (: GTCCTGTTGTCTCCTACTGTCG, REV : FWD CATTTGAGTTGAATATGATGCCCTG), cyp19a1a :; : AMH (GCGGAGAGGTGGAAGAGAGAATG FWD : 회전 GTGGATGGCAGCAGTACGAC)를 다음과 같이 프라이머 시퀀스를 사용 nanos3 (FWD : GCTCGGTGTACGCCAAATCAACAT, REV : CCAAGTGAAAACACAACACCAGTGC), 바사 (FWD : ATCGCATAGGAAGAACTGGACGCT, REV : CCAAGTGAAAACACAACACCAGTGC) 및 β 액틴 (FWD : AGTGCGACGTGGACATCCGTA; REV : GCACTTCCTGTGGACGATGGA) 19. </li></ol></li></ol>

<ol>
	<li>Wilson, C. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wild+sex+in+zebrafish:+loss+of+the+natural+sex+determinant+in+domesticated+strains.">Wild sex in zebrafish: loss of the natural sex determinant in domesticated strains.</a> Genetics. 198 (3), 1291-1308 (2014).</li><li>Liew, W. C., Orban, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zebrafish+sex:+a+complicated+affair.">Zebrafish sex: a complicated affair.</a> Genomics. 13 (2), 172-187 (2014).</li><li>Orban, L., Sreenivasan, R., Olsson, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long+and+winding+roads:+Testis+differentiation+in+zebrafish.">Long and winding roads: Testis differentiation in zebrafish.</a> Mol. Cell. Endocrinol. 312 (1-2), 35-41 (2009).</li><li>Blaser, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transition+from+non-motile+behaviour+to+directed+migration+during+early+PGC+development+in+zebrafish.">Transition from non-motile behaviour to directed migration during early PGC development in zebrafish.</a> J. Cell Sci. 118, 4027-4038 (2005).</li><li>Wang, X. G., Orban, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Anti-M&#252;llerian+hormone+and+11+&#946;-hydroxylase+show+reciprocal+expression+to+that+of+aromatase+in+the+transforming+gonad+of+zebrafish+males.">Anti-M&#252;llerian hormone and 11 &#946;-hydroxylase show reciprocal expression to that of aromatase in the transforming gonad of zebrafish males.</a> Dev. Dynam. 236 (5), 1329-1338 (2007).</li><li>Siegfried, K. R., N&#252;sslein-Volhard, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Germ+line+control+of+female+sex+determination+in+zebrafish.">Germ line control of female sex determination in zebrafish.</a> Dev. Biol. 324 (2), 277-287 (2008).</li><li>Uchida, D., Yamashita, M., Kitano, T., Iguchi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oocyte+apoptosis+during+the+transition+from+ovary-like+tissue+to+testes+during+sex+differentiation+of+juvenile+zebrafish.">Oocyte apoptosis during the transition from ovary-like tissue to testes during sex differentiation of juvenile zebrafish.</a> J. Exp. Biol. 205 (Pt 6), 711-718 (2002).</li><li>Groh, K. J., Sch&#246;nenberger, R., Eggen, R. I. L., Segner, H., Suter, M. J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+protein+expression+in+zebrafish+during+gonad+differentiation+by+targeted+proteomics.">Analysis of protein expression in zebrafish during gonad differentiation by targeted proteomics.</a> Gen. Comp. Endocr. 193, 210-220 (2013).</li><li>Siegfried, K. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+search+of+determinants:+gene+expression+during+gonadal+sex+differentiation.">In search of determinants: gene expression during gonadal sex differentiation.</a> J. Fish Biol. 76 (8), 1879-1902 (2010).</li><li>Small, C. M., Carney, G. E., Mo, Q., Vannucci, M., Jones, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+microarray+analysis+of+sex-+and+gonad-biased+gene+expression+in+the+zebrafish:+evidence+for+masculinization+of+the+transcriptome.">A microarray analysis of sex- and gonad-biased gene expression in the zebrafish: evidence for masculinization of the transcriptome.</a> BMC Genomics. 10, 579 (2009).</li><li>Chiang, E. F., Yan, Y. L., Guiguen, Y., Postlethwait, J., Chung, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+Cyp19+(P450+aromatase)+genes+on+duplicated+zebrafish+chromosomes+are+expressed+in+ovary+or+brain.">Two Cyp19 (P450 aromatase) genes on duplicated zebrafish chromosomes are expressed in ovary or brain.</a> Mol. Biol. Evol. 18 (4), 542-550 (2001).</li><li>Kishida, M., Callard, G. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+cytochrome+P450+aromatase+isoforms+in+zebrafish+(Danio+rerio)+brain+and+ovary+are+differentially+programmed+and+estrogen+regulated+during+early+development.">Distinct cytochrome P450 aromatase isoforms in zebrafish (Danio rerio) brain and ovary are differentially programmed and estrogen regulated during early development.</a> Endocrinology. 142 (2), 740-750 (2001).</li><li>Rodr&#237;guez-Mar&#237;, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+and+expression+pattern+of+zebrafish+anti-M&#252;llerian+hormone+(amh)+relative+to+sox9a,+sox9b,+and+cyp19a1a,+during+gonad+development.">Characterization and expression pattern of zebrafish anti-M&#252;llerian hormone (amh) relative to sox9a, sox9b, and cyp19a1a, during gonad development.</a> Gene Expr.Patterns. 5 (5), 655-667 (2005).</li><li>Krovel, A. V., Olsen, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+a+vas::EGFP+transgene+in+primordial+germ+cells+of+the+zebrafish.">Expression of a vas::EGFP transgene in primordial germ cells of the zebrafish.</a> Mech Dev. 116 (1-2), 141-150 (2002).</li><li>Krovel, A. V., Olsen, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sexual+dimorphic+expression+pattern+of+a+splice+variant+of+zebrafish+vasa+during+gonadal+development.">Sexual dimorphic expression pattern of a splice variant of zebrafish vasa during gonadal development.</a> Dev. Biol. 271 (1), 190-197 (2004).</li><li>Tzung, K. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Early+depletion+of+primordial+germ+cells+in+zebrafish+promotes+testis+formation.">Early depletion of primordial germ cells in zebrafish promotes testis formation.</a> Stem Cell Reports. 4 (1), 61-73 (2015).</li><li>Hsiao, C., Tsai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transgenic+zebrafish+with+fluorescent+germ+cell:+a+useful+tool+to+visualize+germ+cell+proliferation+and+juvenile+hermaphroditism+in+vivo.">Transgenic zebrafish with fluorescent germ cell: a useful tool to visualize germ cell proliferation and juvenile hermaphroditism in vivo.</a> Dev. Biol. 262 (2), 313-323 (2003).</li><li>Jorgensen, A., Nielsen, J. E., Morthorst, J. E., Bjerregaard, P., Leffers, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laser+capture+microdissection+of+gonads+from+juvenile+zebrafish.">Laser capture microdissection of gonads from juvenile zebrafish.</a> Reprod Biol Endocrinol. 7, 97 (2009).</li><li>Chen, S., Zhang, H., Wang, F., Zhang, W., Peng, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=nr0b1+(DAX1)+mutation+in+zebrafish+causes+female-to-male+sex+reversal+through+abnormal+gonadal+proliferation+and+differentiation.">nr0b1 (DAX1) mutation in zebrafish causes female-to-male sex reversal through abnormal gonadal proliferation and differentiation.</a> Mol. Cell. Endocrinol. 433, 105-116 (2016).</li><li>Westerfield, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The Zebrafish Book: A Guide for The Laboratory Use of Zebrafish (Danio rerio). , (2000).</li><li>Liew, W. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polygenic+sex+determination+system+in+zebrafish.">Polygenic sex determination system in zebrafish.</a> PLoS One. 7 (4), e34397 (2012).</li><li>Parichy, D. M., Elizondo, M. R., Mills, M. G., Gordon, T. N., Engeszer, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Normal+table+of+postembryonic+zebrafish+development:+staging+by+externally+visible+anatomy+of+the+living+fish.">Normal table of postembryonic zebrafish development: staging by externally visible anatomy of the living fish.</a> Dev Dyn. 238 (12), 2975-3015 (2009).</li><li>Gupta, T., Mullins, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+of+Organs+from+the+Adult+Zebrafish.">Dissection of Organs from the Adult Zebrafish.</a> J. Vis Exp. (37), (2010).</li><li>Arnaout, R., Reischauer, S., Stainier, D. Y. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recovery+of+Adult+Zebrafish+Hearts+for+High-throughput+Applications.">Recovery of Adult Zebrafish Hearts for High-throughput Applications.</a> J. Vis Exp. (94), (2014).</li><li>Gerlach, G. F., Schrader, L. N., Wingert, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+of+the+Adult+Zebrafish+Kidney.">Dissection of the Adult Zebrafish Kidney.</a> J. Vis Exp. (54), (2011).</li><li>Yoon, C., Kawakami, K., Hopkins, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zebrafish+vasa+homologue+RNA+is+localized+to+the+cleavage+planes+of+2-+and+4-cell-stage+embryos+and+is+expressed+in+the+primordial+germ+cells.">Zebrafish vasa homologue RNA is localized to the cleavage planes of 2- and 4-cell-stage embryos and is expressed in the primordial germ cells.</a> Development. 124 (16), 3157-3165 (1997).</li><li>Braat, A. K., Speksnijder, J. E., Zivkovic, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Germ+line+development+in+fishes.">Germ line development in fishes.</a> Int. J. Dev. Biol. 43 (7), 745-760 (1999).</li><li>Huang, H. Y., Ketting, R. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+zebrafish+gonads+for+RNA+isolation.">Isolation of zebrafish gonads for RNA isolation.</a> Methods Mol Biol. 1093, 183-194 (2014).</li></ol>

저자는 더 경쟁 재정적 이해 관계가 없음을 선언합니다.

제브라 피쉬는 강력한 모델이되었다 광범위하게 개발 및 질병 관련 연구에 사용됩니다. 뇌, 심장, 생식선, 신장 등의 성인 제브라 피쉬에서 기관의 분리를위한 방법은,도 23, 24, 25를 기록하고있다. 때문에 작은 크기와 애벌레 제브라 피쉬의 성선 조직의 역동적 인 리모델링에, 성선 조직의 분리가 어려운 작업입니다. 애벌레 생...

야생 제브라 피쉬 염색체 4의 주요 여성 성 결정은 1 (즉, 일반적인 실험실 균주)를 분실하거나 들여진 제브라 피쉬에서 수정됩니다. 대신, 그들은 온도, 저산소증, 식품 가용성 및 인구 밀도 등 환경 요인에 의해 동행 polygenic 성 결정 시스템을 가지고있다. 제브라 피쉬 성 개발의 상세한 메커니즘은 완전히 이해되지 않습니다. 일차 성 판정 신호 (들) / 무엇 이러한 제브라 성 결정이 발생한 경우 등의 근본적인 문제가 있으며, 유전자 생식선 변환의 제 1 단계는, (3) 2 답변 남아 조절한다. 제브라 피쉬 성 개발의 과정에서 몇 가지 중요한 단계로 인식되고있다. 개발의 초기 단계에서, 4 HPF (시간 포스트 수정) 원시 생식 세포 (PGC와) 사양을 받아야에서 시작 생식기 능선 마이그레이션 및분아 증식. PGC 번호와 생식 세포와 체세포 사이의 상호 작용은 생식선 차별화 4 중요하다. 13 DPF (일 포스트 수정)에서, 생식선은 미분화 단계에 있습니다. 17 DPF으로 생식선 미래의 여성과 남성 모두에서 양방향 가능성이 난소로 발전. 난소에서 세포 사멸에 의존 전환은 고환에 21 ~ 25 DPF에서 시작하고 몇 주 동안 계속 사용할 수 있습니다. DPF (35)에 의해 상기 생식선의 성별 결정된 성별 별 생식 생산 7 양쪽 난소에서 진행되고, 6, 5 고환. 지금까지 다양한 후보 유전자 및 성 결정 메커니즘이 제안되었다. 단백질 체학 및 transcriptomic 분석은 성적으로 동종 이형 표현으로 많은 유전자를 격리하고 이들 유전자는 제브라 피쉬 (8)에서 성 차별을 연구하기 위해 사용되어왔다 </sup&gt; 9,10. 예를 들면, 애벌레 제브라에서 cyp19a1a 유전자 특이 아니라 고환 (11), (12) 난소 표현된다. 또한 AMH 유전자 약하게 난소 난포 과립 막 세포에서 발현되지만 강하게 정소 세르 톨리 세포 (13)이다. 반대로, 바사 유전자가 지속적으로 적합한 생식선 마커 (14), (15) 제조, 남녀 모두 지브라 피쉬의 생식 세포에서 발현된다. 생식선 유전자 발현 량을 조사하는 것은, 특히 양방향 전위 난소 단계 3, 9에 결정 성 및 분화의 분자 메커니즘을 이해하는 것이 중요하다. 그러나 애벌레 제브라 피쉬와 상응 작은 생식선의 작은 크기 gonada의 분리를 복잡하게추가로 분자 분석을위한 조직 L. 사용 이전의 연구는 opercula 항문 구멍 (16) 사이에 전체 트렁크 영역을 해부. 이 준비는 포함 생식선 있지만, 여러 조직과 기관으로 구성되어 있습니다. 대안 적으로, 바사 같은 성선 GFP 특이 식 트랜스 제닉 동물 : EGFP는 형광 활성화 세포 분류 (FACS)과 레이저 캡처 마이크로 해부 (17), (18)를 통하여 생식선 조직의 분리를 위해 사용 하였다. 그러나 그들의 광범위한 응용이 제한됩니다. 여기, 우리는 17 DPF 25 DPF에서 애벌레 제브라 피쉬에서 성선 조직을 분리하는 간단한 절차를 설명합니다. 우리는 다른 기관에 대한 생식선의 위치를 ​​보여 주변 조직에서 형태 학적 손상 생식선을 격리 할 것. 우리는 더 높은 정량 PCR을 통해 트렁크 조직 (과 비교 고립 된 생식선로 표현 등 바사와 cyp19a1a과 생식선 특정 유전자를 보여qPCR에) 분석. 본 프로토콜은 이에 생식기 조직 (19)의 연속적인 분자 분석을 가능하게 식별, 분리, 정제 및 RNA 유생 지브라 피쉬의 생식선 특정 유전자의 증폭을 허용한다.

<table><tbody><tr><td>Cell culture dish 100 mm</td><td>Corning</td><td>430167</td><td>For embryo incubation</td></tr><tr><td>20x EM</td><td></td><td></td><td>For a 1 L needed: add 17.5 g NaCl, 0.75 g KCl and 2.9 g CaCl&amp;#183;2H&lt;sub&gt;2&lt;/sub&gt;O; then add 0.41 g KH&lt;sub&gt;2&lt;/sub&gt;PO4, 0.412 g Na&lt;sub&gt;2&lt;/sub&gt;HPO4 anhydrous and 4.9 g MgSO&lt;sub&gt;4&lt;/sub&gt;&amp;#183;7H&lt;sub&gt;2&lt;/sub&gt;O.</td></tr><tr><td>1x EM</td><td></td><td></td><td>Dilute 20x EM in distilled water</td></tr><tr><td>AGAROSE G-10</td><td>Gene</td><td>121985</td><td>For preparing the 2% agar plates</td></tr><tr><td>Trizol Reagent</td><td>Invitrogen</td><td>15596-026</td><td>For RNA isolation</td></tr><tr><td>Meter glass</td><td>Shen Bo</td><td>250 ml</td><td>For preparing the 2% agar plates</td></tr><tr><td>Microwave Oven</td><td>Midea</td><td>M1-211A</td><td>For heating the AGAR</td></tr><tr><td>Tweezer DUMONT#5INOX</td><td>World Precision Instrument</td><td>500341</td><td>For dissection</td></tr><tr><td>Stereomicroscope</td><td>Motic</td><td>SMZ168</td><td>For dissection</td></tr><tr><td>Pure water equipment</td><td>Millipore</td><td></td><td></td></tr><tr><td>Ringer&amp;rsquo;s solution</td><td></td><td></td><td>For a 1 L needed: Add 6.78 g NaCl, 0.22 g KCl, 0.26 g CaCl&lt;sub&gt;2&lt;/sub&gt; and 1.19 g Hepes; then fill to 1 L; Adjust pH to 7.2. Sterilize by filtration and keep in an autoclaved clear polycarbonate container.</td></tr><tr><td>Transfer pipette</td><td>Samco</td><td>202, 204</td><td></td></tr><tr><td>Metal bath</td><td>QiLinbeier</td><td></td><td>Model GL-150</td></tr><tr><td>Microscope</td><td>Leica&amp;nbsp;</td><td>M205 FA</td><td>For photomicrograph</td></tr><tr><td>Centrifuge</td><td>Eppendorf</td><td>5417R</td><td></td></tr><tr><td>Micro Scale RNA Isolation Kit</td><td>Ambion</td><td>AM1931</td><td>For RNA isolation from gonad tissues</td></tr><tr><td>Dnase I</td><td>Sigma</td><td>AMPD1-1KT</td><td>For DNA digestion in the RNA solution</td></tr><tr><td>RevertAid First Strand cDNA Synthesis Kit</td><td>Thermo Scientific</td><td>#K1631</td><td>For first-strand cDNA synthesis</td></tr><tr><td>Rnase H</td><td>Thermo Scientific</td><td>#EN0202</td><td>For digesting the residual RNA in the cDNA solution.</td></tr><tr><td>SYBR Green Realtime PCR Master Mix</td><td>TOYOBO</td><td>QPK-201</td><td>This product is a Taq DNA polymerase-based 2x master mix for real-time PCR and&amp;nbsp; applicable for intercalation assay with SYBR Green I.</td></tr><tr><td>Spectrophotometer</td><td>Ne Drop</td><td>OD-2000+</td><td>Measuring the concentration of the total RNA</td></tr><tr><td>Mastercycler</td><td>Eppendorf</td><td>AG 22331 Hamburg</td><td>gene expression profiling</td></tr></tbody></table>

dissection of larval zebrafish gonadal tissue

야생 제브라 피쉬는 ZZ / ZW 성 결정 시스템을 가지고 있지만, 길 들여진 제브라 피쉬는 성 염색체를 잃었다. 그들은 게놈가 공동으로 개별 물고기의 성 정체성을 결정 전반에 걸쳐 여러 유전자가 분산 polygenic 성 결정 시스템을 활용합니다. 현재 유전자는 생식소의 발달을 조절에 관여하고 작동 방법이 어려운 남아있다. 일반적으로, 성선 조직을 분리하는 것은 성 발달 과정을 조사하기위한 첫 번째 단계입니다. 여기서 우리는 zebrafish의 유충 DPF (17) DPF (일 포스트 수정) 25에서 성선 조직을 분리하는 방법을 제시한다. 분리 된 성선 조직은 연속적 형태 및 유전자 발현 프로파일 링에 의해 조사 할 수있다.

생식기의 해부는 앱 스트레인 애벌레 제브라 피쉬에서 수행되었다. 도 1은 DPF (17)와 DPF (25)에서 유충 지브라 피쉬의 전형적인 생식선의 조직을 보여준다. 첫째, 피부와 복부의 한 쪽의 근육은 내부 장기를 노출 절단한다. 내부 장기의 질량을 제거한 후, 함께 생식소와 부레 트렁크에 남아 있습니다. 생식선은 ( &#39;도 1b에</...

Watch this Scientific Journal Video about Dissection of Larval Zebrafish Gonadal Tissue at JoVE.com

Dissection of Larval Zebrafish Gonadal Tissue

여기서 우리는 제브라 피쉬 섹스의 분화 및 유지 보수의 조사를 용이하게 애벌레 제브라 피쉬의 성선 조직을 분리하기위한 프로토콜을 제시한다.

애벌레 Zebrafish의 생식소 조직의 해부

Although wild zebrafish possess a ZZ/ZW sex-determination system, domesticated zebrafish have lost the sex chromosome. They utilize a polygenic sex ...

dissection-of-larval-zebrafish-gonadal-tissue

Research

JoVE Journal

Developmental Biology

10.2K 조회수.  Fudan University.  여기서 우리는 제브라 피쉬 섹스의 분화 및 유지 보수의 조사를 용이하게 애벌레 제브라 피쉬의 성선 조직을 분리하기위한 프로토콜을 제시한다. 

비디오: Dissection of Larval Zebrafish Gonadal Tissue

Dissection and Lateral Mounting of Zebrafish Embryos: Analysis of Spinal Cord Development

The zebrafish spinal cord is an effective investigative model for nervous system research for several reasons. First, genetic, transgenic and gene knockdown approaches can be utilized to examine the molecular mechanisms underlying nervous system development. Second, large clutches of developmentally synchronized embryos provide large experimental sample sizes. Third, the optical clarity of the zebrafish embryo permits researchers to visualize progenitor, glial, and neuronal populations. Although zebrafish embryos are transparent, specimen thickness can impede effective microscopic visualization. One reason for this is the tandem development of the spinal cord and overlying somite tissue. Another reason is the large yolk ball, which is still present during periods of early neurogenesis. In this article, we demonstrate microdissection and removal of the yolk in fixed embryos, which allows microscopic visualization while preserving surrounding somite tissue. We also demonstrate semipermanent mounting of zebrafish embryos. This permits observation of neurodevelopment in the dorso-ventral and anterior-posterior axes, as it preserves the three-dimensionality of the tissue.

Developmental processes such as proliferation, patterning, differentiation, and axon guidance can be readily modeled in the zebrafish spinal cord. In this article, we describe a mounting procedure for zebrafish embryos, which optimizes visualization of these events.

해부 및 제브라 피쉬 배아의 측면 장착 : 척수 개발의 분석

The zebrafish spinal cord is an effective investigative model for nervous system research for several reasons. First, genetic, transgenic and gene ...

연구

신경과학

Dissection of Organs from the Adult Zebrafish

Over the last 20 years, the zebrafish has become a powerful model organism for understanding vertebrate development and disease.  Although experimental analysis of the embryo and larva is extensive and the morphology has been well documented, descriptions of adult zebrafish anatomy and studies of development of the adult structures and organs, together with techniques for working with adults are lacking. The organs of the larva undergo significant changes in their overall structure, morphology, and anatomical location during the larval to adult transition.  Externally, the transparent larva develops its characteristic adult striped pigment pattern and paired pelvic fins, while internally, the organs undergo massive growth and remodeling.  In addition, the bipotential gonad primordium develops into either testis or ovary.  This protocol identifies many of the organs of the adult and demonstrates methods for dissection of the brain, gonads, gastrointestinal system, heart, and kidney of the adult zebrafish. The dissected organs can be used for in situ hybridization, immunohistochemistry, histology, RNA extraction, protein analysis, and other molecular techniques.  This protocol will assist in the broadening of studies in the zebrafish to include the remodeling of larval organs, the morphogenesis of organs specific to the adult and other investigations of the adult organ systems.

This protocol describes a procedure for identifying and dissecting organs from the adult zebrafish.

성인 Zebrafish에서 기관의 해부

Over the last 20 years, the zebrafish has become a powerful model organism for understanding vertebrate development and disease.  Although experimental ...

생물학

Spinal Cord Transection in the Larval Zebrafish

Mammals fail in sensory and motor recovery following spinal cord injury due to lack of axonal regrowth below the level of injury as well as an inability to reinitiate spinal neurogenesis. However, some anamniotes including the zebrafish Danio rerio exhibit both sensory and functional recovery even after complete transection of the spinal cord. The adult zebrafish is an established model organism for studying regeneration following spinal cord injury, with sensory and motor recovery by 6&#160;weeks post-injury. To take advantage of in vivo analysis of the regenerative process available in the transparent larval zebrafish as well as genetic tools not accessible in the adult, we use the larval zebrafish to study regeneration after spinal cord transection. Here we demonstrate a method for reproducibly and verifiably transecting the larval spinal cord. After transection, our data shows sensory recovery beginning at 2&#160;days post-injury (dpi), with the C-bend movement detectable by 3 dpi and resumption of free swimming by 5 dpi. Thus we propose the larval zebrafish as a companion tool to the adult zebrafish for the study of recovery after spinal cord injury.

After spinal transection, adult zebrafish have functional recovery by six weeks post-injury. To take advantage of larval transparency and faster recovery, we present a method for transecting the larval spinal cord. After transection, we observe sensory recovery beginning at 2&#160;days post-injury, and C-bend movement by 3 days post-injury.

애벌레 Zebrafish의 척수 절개

Mammals fail in sensory and motor recovery following spinal cord injury due to lack of axonal regrowth below the level of injury as well as an inability ...

Dissection and Live-Imaging of the Late Embryonic Drosophila Gonad

The Drosophila melanogaster male embryonic gonad is an advantageous model to study various aspects of developmental biology including, but not limited to, germ cell development, piRNA biology, and niche formation. Here, we present a dissection technique to live-image the gonad ex vivo during a period when in vivo live-imaging is highly ineffective. This protocol outlines how to transfer embryos to an imaging dish, choose appropriately-staged male embryos, and dissect the gonad from its surrounding tissue while still maintaining its structural integrity. Following dissection, gonads can be imaged using a confocal microscope to visualize dynamic cellular processes. The dissection procedure requires precise timing and dexterity, but we provide insight on how to prevent common mistakes and how to overcome these challenges. To our knowledge this is the first dissection protocol for the Drosophila embryonic gonad, and will permit live-imaging during an otherwise inaccessible window of time. This technique can be combined with pharmacological or cell-type specific transgenic manipulations to study any dynamic processes occurring within or between the&#160;cells in their natural gonadal environment.

Dissection and Live-Imaging of the Late Embryonic Drosophila Gonad

Here, we provide a dissection protocol required to live-image the late embryonic Drosophila male gonad. This protocol will permit observation of dynamic cellular processes under normal conditions or after transgenic or pharmacological manipulation.

후기 배아 초파리 고나드의 해부와 라이브 이미징

The Drosophila melanogaster male embryonic gonad is an advantageous model to study various aspects of developmental biology including, but not limited to, ...

발생학

Microdissection of Zebrafish Embryonic Eye Tissues

Zebrafish is a popular animal model for research on eye development because of its rapid ex utero development and good fecundity. By 3 days post fertilization (dpf), the larvae will show the first visual response. Many genes have been identified to control a proper eye development, but we are far from a complete understanding of the underlying genetic architecture. Whole genome gene expression profiling is a useful tool to elucidate genetic regulatory network for eye development. However, the small size of the embryonic eye in zebrafish makes it challenging to obtain intact and pure eye tissues for expression analysis. For example, the anterior-posterior length of the eye between day 2 and 3 is only approximately 200-300 &mu;m, while the diameter of the lens is less 100 &mu;m. Also, the retinal pigment epithelium (RPE) underlying the retina is just a single-layer epithelium. While gene expression profiles can be obtained from the whole embryo, they do not accurately represent the expression of these tissues. Therefore pure tissue must be obtained for a successful gene expression profiling of eye development. To address this issue, we have developed an approach to microdissect intact retina and retina with RPE attached from 1-3 dpf, which cover major stages of eye morphogenesis. All procedures can be done with fine forceps and general laboratory supplies under standard stereomicroscopes. For retinal dissection, the single-layer RPE is removed and peeled off by brushing action and the preferential adherence of the RPE remnants to the surface of the culture plate for dissection. For RPE-attached retinal dissection, the adherence of RPE to the dissection plate is removed before the dissection so that the RPE can be completely preserved with the retina. A careful lifting action of this tissue can efficiently separate the presumptive choroid and sclera. The lens can be removed in both cases by a chemically etched tungsten needle. In short, our approach can obtain intact eye tissues and has been successfully utilized to study tissue-specific expression profiles of zebrafish retina1, 2 and retinal pigment epithelium3.

This article describes an approach to microdissect zebrafish retinas with and without retinal pigment epithelium attached, from one to three days postfertilization embryos.

Zebrafish 배아 눈 조직의 Microdissection

Zebrafish is a popular animal model for research on eye development because of its rapid ex utero development and good fecundity. By 3 days post ...

Eye Removal in Living Zebrafish Larvae to Examine Innervation-dependent Growth and Development of the Visual System

Zebrafish exhibit remarkable life-long growth and regenerative abilities. For example, specialized stem cell niches established during embryogenesis support continuous growth of the entire visual system, both in the eye and the brain. Coordinated growth between the retinae and the optic tectum ensures accurate retinotopic mapping as new neurons are added in the eyes and brain. To address whether retinal axons provide crucial information for regulating tectal stem and progenitor cell behaviors such as survival, proliferation, and/or differentiation, it is necessary to be able to compare innervated and denervated tectal lobes within the same animal and across animals. 
Surgical removal of one eye from living larval zebrafish followed by observation of the optic tectum achieves this goal. The accompanying video demonstrates how to anesthetize larvae, electrolytically sharpen tungsten needles, and use them to remove one eye. It next shows how to dissect brains from fixed zebrafish larvae. Finally, the video provides an overview of the protocol for immunohistochemistry and a demonstration of how to mount stained embryos in low-melting-point agarose for microscopy.

The article explains how to surgically remove eyes from living zebrafish larvae as the first step toward investigating how retinal input influences optic tectum growth and development. In addition, the article provides information about larval anesthetization, fixation, and brain dissection, followed by immunohistochemistry and confocal imaging.

살아있는 제브라 피쉬 유충의 눈 제거는 시각 시스템의 신경 의존적 인 성장과 발달을 조사합니다.

Zebrafish exhibit remarkable life-long growth and regenerative abilities. For example, specialized stem cell niches established during embryogenesis ...

Single-Cell RNA 염기서열분석을 위한 Zebrafish 유충의 장세포 처리

Gut Isolation from Zebrafish Larvae for Single-cell RNA Sequencing

The gastrointestinal (GI) tract performs a range of functions essential for life. Congenital defects affecting its development can lead to enteric neuromuscular disorders, highlighting the importance to understand the molecular mechanisms underlying GI development and dysfunction. In this study, we present a method for gut isolation from zebrafish larvae at 5 days post fertilization to obtain live,&#160;viable cells which can be used for single-cell RNA sequencing (scRNA-seq) analysis. This protocol is based on the manual dissection of the zebrafish intestine, followed by enzymatic dissociation with papain. Subsequently, cells are submitted to fluorescence-activated cell sorting, and viable cells are collected for scRNA-seq. With this method, we were able to successfully identify different intestinal cell types, including epithelial, stromal, blood, muscle, and immune cells, as well as enteric neurons and glia. Therefore, we consider it to be a valuable resource for studying the composition of the GI tract in health and disease, using the zebrafish.

저자 스포트라이트: 위장 발달의 전사체학적 측면을 조사하기 위한 제브라피시 유충의 장 세포 분리 및 분석 

Here, we describe a method for gut isolation from zebrafish larvae at 5 days post fertilization, for single-cell RNA sequencing analysis.

Single-cell RNA 염기서열분석을 위한 Zebrafish 유충의 장 분리

The gastrointestinal (GI) tract performs a range of functions essential for life. Congenital defects affecting its development can lead to enteric ...

Heart Dissection in Larval, Juvenile and Adult Zebrafish, Danio rerio

Zebrafish have become a beneficial and practical model organism for the study of embryonic heart development (see recent reviews1-6), however, work examining post-embryonic through adult cardiac development has been limited7-10. Examining the changing morphology of the maturing and aging heart are restricted by the lack of techniques available for staging and isolating juvenile and adult hearts. In order to analyze heart development over the fish's lifespan, we dissect zebrafish hearts at numerous stages and photograph them for further analysis11. The morphological features of the heart can easily be quantified and individual hearts can be further analyzed by a host of standard methods. Zebrafish grow at variable rates and maturation correlates better with fish size than age, thus, post-fixation, we photograph and measure fish length as a gauge of fish maturation. This protocol explains two distinct, size dependent dissection techniques for zebrafish, ranging from larvae 3.5mm standard length (SL) with hearts of 100&mu;m ventricle length (VL), to adults, with SL of 30mm and VL 1mm or larger. Larval and adult fish have quite distinct body and organ morphology. Larvae are not only significantly smaller, they have less pigment and each organ is visually very difficult to identify. For this reason, we use distinct dissection techniques.
We used pre-dissection fixation procedures, as we discovered that hearts dissected directly after euthanization have a more variable morphology, with very loose and balloon like atria compared with hearts removed following fixation. The fish fixed prior to dissection, retain in vivo morphology and chamber position (data not shown). In addition, for demonstration purposes, we take advantage of the heart (myocardial) specific GFP transgenic Tg(myl7:GFP)twu34 (12), which allows us to visualize the entire heart and is particularly useful at early stages in development when the cardiac morphology is less distinct from surrounding tissues. Dissection of the heart makes further analysis of the cell and molecular biology underlying heart development and maturation using in situ hybridization, immunohistochemistry, RNA extraction or other analytical methods easier in post-embryonic zebrafish. This protocol will provide a valuable technique for the study of cardiac development maturation and aging.

Heart Dissection in Larval, Juvenile and Adult Zebrafish, Danio rerio

A clear, standardized method for dissection and isolation of the zebrafish heart at multiple developmental stages are described. Annotation and quantification techniques are also discussed.

애벌레의 심장 해부, 소년과 성인 Zebrafish, Danio rerio</em

Zebrafish have become a beneficial and practical model organism for the study of embryonic heart development (see recent reviews1-6), however, work ...

애벌레 Zebrafish의 생식소 조직의 해부

요약

더 많은 비디오 탐색

이 비디오의 챕터

해부 및 제브라 피쉬 배아의 측면 장착 : 척수 개발의 분석

성인 Zebrafish에서 기관의 해부

애벌레 Zebrafish의 척수 절개

후기 배아 초파리 고나드의 해부와 라이브 이미징

Zebrafish 배아 눈 조직의 Microdissection

살아있는 제브라 피쉬 유충의 눈 제거는 시각 시스템의 신경 의존적 인 성장과 발달을 조사합니다.

Single-cell RNA 염기서열분석을 위한 Zebrafish 유충의 장 분리

Single-cell RNA 염기서열분석을 위한 Zebrafish 유충의 장 분리

Single-cell RNA 염기서열분석을 위한 Zebrafish 유충의 장 분리

애벌레의 심장 해부, 소년과 성인 Zebrafish, Danio rerio