This research was supported by the U.S. Department of Agriculture, Agricultural Research Service (USDA-ARS), National Program 108, Current Research Information System numbers 8072-42000-093 and 8072-42000-094-000-D. Mention of trade names or commercial products in this article is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the U. S. Department of Agriculture. USDA is an equal opportunity provider and employer.

All work associated with this protocol should be conducted within a biological safety cabinet (BSC) to maintain aseptic conditions and minimize the risk of sample contamination or operator exposure to microbial pathogens. When transferring samples outside the BSC, use sealed containers to prevent spillage in case of accidental drops, maintaining sample integrity. Preferably, disposable components should be used throughout the procedure to mitigate the possibility of cross-contamination. In cases where disposables are not feasible, ensure all equipment and materials are sterile prior to use. Proper waste management is crucial; all used disposable components should be discarded as biohazard waste. Autoclave materials before discarding to ensure proper sterilization and avoid containment of potentially hazardous materials. Adhering to these precautions not only safeguards sample integrity but also minimizes the risk of operator exposure to microbial pathogens. Figure 1 depicts the workflow of sample preparation, selective enrichment, filter-based isolation, and mqPCR differentiation of Campylobacter species. Supplemental File 1 depicts a more detailed workflow and images throughout the process.
1. Preparation of meat samples
<ol>
	<li>Acquiring meat samples
	<ol>
		<li>Acquire various fresh meat packages, including chicken thighs, wings, drumsticks, and livers from local retailers.</li>
		<li>Transfer all samples to storage at 4 &#176;C and process within 24 h after receipt. 
		NOTE: Storing the fresh samples at lower temperatures, such as below freezing, will affect the recovery.</li>
	</ol>
	</li>
	<li>Processing meat samples
	<ol>
		<li>Follow the ratio of components prescribed within the FSIS sampling guideline6,17.</li>
		<li>Cut 450 g chicken pieces from each package and place them in a stomacher bag (see Table of Materials). 
		NOTE: Stomacher bags are suggested because they have sufficient mechanical strength to ensure the downstream processes, and will not rupture or leak.</li>
		<li>Prepare buffered peptone water (BPW).
		<ol>
			<li>Dissolve 20 g of the powder (see Table of Materials) in 1 L of purified water. Autoclave the solution at 121 &#176;C for 15 min. Dilute the solution in sterile water to a concentration of 0.1%.</li>
		</ol>
		</li>
		<li>Add 200 mL 0.1% BPW to the stomacher bag containing the chicken.</li>
		<li>Manually massage/palpate the sample from the outside of the stomacher bag for 2 min.</li>
		<li>Collect all the chicken rinse from the filtered side of the bag using a motorized pipette controller (see Table of Materials).</li>
		<li>Dispense the chicken rinse into sterile centrifuge bottles. Centrifuge at 10,000 x g for 10 min at room temperature.</li>
		<li>Carefully collect the supernatant using a motorized pipette controller with a 25 mL disposable serological plastic pipette. Avoid disturbing the pellet.</li>
		<li>Repeat the process as necessary to ensure all of the supernatant is removed.</li>
		<li>Discard the collected supernatant.</li>
	</ol>
	</li>
</ol>
2.&#160;Selective enrichment of Campylobacter from raw meat
<ol>
	<li>Preparation of Bolton Broth with supplements
	<ol>
		<li>Dissolve 13.8 g of powder (see Table of Materials) in 500 mL of purified water. Sterilize the broth by autoclaving for 15 min at 121 &#176;C.</li>
		<li>Add 25 mL laked horse blood (see Table of Materials) to the sterilized 500 mL Bolton Broth. 
		NOTE: The addition of horse blood acts as an oxygen quenching agent to aid in the recovery of injured Campylobacter cells from the food matrix.</li>
		<li>Reconstitute 1 vial of antibiotic supplement (cefoperazone, cycloheximide, trimethoprim, and vancomycin, see Table of Materials) in 5 mL 50% ethanol.</li>
		<li>Add the reconstituted antibiotic supplement to the Bolton Broth.</li>
	</ol>
	</li>
	<li>Enrichment procedure
	<ol>
		<li>Resuspend the pellet in 50 mL Bolton Broth containing laked horse blood and antibiotics.</li>
		<li>Place samples (with loosened caps) inside a sealed container that maintains a gas mixture of 85% N2, 10% CO2, and 5% O2.
		<ol>
			<li>Ensure the cap is loose, but the container is tightly sealed to produce the microaerophilic and thermophilic growth requirements of Campylobacter. 
			NOTE: Gas packs that maintain an atmosphere of 85% N2, 10% CO2, and 5% O2 can be used when environmental chambers are not available.</li>
			<li>Incubate the samples at 42 &#176;C for 24 h.</li>
		</ol>
		</li>
	</ol>
	</li>
</ol>
3. Isolation and purification of C. jejuni and C. coli from raw chicken
<ol>
	<li>Preparation of Brucella agar plates
	<ol>
		<li>Dissolve 28 g of Brucella powder (see Table of Materials) in 1 L of purified water. Dissolve 15 g of agar in the Brucella solution.</li>
		<li>Sterilize the Brucella agar by autoclaving for 15 min at 121 &#176;C. Cool the medium-agar mix in a 55 &#176;C water bath.</li>
		<li>Pour 20 mL of Brucella agar into each 100 mm diameter Petri dish.</li>
	</ol>
	</li>
	<li>Filter method and colony cultivation
	<ol>
		<li>Evaluate the effect of moisture on Campylobacter passing through filters by drying Brucella agar plates with lids opened in a Biosafety cabinet for 0 h, 1 h, 2 h and 3 h.</li>
		<li>Prepare a no-filter control by directly spreading 80 &#181;L of the sample on the Brucella agar plate.</li>
	</ol>
	</li>
	<li>Place a cellulose acetate filter (0.45 &#181;m or 0.65 pore-size, see Table of Materials) at the center of a Brucella agar plate.</li>
	<li>Pipette 4 drops/filter and 20 &#181;L/drop of enriched sample onto the filter.
	<ol>
		<li>Place the drops near the center of the filter to ensure the liquid that reaches the plate goes through the filter, not around the filter.</li>
		<li>Place the drops in a manner that ensures they will not spread and aggregate.</li>
	</ol>
	</li>
	<li>Incubate drops at room temperature for 15 min and carefully remove the filters. 
	NOTE: This step permits sufficient time for the Campylobacter cells to traverse the membrane and reach the agar medium without excessive drying.</li>
	<li>Incubate plates at 42 &#176;C for approximately 24 h under the microaerobic conditions described earlier.</li>
	<li>Pick characteristic Campylobacter colonies with specific traits. 
	NOTE: Campylobacter colonies are typically round with smooth edges, glistening, and translucent yellowish or pinkish color6.</li>
	<li>Streak colonies onto Brucella agar plates for purification. Repeat this step until plates with a single uniform colony morphology are obtained.</li>
	<li>Prepare samples for long-term storage.
	<ol>
		<li>Prepare Bolton Broth as described earlier. Add one colony from the plate with uniform colony morphology.</li>
		<li>Grow overnight (24 h) under microaerophilic conditions described earlier. Add 900 &#181;L of the overnight culture to a 2 mL cryovial containing 100 &#181;L of DMSO.</li>
		<li>Rapidly cool in a dry ice-ethanol bath (approx. -72 &#176;C) for 10 min. Transfer to a -80 &#176;C freezer for long-term storage.</li>
	</ol>
	</li>
</ol>
4. Identification of C. jejuni and C. coli species
<ol>
	<li>Perform species-level identification of C. jejuni and C. coli using a multiplex qPCR (mqPCR) assay previously developed18,19.
	<ol>
		<li>Perform rapid cell lysis and genomic DNA extraction in a 96-well plate format. 
		NOTE: It is strongly recommended to consider using commercial kits (see Table of Materials) to ensure that the sample is sufficiently free of known inhibitors of PCR.
		<ol>
			<li>Disperse purified Campylobacter colonies into 100 &#181;L of extraction solution.</li>
			<li>Lyse samples at 99 &#176;C for 10 min followed by cooling at 20 &#176;C for 2 min in a thermocycler.</li>
			<li>Centrifuge the plate at 8,000 x g for 10 min at room temperature. Remove 2 &#181;L of aliquots of the supernatant for the mqPCR assay.</li>
			<li>Prepare a 20 &#181;L reaction mixture consisting of 10 &#181;L of 2x Master Mix, 2.0 &#181;L of DNA sample, 104 copies of Internal Amplification Control (IAC) template, and 200 nM of each primer and probe (see Table of Materials). 
			NOTE: The primers and probes of hipO and cdtA are the exclusive target genes for C. jejuni and C. coli, respectively.&#160;The IAC consists of a 79-bp DNA segment of the human adenovirus and is included as a positive control to ensure consistent activity of DNA polymerase across all samples.</li>
		</ol>
		</li>
		<li>Load all samples in triplicates in a 96-well optical plate covered with an optical film and place them in a Real-Time PCR system (see Table of Materials).
		<ol>
			<li>Initiate a hot-start activation of the DNA polymerase at 95 &#176;C for 10 min.&#160;Follow with 40 cycles of denaturation at 95 &#176;C for 15 s and annealing/extension at 60 &#176;C for 1 min.</li>
		</ol>
		</li>
	</ol>
	</li>
</ol>
5. Enumerate cell suspensions
<ol>
	<li>Enumerate cell suspensions using a 6 x 6 drop plate procedure20. Refer to Supplemental File 1 for images depicting the 6 x 6 drop plate method.</li>
	<li>Air dry Brucella agar plates with the lid off in a laminar flow hood for 45 min.</li>
	<li>Add 200 &#181;L of bacterial suspension to six rows (A-F) in the first column of a 96-well plate.</li>
	<li>Distribute 180 &#181;L of Brucella medium across six rows of the remaining columns (2-12).</li>
	<li>Prepare ten-fold serial dilutions using 20 &#181;L transfers.
	<ol>
		<li>For instance, transfer 20 &#181;L of sample from column one to column two.&#160;Repeat this process for a minimum of 6 columns.</li>
		<li>Reflux mix each suspension ten times using the pipette, changing the tips between each transfer.</li>
	</ol>
	</li>
	<li>Use a multichannel pipette to deposit 7 &#181;L drops from six rows of a column on the surface of a Brucella agar plate.</li>
	<li>Repeat to create a 6 x 6 array, ensuring rows are technical replicates across columns.</li>
	<li>Air dry the plates for 5 min, and then invert the plate.Incubate plates at 42 &#176;C for 24 h.</li>
	<li>Count the number of colonies in each representative dilution.</li>
</ol>

Enhanced Campylobacter Isolation from Meat

<ol>
	<li>Rushton, S. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Climate,+human+or+environment:+Individual-based+modelling+of+Campylobacter+seasonality+and+strategies+to+reduce+disease+burden.">Climate, human or environment: Individual-based modelling of Campylobacter seasonality and strategies to reduce disease burden.</a> J Transl Med. 17 (1), 34 (2019).</li><li>Facciol&#224;, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Campylobacter:+From+microbiology+to+prevention.">Campylobacter: From microbiology to prevention.</a> J Prev Med Hyg. 58 (2), E79-E92 (2017).</li><li>Perez-Arnedo, I., Gonzalez-Fandos, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prevalence+of+Campylobacter+spp.+In+poultry+in+three+spanish+farms,+a+slaughterhouse+and+a+further+processing+plant.">Prevalence of Campylobacter spp. In poultry in three spanish farms, a slaughterhouse and a further processing plant.</a> Foods. 8 (3), 111 (2019).</li><li>Nachamkin, I., Allos, B. M., Ho, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Campylobacter+species+and+guillain-barr&#233;+syndrome.">Campylobacter species and guillain-barr&#233; syndrome.</a> Clin Microbiol Rev. 11 (3), 555-567 (1998).</li><li>Department of Food Administration. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacteriological+analytical+manual.">Bacteriological analytical manual.</a> Department of Food Administration. , (1992).</li><li>USDA Office of Public Health Science. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolating+and+identifying+Campylobacter+jejuni/coli/lari+from+poultry+rinsate,+sponge+and+raw+product+samples.">Isolating and identifying Campylobacter jejuni/coli/lari from poultry rinsate, sponge and raw product samples.</a> Microbiology Laboratory Guidebook. , (2022).</li><li>Singh, H., Rathore, R. S., Singh, S., Cheema, P. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+analysis+of+cultural+isolation+and+PCR+based+assay+for+detection+of+Campylobacter+jejuni+in+food+and+faecal+samples.">Comparative analysis of cultural isolation and PCR based assay for detection of Campylobacter jejuni in food and faecal samples.</a> Braz J Microbiol. 42 (1), 181-186 (2011).</li><li>Kralik, P., Ricchi, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+basic+guide+to+real+time+pcr+in+microbial+diagnostics:+Definitions,+parameters,+and+everything.">A basic guide to real time pcr in microbial diagnostics: Definitions, parameters, and everything.</a> Front Microbiol. 8, (2017).</li><li>Linton, D., Lawson, A. J., Owen, R. J., Stanley, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR+detection,+identification+to+species+level,+and+fingerprinting+of+Campylobacter+jejuni+and+Campylobacter+coli+direct+from+diarrheic+samples.">PCR detection, identification to species level, and fingerprinting of Campylobacter jejuni and Campylobacter coli direct from diarrheic samples.</a> J Clin Microbiol. 35 (10), 2568-2572 (1997).</li><li>Kabiraz, M. P., Majumdar, P. R., Mahmud, M. M. C., Bhowmik, S., Ali, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Conventional+and+advanced+detection+techniques+of+foodborne+pathogens:+A+comprehensive+review.">Conventional and advanced detection techniques of foodborne pathogens: A comprehensive review.</a> Heliyon. 9 (4), e15482 (2023).</li><li>Kaakoush, N. O., Casta&#241;o-Rodr&#237;guez, N., Mitchell, H. M., Man, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+epidemiology+of+Campylobacter+infection.">Global epidemiology of Campylobacter infection.</a> Clin Microbiol Rev. 28 (3), 687-720 (2015).</li><li>Gilbreath, J. J., Cody, W. L., Merrell, D. S., Hendrixson, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Change+is+good:+Variations+in+common+biological+mechanisms+in+the+epsilonproteobacterial+genera+Campylobacter+and+Helicobacter.">Change is good: Variations in common biological mechanisms in the epsilonproteobacterial genera Campylobacter and Helicobacter.</a> Microbiol Mol Biol Rev. 75 (1), 84-132 (2011).</li><li>Lertsethtakarn, P., Ottemann, K. M., Hendrixson, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Motility+and+chemotaxis+in+campylobacter+and+helicobacter.">Motility and chemotaxis in campylobacter and helicobacter.</a> Annu Rev Microbiol. 65, 389-410 (2011).</li><li>Jokinen, C. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+enhanced+technique+combining+pre-enrichment+and+passive+filtration+increases+the+isolation+efficiency+of+Campylobacter+jejuni+and+Campylobacter+coli+from+water+and+animal+fecal+samples.">An enhanced technique combining pre-enrichment and passive filtration increases the isolation efficiency of Campylobacter jejuni and Campylobacter coli from water and animal fecal samples.</a> J Microbiol Methods. 91 (3), 506-513 (2012).</li><li>Engberg, J., On, S. L., Harrington, C. S., Gerner-Smidt, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prevalence+of+Campylobacter,+Arcobacter,+Helicobacter,+and+Sutterella+spp.+In+human+fecal+samples+as+estimated+by+a+reevaluation+of+isolation+methods+for+Campylobacters.">Prevalence of Campylobacter, Arcobacter, Helicobacter, and Sutterella spp. In human fecal samples as estimated by a reevaluation of isolation methods for Campylobacters.</a> J Clin Microbiol. 38 (1), 286-291 (2000).</li><li>Lastovica, A. J., Le Roux, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+isolation+of+campylobacteria+from+stools.">Efficient isolation of campylobacteria from stools.</a> J Clin Microbiol. 38 (7), 2798-2799 (2000).</li><li>USDA. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Salmonella+and+Campylobacter+verification+program+for+raw+poultry+products.+FSIS+Directive+10250.1.+10000+Series:+Laboratory+Services.">Salmonella and Campylobacter verification program for raw poultry products. FSIS Directive 10250.1. 10000 Series: Laboratory Services.</a> USDA. , (2021).</li><li>He, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simultaneous+detection+and+differentiation+of+Campylobacter+jejuni,+c.+Coli,+and+c.+Lari+in+chickens+using+a+multiplex+real-time+PCR+assay.">Simultaneous detection and differentiation of Campylobacter jejuni, c. Coli, and c. Lari in chickens using a multiplex real-time PCR assay.</a> Food Anal Methods. 3, 321-329 (2010).</li><li>Suo, B., He, Y., Tu, S. -. I., Shi, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+multiplex+real-time+polymerase+chain+reaction+for+simultaneous+detection+of+salmonella+spp.,+escherichia+coli+o157,+and+listeria+monocytogenes+in+meat+products.">A multiplex real-time polymerase chain reaction for simultaneous detection of salmonella spp., escherichia coli o157, and listeria monocytogenes in meat products.</a> Foodborne Pathog Dis. 7 (6), 619-628 (2010).</li><li>Chen, C. Y., Nace, G. W., Irwin, P. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+6+x+6+drop+plate+method+for+simultaneous+colony+counting+and+MPN+enumeration+of+Campylobacter+jejuni,+listeria+monocytogenes,+and+escherichia+coli.">A 6 x 6 drop plate method for simultaneous colony counting and MPN enumeration of Campylobacter jejuni, listeria monocytogenes, and escherichia coli.</a> J Microbiol Methods. 55 (2), 475-479 (2003).</li><li>Speegle, L., Miller, M. E., Backert, S., Oyarzabal, O. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+cellulose+filters+to+isolate+Campylobacter+spp.+From+naturally+contaminated+retail+broiler+meat.">Use of cellulose filters to isolate Campylobacter spp. From naturally contaminated retail broiler meat.</a> J Food Prot. 72 (12), 2592-2596 (2009).</li><li>Guirin, G. F., Brusa, V., Adriani, C. D., Leotta, G. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prevalence+of+Campylobacter+jejuni+and+Campylobacter+coli+from+broilers+at+conventional+and+kosher+abattoirs+and+retail+stores.">Prevalence of Campylobacter jejuni and Campylobacter coli from broilers at conventional and kosher abattoirs and retail stores.</a> Rev Argent Microbiol. 52 (3), 217-220 (2020).</li><li>Noormohamed, A., Fakhr, M. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+higher+prevalence+rate+of+Campylobacter+in+retail+beef+livers+compared+to+other+beef+and+pork+meat+cuts.">A higher prevalence rate of Campylobacter in retail beef livers compared to other beef and pork meat cuts.</a> Int J Environ Res Public Health. 10 (5), 2058-2068 (2013).</li><li>Walker, L. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prevalence+of+Campylobacter+coli+and+Campylobacter+jejuni+in+retail+chicken,+beef,+lamb,+and+pork+products+in+three+Australian+states.">Prevalence of Campylobacter coli and Campylobacter jejuni in retail chicken, beef, lamb, and pork products in three Australian states.</a> J Food Prot. 82 (12), 2126-2134 (2019).</li><li>Zhao, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prevalence+of+Campylobacter+spp.,+Escherichia+coli,+and+Salmonella+serovars+in+retail+chicken,+turkey,+pork,+and+beef+from+the+greater+Washington,+D.C.,+area.">Prevalence of Campylobacter spp., Escherichia coli, and Salmonella serovars in retail chicken, turkey, pork, and beef from the greater Washington, D.C., area.</a> Appl Environ Microbiol. 67 (12), 5431-5436 (2001).</li><li>Honsheng, H., Manuel Mariano, G., Guillermo, T. -. I., Saeed, E. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Campylobacter. , (2022).</li><li>He, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+identification+and+classification+of+Campylobacter+spp.+using+laser+optical+scattering+technology.">Rapid identification and classification of Campylobacter spp. using laser optical scattering technology.</a> Food Microbiol. 47, 28-35 (2015).</li><li>Steele, T. W., Mcdermott, S. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+use+of+membrane+filters+applied+directly+to+the+surface+of+agar+plates+for+the+isolation+of+Campylobacter+jejuni+from+feces.">The use of membrane filters applied directly to the surface of agar plates for the isolation of Campylobacter jejuni from feces.</a> Pathology. 16 (3), 263-265 (1984).</li><li>Bourke, B., Chan, V. L., Sherman, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Campylobacter+upsaliensis:+Waiting+in+the+wings.">Campylobacter upsaliensis: Waiting in the wings.</a> Clin Microbiol Rev. 11 (3), 440-449 (1998).</li><li>Berrang, M. E., Meinersmann, R. J., Cox, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Passage+of+Campylobacter+jejuni+and+Campylobacter+coli+subtypes+through+0.45-+and+0.65-micrometer-pore-size+nitrocellulose+filters.">Passage of Campylobacter jejuni and Campylobacter coli subtypes through 0.45- and 0.65-micrometer-pore-size nitrocellulose filters.</a> J Food Prot. 80 (12), 2029-2032 (2017).</li><li>Hill, G. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimizing+enrichment+of+Campylobacter+on+poultry.">Optimizing enrichment of Campylobacter on poultry.</a> J App Poult Res. 26 (3), 307-315 (2017).</li><li>Kim, J. C., Oh, E., Kim, J., Jeon, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+oxidative+stress+resistance+in+Campylobacter+jejuni,+a+microaerophilic+foodborne+pathogen.">Regulation of oxidative stress resistance in Campylobacter jejuni, a microaerophilic foodborne pathogen.</a> Front Microbiol. 6, 751 (2015).</li><li>Nennig, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metaphenotypes+associated+with+recurrent+genomic+lineages+of+Campylobacter+jejuni+responsible+for+human+infections+in+luxembourg.">Metaphenotypes associated with recurrent genomic lineages of Campylobacter jejuni responsible for human infections in luxembourg.</a> Front Microbiol. 13, (2022).</li><li>Moore, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+dormancy+in+Campylobacter:+Abstract+theory+or+cause+for+concern.">Bacterial dormancy in Campylobacter: Abstract theory or cause for concern.</a> Int J Food Sci Technol. 36 (6), 593-600 (2001).</li><li>Saha, S., Saha, S., Sanyal, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recovery+of+injured+Campylobacter+jejuni+cells+after+animal+passage.">Recovery of injured Campylobacter jejuni cells after animal passage.</a> Appl Environ Microbiol. 57 (11), 3388-3389 (1991).</li><li>Baylis, C. L., Macphee, S., Martin, K. W., Humphrey, T. J., Betts, R. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+three+enrichment+media+for+the+isolation+of+Campylobacter+spp.+From+foods.">Comparison of three enrichment media for the isolation of Campylobacter spp. From foods.</a> J Appl Microbiol. 89 (5), 884-891 (2000).</li><li>Line, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+a+selective+differential+agar+for+isolation+and+enumeration+of+Campylobacter+spp.">Development of a selective differential agar for isolation and enumeration of Campylobacter spp.</a> J Food Prot. 64 (11), 1711-1715 (2001).</li><li>Armstrong, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impacts+of+clarification+techniques+on+sample+constituents+and+pathogen+retention.">Impacts of clarification techniques on sample constituents and pathogen retention.</a> Foods. 8 (12), 636 (2019).</li></ol>

All the authors declare that there is no conflict of interest.

Significance of the protocol 
C. jejuni and C. coli were the two major species of Campylobacter found to be prevalent in poultry22 and animal livers23,24. In this study, the meat samples of chicken parts (legs, wings, and thighs), chicken livers, and beef livers were randomly collected during different time periods, and from different retail stores and manufacturers for the isolation of Campylobacter spp. Of the 49 total Campylobacter strains isolated, 36 were identified as C. jejuni and 13 were C. coli, with no other Campylobacter species found, which is consistent with other reports25.
The assay is based on the spiral-shaped cell morphology and characteristic corkscrew-like motility of Campylobacter spp. A simple, yet effective, passive filtration technique26,27 that exploited its spiral-shaped cell morphology (long, slender, 0.2-0.9 by 0.5-5 &#181;m) and strong corkscrew motility was used to separate Campylobacter from a mixture of background organisms. The high motility of Campylobacter allowed the cells to traverse the membrane filters and move towards favorable conditions found within the agar medium, while other background microorganisms from the meat products were unable to pass through. This method is relatively inexpensive, rapid, and selective, which makes it suitable for use in a variety of settings, including food processing facilities, clinical laboratories, and research laboratories.
A pioneering article often cited states that the 0.45 &#181;m filter worked so well that 0.65 &#181;m was not evaluated28. Results from this present study indicate the 0.65 &#181;m pore size filter performed significantly better than the 0.45 &#181;m pore size, resulting in a 29-fold increase in the number of cells recovered from the enrichment. This is important because the filters selected do not display reduced selectivity as previously reported29. Further, as it is known that filtering will significantly reduce the amount of Campylobacter recovered compared to direct plating30, therefore, increasing the size of the pore improves recovery of the microorganism, which is consistent with previously reported findings21. This is significant because all the cells that traversed the filters formed uniform Campylobacter colonies, indicating that both filters were sufficient at preventing other microflora and food particles from passing through. Additionally, the FSIS flowchart7 notes the potential for extended result production due to re-streaking isolates on Campy-Cefex plates containing antibiotics. Contrastingly, the protocol described in this manuscript, which combines the use of filtration and selective enrichment with cefoperazone, cycloheximide, trimethoprim, and vancomycin, has not necessitated re-streaking.
The current method employed is consistent with current FSIS Sampling and Verification programs17. As the level of Campylobacter contamination can be low (153 CFU/450 g chicken), the rinse is centrifuged to concentrate the sample by a factor of four, which increases the sensitivity of the assay. After concentrating the rinsate by a factor of 4x, samples are enriched for 48 h and screened with the Molecular Detection System (MDS) to replicate the method employed by FSIS laboratories (data not shown). Notably, the method described has yet to fail to identify positive strains within 24 h that were detected by the Molecular Detection System using 48 h of enrichment (data not shown). Lastly, an additional benefit of this protocol is that it can provide information related to the bacterial species and identify if the Campylobacter is C.coli, C. jejuni, or C. lari, while the MDS adopted in MLG 41.07 can only provide a binary positive/negative response for Campylobacter.
Critical steps 
The protocol for Campylobacter isolation and identification necessitates precision during centrifugation, filtration, and molecular analysis. Accurate dilutions, proper incubation conditions, and meticulous adherence to qPCR assay conditions are pivotal for reliable species identification.
As a microaerophilic bacterium, Campylobacter is very fragile and sensitive to various environmental stresses and requires unique fastidious conditions for growth31,32,33. In food samples typically undergoing lengthy periods of transportation and storage, many Campylobacter cells are perhaps in a dormancy or sublethal/lethal injured state34,35. Thus, it is important to recover the stressed cells from their food matrices and grow them to a higher concentration. In the first step of the procedure, we used Bolton Broth supplemented with laked horse blood and antibiotics for selective enrichment of Campylobacter from food. The add-in blood served as an oxygen quenching agent to overcome the adverse effects of free oxygen radicals36. The antibiotics were used to inhibit the growth of background microflora37.
To minimize the exposure time of Campylobacter to ambient atmospheric oxygen, a 15 min incubation period was selected to allow for the cells to traverse the filter. Also, the moisture of the Brucella agar plate under the filter played an important role in the rate of passage. Specifically, the results from testing agar plates dried for 0 h, 1 h, 2 h and 3 h suggested that a high moisture content in the filter prevented cells from passing through. Equally critical is the precise placement of filters and drops on the plates and filters, both influencing the success of isolating cells.
Potential pitfalls and limitations 
While presenting a structured approach for isolating and identifying Campylobacter species from raw chicken samples, several limitations of this protocol deserve attention. External contamination, insufficiently dried plates, clogging of filters impeding microbial movement, entrapment of the microorganisms within the pellet, incomplete sealing of the atmospheric chamber, and drops spreading beyond filter boundaries are among the primary pitfalls.
Inadequate separation of the microorganisms from the food surfaces or their confinement within the bulk of the sample may hinder their isolation using this method. Additionally, relying on microbial motility for traversal through passive filters presents a notable limitation; it is possible that the filter membranes retained some less motile Campylobacter strains, as it has been shown filters can reduce the capture efficiency of microbial pathogens in food38. Further limitations encompass the batch nature of centrifugation and filtration processes, susceptibility to filter clogging, and inefficiency in dispersing the pellet formed, which will impact the accuracy of microbial loads. These limitations collectively emphasize the need for caution and supplementary methodologies in ensuring comprehensive analysis, especially when dealing with varied sample types or seeking high-throughput capabilities.
Suggestions for troubleshooting 
To preempt potential issues, initially ensure that all materials adhere to the necessary quality standards and have not expired. Troubleshoot clogged filters by potentially employing an additional filtration to remove any large contaminates that may restrict the passage of the Campylobacter through the nitrocellulose membrane. If contamination is observed, verify that the drops were not placed too close to the edge of the filter and permitted liquid to reach the agar by going around the filter as opposed to through the pores. If there is insufficient growth following enrichment, verify the seals of the atmospheric containers are tight and not leaking.
Potential refinement and expansion 
Exploring alternative filter materials may enhance microbial traversal and enable this protocol to be expanded for use in isolating other motile microorganisms from heterogeneous mixtures such as food. Identifying controls to retain less motile Campylobacter variants without negatively impacting the specificity is advisable. Additionally, while the multiplexed qPCR assay utilized in this study was demonstrated to have the capabilities to detect C.lari18 other Campylobacter species of interest can be included within this assay.
In summary, through evaluating different parameters and settings, the appropriate conditions for filter-based isolation and species-level identification of C. jejuni and C. coli from food were established. The method has been demonstrated to be sensitive, specific, robust, and cost-effective. By applying it to real food samples, the protocol was able to isolate 36 C. jejuni and 13 C. coli strains from 79 meat packages.
The protocol is aligned with FSIS Directive 10,250.117, which outlines the procedure for raw chicken part sampling, and MLG 41.076 for isolation and identification of Campylobacter. The data suggests that concentrating the sample by 4x and enriching it for 24 h, coupled with filtration and plating, yields isolated, confirmed colonies within 48 h as opposed to 96 h. The protocol is compatible with DNA-based methods such as genome sequencing to provide a comprehensive characterization of Campylobacter strains, including their antimicrobial resistance profiles, virulence predictions, and phylogenetic relationships. The protocol represents a promising alternative for the efficient recovery and isolation of Campylobacter spp. from raw poultry, which can facilitate epidemiological studies and public health interventions.

Campylobacter spp. are the leading cause of bacterial foodborne gastroenteritis worldwide, with an estimated 800 million cases annually1. As a major zoonotic bacterium, Campylobacter naturally colonizes the gastrointestinal tracts of a wide range of animals, including wild birds, farm animals, and pets2. During slaughtering or food processing, Campylobacter spp. frequently contaminate carcasses or meat products3. Campylobacteriosis is usually associated with the consumption of undercooked poultry or cross-contamination of other foods by raw poultry juices2. It can cause serious complications, such as Guillain-Barr&#233; syndrome, reactive arthritis, and septicemia in immunocompromised individuals4. Detecting and isolating Campylobacter from food sources, especially poultry products, is essential for public health surveillance, outbreak investigation, and risk assessment.
Conventional culture-based methods are the traditional and standard methods for Campylobacter detection5,6. However, there are several limitations, including long incubation times (48 h or more), low sensitivity (up to 50%), and are not inclusive to all strains (some stressed Campylobacter cells may not grow well or at all in the media)7. Molecular methods, such as polymerase chain reaction (PCR), are more rapid and sensitive than culture-based methods, but they do not provide viable isolates for further characterization8,9.
Immunological methods are alternative and complementary methods for Campylobacter detection. These are rapid, simple, and versatile, but also have several limitations, including cross-reactivity (some antibodies may bind to non-Campylobacter bacteria or other substances that share similar antigens), low specificity (some antibodies may not bind to all Campylobacter strains or serotypes), and sample preparation requirements (immunological methods often require pre-treatment of the samples to remove interfering substances to enhance the binding of the antibodies)10.
Within the genus of Campylobacter, C. jejuni and C. coli cause most human Campylobacter infections (81% and 8.4%, respectively)11. Both are spiral-shaped, microaerophilic, and thermophilic bacteria containing a unipolar flagellum or bipolar flagella. Rotation of a flagellum at each pole is considered both the primary driving force for its characteristic corkscrew motility and crucial to its pathogenesis because it allows the bacterium to swim through the viscous mucosa of the host gastrointestinal tract. The motility of Campylobacter is controlled by its chemosensory system that allows the cells to move toward favorable environments12,13. Based on the cell morphology and physiological characteristics of Campylobacter, a few studies have utilized membrane filtration for the isolation of Campylobacter spp. from fecal and environmental samples14,15,16.
This study presents a rapid and robust protocol for the isolation and subsequent detection of C. jejuni and C. coli from raw meat, which overcomes the drawbacks of the existing methods and offers several advantages. Tentative colonies can be confirmed as Campylobacter spp. using a variety of methods, such as microscopy, biochemical tests (e.g., catalase and oxidase activity assays), or molecular methods6. The method identifies the isolates at the species level using a multiplex real-time PCR (mqPCR) assay that targets genes unique to C. jejuni and C. coli. This method is relatively inexpensive, rapid, and selective, which makes it suitable for use in a variety of settings, including food processing facilities, clinical laboratories, and research laboratories.

<table><tbody><tr><td>Agar - Solidifying Agent (Difco)</td><td>Becton, Dickinson and Company (BD)</td><td>281230</td><td></td></tr><tr><td>Analytical Balance</td><td>Mettler Toledo</td><td>JL602-G/L</td><td>Equipment&amp;nbsp;</td></tr><tr><td>Analytical Balance</td><td>Mettler Toledo</td><td>AB54-S</td><td>Equipment&amp;nbsp;</td></tr><tr><td>Antibiotic supplements cefoperazone, cycloheximide, trimethoprim, vancomycin</td><td>Oxoid Ltd.</td><td>SR0183E</td><td></td></tr><tr><td>Atmosphere Control Gas Pak&amp;nbsp; (Campy, 85% N&lt;sub&gt;2&lt;/sub&gt;, 10% CO&lt;sub&gt;2&lt;/sub&gt;, and 5% O&lt;sub&gt;2&lt;/sub&gt;)</td><td>Becton, Dickinson and Company (BD)</td><td>260680</td><td></td></tr><tr><td>Atmosphere Control Vessel,&amp;nbsp; GasPak EZ CampyPak container system&amp;nbsp;</td><td>Becton, Dickinson and Company (BD)</td><td>260678</td><td></td></tr><tr><td>Autoclave - Amsco Lab250, Laboratory Steam Sterilizer</td><td>Steris plc</td><td>LV-250</td><td>Equipment&amp;nbsp;</td></tr><tr><td>Biological Safety Cabinet, Type A2, Purifier Logic+</td><td>Labconco Corporation</td><td>302411101</td><td>Equipment&amp;nbsp;</td></tr><tr><td>Bolton broth&amp;nbsp;</td><td>Oxoid Ltd.</td><td>CM0983</td><td></td></tr><tr><td>Brucella broth (Difco)</td><td>Becton, Dickinson and Company (BD)</td><td>211088</td><td></td></tr><tr><td>Buffered Peptone Water</td><td>Bio-Rad Laboratories Inc.</td><td>3564684</td><td></td></tr><tr><td>Centrifuge Microcentrifuge 5424</td><td>Eppendorf</td><td>5424</td><td>Equipment</td></tr><tr><td>Centrifuge, Avanti J-25</td><td>Beckman Coulter, Inc.&amp;nbsp;</td><td></td><td>Equipment</td></tr><tr><td>Chicken thighs, wings, drumsticks, livers</td><td>Local retailers</td><td></td><td></td></tr><tr><td>DNA Extraction - PreMan Ultra Sample Preparation Reagent&amp;nbsp;</td><td>Thermo Fisher Scientific Inc.&amp;nbsp;</td><td>4318930</td><td></td></tr><tr><td>FAM probe for hipO (Sequence 5&#039;-TTGCAACCTCACTAGCAAAATCC&lt;br/&gt; ACAGCT-3&#039;)</td><td>Integrated DNA Technologies</td><td></td><td></td></tr><tr><td>Filter - 0.45 &amp;micro;m sterile cellulose acetate filter&amp;nbsp;</td><td>Merck-Millipore LTD</td><td>DAWP04700</td><td></td></tr><tr><td>Filter - 0.65 &amp;micro;m sterile cellulose acetate filter&amp;nbsp;</td><td>Merck-Millipore LTD</td><td>HAWG04700</td><td></td></tr><tr><td>forward primer for cdtA (Sequence 5&#039;-TGTCAAACAAAAAACACCAAGCT&lt;br/&gt; T-3&#039; &#039;)</td><td>Integrated DNA Technologies</td><td></td><td></td></tr><tr><td>forward primer for hipO (Sequence 5&#039;-TCCAAAATCCTCACTTGCCATT-3&#039;)</td><td>Integrated DNA Technologies</td><td></td><td></td></tr><tr><td>forward primer for IAC (Sequence 5&#039;-GGCGCGCCTAACACATCT-3&#039;)</td><td>Integrated DNA Technologies</td><td></td><td></td></tr><tr><td>HEX probe for cdtA (Sequence 5&#039;-AAAATTTCCCGCCATACCACTTG&lt;br/&gt; TCCC-3&#039;)</td><td>Integrated DNA Technologies</td><td></td><td></td></tr><tr><td>Incubator - Inova 4230 refrigerated incubator shaker</td><td>New Brunswick Scientific</td><td>4230</td><td>Equipment&amp;nbsp;</td></tr><tr><td>Inoculating Loop - Combi Loop&amp;nbsp; 10&amp;micro;L and 1&amp;micro;L&amp;nbsp;</td><td>Fisher Scientific International, Inc</td><td>22-363-602</td><td></td></tr><tr><td>Internal Amplification Control (IAC) DNA fragment (Sequence 5&#039;-TGGAAGCAATGCCAAATGTGTAT&lt;br/&gt; GTGGTGGCATTGTCTTCTCCC&lt;br/&gt; GTTGTAACTATCCACTGAGATG&lt;br/&gt; TGTTAGGCGCGCC-3&#039;)</td><td>Integrated DNA Technologies</td><td></td><td></td></tr><tr><td>Laked horse blood&amp;nbsp;</td><td>Remel Inc.</td><td>R54072</td><td></td></tr><tr><td>Manual pipette Pipet-Lite LTS Pipette L-1000XLS+</td><td>Mettler Toledo</td><td>17014382</td><td>Equipment</td></tr><tr><td>Manual pipette Pipet-Lite LTS Pipette L-100XLS+</td><td>Mettler Toledo</td><td>17014384</td><td>Equipment</td></tr><tr><td>Manual pipette Pipet-Lite LTS Pipette L-10XLS+</td><td>Mettler Toledo</td><td>17014388</td><td>Equipment</td></tr><tr><td>Manual pipette Pipet-Lite LTS Pipette L-200XLS+</td><td>Mettler Toledo</td><td>17014391</td><td>Equipment</td></tr><tr><td>Manual pipette Pipet-Lite LTS Pipette L-20XLS+</td><td>Mettler Toledo</td><td>17014392</td><td>Equipment</td></tr><tr><td>Manual pipette Pipet-Lite Multi Pipette L8-200XLS+</td><td>Mettler Toledo</td><td>17013805</td><td>Equipment</td></tr><tr><td>Manual pipette Pipet-Lite Multi Pipette L8-20XLS+</td><td>Mettler Toledo</td><td>17013803</td><td>Equipment</td></tr><tr><td>Media Storage Bottle -PYREX 1 L Square Glass&amp;nbsp; Bottle, with GL45 Screw Cap</td><td>Corning Inc.</td><td>1396-1L</td><td>Equipment</td></tr><tr><td>Media Storage Bottle -PYREX 2 L Round Wide Mouth Bottle, with GLS80 Screw Cap</td><td>Corning Inc.</td><td>1397-2L</td><td>Equipment</td></tr><tr><td>Microtiter plate, 96 well plate, flat bottom, polystyrene, 0.34 cm&lt;sup&gt;2&lt;/sup&gt;, sterile, 108/cs</td><td>MilliporeSigma</td><td>Z707902</td><td></td></tr><tr><td>Mixer - Vortex Genie 2</td><td>Scientific Industries Inc.</td><td>SI-0236</td><td>Equipment</td></tr><tr><td>Motorized pipette controller, PIPETBOY2</td><td>INTEGRA Biosciences Corp.</td><td></td><td>Equipment</td></tr><tr><td>PCR Mastermix 2&amp;times; TaqMan Gene Expression&amp;nbsp;</td><td>Thermo Fisher Scientific Inc.&amp;nbsp;</td><td>4369542</td><td></td></tr><tr><td>Petri Dish Rotator -&amp;nbsp; bioWORLD Inoculation Turntable</td><td>Fisher Scientific International, Inc</td><td>3489E20</td><td>Equipment</td></tr><tr><td>Petri Dishes with Clear Lid (100 mm x 15mm)</td><td>Fisher Scientific International, Inc</td><td>FB0875713</td><td></td></tr><tr><td>Pipette Tips GP LTS 1000&amp;micro;L S 768A/8</td><td>Mettler Toledo</td><td>&amp;nbsp;30389273</td><td></td></tr><tr><td>Pipette Tips GP LTS 20&amp;micro;L 960A/10</td><td>Mettler Toledo</td><td>30389270</td><td></td></tr><tr><td>Pipette Tips GP LTS 200&amp;micro;L F 960A/10</td><td>Mettler Toledo</td><td>30389276</td><td></td></tr><tr><td>Reagent Reservoir, 25 mL sterile reservoir used with multichannel pipettors</td><td>Thermo Fisher Scientific Inc.&amp;nbsp;</td><td>8093-11</td><td></td></tr><tr><td>Realtime PCR - 7500 Real-Time PCR system&amp;nbsp;</td><td>(Applied Biosystems, Foster City, CA)</td><td></td><td>Equipment</td></tr><tr><td>reverse primer for cdtA (Sequence 5&#039;-CCTTTGACGGCATTATCTCCTT-3&#039;)</td><td>Integrated DNA Technologies</td><td></td><td></td></tr><tr><td>reverse primer for hipO (Sequence 5&#039;-TGCACCAGTGACTATGAATAACG&lt;br/&gt; A-3&#039;)</td><td>Integrated DNA Technologies</td><td></td><td></td></tr><tr><td>reverse primer for IAC (Sequence 5&#039;-TGGAAGCAATGCCAAATGTGTA&lt;br/&gt; -3&#039;)</td><td>Integrated DNA Technologies</td><td></td><td></td></tr><tr><td>Serological Pipettes, Nunc Serological Pipettes (10 mL)</td><td>Thermo Fisher Scientific Inc.&amp;nbsp;</td><td>170356N</td><td></td></tr><tr><td>Serological Pipettes, Nunc Serological Pipettes (2 mL)</td><td>Thermo Fisher Scientific Inc.&amp;nbsp;</td><td>170372N</td><td></td></tr><tr><td>Serological Pipettes, Nunc Serological Pipettes (25 mL)</td><td>Thermo Fisher Scientific Inc.&amp;nbsp;</td><td>170357N</td><td></td></tr><tr><td>Serological Pipettes, Nunc Serological Pipettes (50 mL)</td><td>Thermo Fisher Scientific Inc.&amp;nbsp;</td><td>170376N</td><td></td></tr><tr><td>Spreader - Fisherbrand L-Shaped Cell Spreaders</td><td>Fisher Scientific International, Inc</td><td>14-665-230</td><td></td></tr><tr><td>Stomacher bag, Nasco Whirl-Pak Write-On Homogenizer Blender Filter Bags</td><td>Thermo Fisher Scientific Inc.&amp;nbsp;</td><td>01-812</td><td></td></tr><tr><td>TAMRA probe for IAC (Sequence 5&#039;-TTACAACGGGAGAAGACAATGCC&lt;br/&gt; ACCA-3&#039;)</td><td>Integrated DNA Technologies</td><td></td><td></td></tr><tr><td>Thermocycler (GeneAmp PCR system 9700)</td><td>Applied Biosystems</td><td></td><td>Equipment</td></tr><tr><td>Water Filtration - Elga Veolia Purelab Flex&amp;nbsp;</td><td>Elga LabWater</td><td>PF2XXXXM1-US</td><td>Equipment</td></tr></tbody></table>

detection and isolation of campylobacter spp. from raw meat

This article presents a rapid yet robust protocol for isolating Campylobacter spp. from raw meats, specifically focusing on Campylobacter jejuni and Campylobacter coli. The protocol builds upon established methods, ensuring compatibility with the prevailing techniques employed by regulatory bodies such as the Food and Drug Administration (FDA) and the U.S. Department of Agriculture (USDA) in the USA, as well as the International Organization for Standardization (ISO) in Europe. Central to this protocol is collecting a rinsate, which is concentrated and resuspended in Bolton Broth media containing horse blood. This medium has been proven to facilitate the recovery of stressed Campylobacter cells and reduce the required enrichment duration by 50%. The enriched samples are then transferred onto nitrocellulose membranes on brucella plates. To improve the sensitivity and specificity of the method, 0.45 &#181;m and 0.65 &#181;m pore-size filter membranes were evaluated. Data revealed a 29-fold increase in cell recovery with the 0.65 &#181;m pore-size filter compared to the 0.45 &#181;m pore-size without impacting specificity. The highly motile characteristics of Campylobacter allow cells to actively move through the membrane filters towards the agar medium, which enables effective isolation of pure Campylobacter colonies. The protocol incorporates multiplex quantitative real-time polymerase chain reaction (mqPCR) assay to identify the isolates at the species level. This molecular technique offers a reliable and efficient means of species identification. Investigations conducted over the past twelve years involving retail meats have demonstrated the ability of this method to enhance recovery of Campylobacter from naturally contaminated meat samples compared to current reference methods. Furthermore, this protocol boasts reduced preparation and processing time. As a result, it presents a promising alternative for the efficient recovery of Campylobacter from meat. Moreover, this procedure can be seamlessly integrated with DNA-based methods, facilitating rapid screening of positive samples alongside comprehensive whole-genome sequencing analysis.

Effect of moisture in Brucella agar plates for passive filtration of Campylobacter 
Campylobacter has a small genome and lacks several stress response genes commonly occurring in other bacteria, such as E. coli O157:H7 and Salmonella. Therefore, it is more sensitive to various environmental stresses and cannot tolerate dehydration or ambient oxygen levels. Conversely, an overly moist agar medium can flood the filter. This not only causes diffusion of the sample to outside the filter, but also increases exposure time to oxygen21.
To determine the appropriate conditions for filter-based isolation of Campylobacter, Brucella agar plates were dried with the lids removed for 0 h, 1 h, 2 h, and 3 h inside a biological safety cabinet and assessed for the efficiency of Campylobacter cells to traverse a 0.65 &#181;m pore-size filter. Four 20 &#181;L aliquots of C. jejuni S27 cultures at the concentrations of 1.53 x 104 and 1.53 x 105 CFU/mL were pipetted onto each filter membrane that had been placed on top of a Brucella plate. After 15 min of penetration, filters were removed, and plates were incubated overnight for cell growth.
Cells from 5 replicated plates were then counted and noted in Table 1. The results indicated that the agar plates dried for 2 h and 3 h performed similarly with nearly equal numbers of cells recovered from passive filtration. Noticeably, the plates dried under these conditions for 0 h and 1 h did not allow cells to fully traverse the membrane within the 15 min time period used.
Comparison of different pore-size filter membranes for isolating Campylobacter from chicken livers 
Considering the Campylobacter cell sizes (0.5-5 &#181;m in length and 0.2-0.9 &#181;m in width) and a wide range of food particle sizes, cellulose acetate filters with 0.45 &#181;m and 0.65 &#181;m pore sizes were tested for the efficiency of Campylobacter passage when given a 15 min incubation time. Food samples consisting of 450 g of chicken livers spiked with 153 CFU of C. jejuni and then enriched overnight were used for the experiment. As a no-filter control, direct plating of the enrichment sample was included in parallel. The results (Figure 2) from 5 replicate plates consistently showed that the 0.65 &#181;m pore size filter allowed more cells to traverse than the 0.45 &#181;m pore-size filters, resulting in increases of ~29-fold more cells obtained. The 0.45 &#181;m pore size filter retained too many cells on the upper side of the filter, resulting in a significantly lower recovery of Campylobacter from food compared to the 0.65 &#181;m pore size filter. As expected, there was a lawn of different background organisms growing on the no-filter control plates.
Application of passive filtration in Campylobacter isolation from retail chicken 
Because of the unusual motility of Campylobacter cells, the passive filtration technique was selected for the isolation of C. jejuni and C. coli from retail meat products, which are typically contaminated with numerous background organisms. Between the years 2014-2023, a total of 79 raw meat packages, including different parts of chicken meat, chicken livers, beef livers, and calf livers, were collected from various local supermarkets. From each package, 450 g was sampled for the isolation of Campylobacter spp. By combining selective enrichment of Campylobacter in blood-containing Bolton Broth and passive filtration of the cells through a 0.65 &#181;m pore size cellulose acetate filter directly onto a Brucella agar plate, 49 Campylobacter strains have been successfully isolated from 79 meat samples (Table 2). Figure 3 represents the result of isolating a new Campylobacter strain from chicken livers. The method has been repeatedly proven to be sensitive, specific, and cost-effective.
Identification and differentiation of C. jejuni and C. coli isolates 
To verify the genus and differentiate the species of Campylobacter isolates obtained from raw meat, a multiplex qPCR assay amplifying the specific gene targets (hipO and cdtA) for C. jejuni and C. coli, and an internal amplification control (IAC) was employed. The IAC was included as a false-negative indicator in the concurrent amplification of multiple genes. The assay was implemented in a 96-well format with rapid cell lysis and DNA extraction using a commercially available reagent (see Table of Materials). Table 2 summarizes the result of species identification of the C. jejuni and C. coli strains. As additional verification, whole-genome sequencing results confirmed the species of all the isolates (data not shown).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/66462/66462fig01.jpg" /> 
Figure 1: A workflow diagram for the isolation and identification of Campylobacter species from retailed meat. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/66462/66462fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/66462/66462fig02.jpg" /> 
Figure 2: The impact of filter size on recovery of Campylobacter. The results indicate that the 0.65 &#181;m filter can recover an average of 900 &#177; 138 colonies, while the 0.45 &#181;m filter recovers 31 &#177; 7 colonies. The results were generated from N = 20 (5 plates with 4 drops/plate) and a Student&#39;s t-test indicates the means are statistically different (p &#60; 0.0001). <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/66462/66462fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/66462/66462fig03.jpg" /> 
Figure 3: Isolation of Campylobacter by passive filtration of enriched poultry samples. (A) Depicts the four 20 &#181;L drops of enriched sample deposited on the nitrocellulose membrane filter. The image was collected during the 15 min of passive filtration. (B) Depicts the plate after the nitrocellulose filter was removed. The four spots indicate where the enriched sample traversed the membrane. (C) Depicts the plate following 24 h incubation. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/66462/66462fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
Table 1: The effect of the drying time of Brucella agar plates on the passive filtration of C. jejuni. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/66462/Table 1.xlsx" target="_blank">Please click here to download this Table.</a>
Table 2: C. jejuni and C. coli strainsisolated from raw meat. During the period of time ranging from 2008 to 2023, 36 C. jejuni and 13 C. coli strains were isolated from 79 meat packages across 24 unique retail products. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/66462/Table 2.xlsx" target="_blank">Please click here to download this Table.</a>
Supplemental File 1: Images throughout the isolation and enumeration processes. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/66462/Supplemental File 1.zip" target="_blank">Please click here to download this File.</a>

Watch this Scientific Journal Video about Author Spotlight: Development of an Enhanced Protocol for Rapid and Accurate Isolation of Campylobacter  from Food Products at JoVE.com

Author Spotlight: Development of an Enhanced Protocol for Rapid and Accurate Isolation of Campylobacter from Food Products

Campylobacter is the leading cause of bacterial foodborne gastroenteritis worldwide. Despite establishments enacting measures to reduce the prevalence throughout their facilities, contaminated products consistently reach consumers. The technique developed over the past twelve years addresses limitations of existing methods for isolating and detecting Campylobacter spp. from raw meat.

Detection and Isolation of Campylobacter spp. from Raw Meat

This article presents a rapid yet robust protocol for isolating Campylobacter spp. from raw meats, specifically focusing on Campylobacter jejuni and ...

detection-and-isolation-of-campylobacter-spp-from-raw-meat

Universidad de Cartagena UDEC

Research

JoVE Journal

Biology

1.7K Views.  Agricultural Research Service (ARS), United States Department of Agriculture (USDA). Campylobacter is the leading cause of bacterial foodborne gastroenteritis worldwide. Despite establishments enacting measures to reduce the prevalence throughout their facilities, contaminated products consistently reach consumers. The technique developed over the past twelve years addresses limitations of existing methods for isolating and detecting Campylobacter spp. from raw meat.

Video: Author Spotlight: Development of an Enhanced Protocol for Rapid and Accurate Isolation of Campylobacter  from Food Products

Subtyping of Campylobacter jejuni ssp. doylei Isolates Using Mass Spectrometry-based PhyloProteomics (MSPP)

MALDI-TOF MS offers the possibility to differentiate some bacteria not only at the species and subspecies level but even below, at the strain level. Allelic isoforms of the detectable biomarker ions result in isolate-specific mass shifts. Mass spectrometry-based phyloproteomics (MSPP) is a novel technique that combines the mass spectrometric detectable biomarker masses in a scheme that allows deduction of phyloproteomic relations from isolate specific mass shifts compared to a genome sequenced reference strain. The deduced amino acid sequences are then used to calculate MSPP-based dendrograms.
Here we describe the workflow of MSPP by typing a Campylobacter jejuni ssp. doylei isolate collection of seven strains. All seven strains were of human origin and multilocus sequence typing (MLST) demonstrated their genetic diversity. MSPP-typing resulted in seven different MSPP sequence types, sufficiently reflecting their phylogenetic relations.
The C. jejuni ssp. doylei MSPP scheme includes 14 different biomarker ions, mostly ribosomal proteins in the mass range of 2 to 11 kDa. MSPP can in principle, be adapted to other mass spectrometric platforms with an extended mass range. Therefore, this technique has the potential to become a useful tool for strain level microbial typing.

Subtyping of Campylobacter jejuni ssp. doylei Isolates Using Mass Spectrometry-based PhyloProteomics MSPP

Mass spectrometry-based phyloproteomics (MSPP) was used to type a collection of Campylobacter jejuni ssp. doylei isolates at the strain level in comparison to multilocus sequence typing (MLST).

MALDI-TOF MS offers the possibility to differentiate some bacteria not only at the species and subspecies level but even below, at the strain level. ...

Genetics

Detection of Foodborne Bacterial Pathogens from Individual Filth Flies

There is unanimous consensus that insects are important vectors of foodborne pathogens. However, linking insects as vectors of the pathogen causing a particular foodborne illness outbreak has been challenging. This is because insects are not being aseptically collected as part of an environmental sampling program during foodborne outbreak investigations and because there is not a standardized method to detect foodborne bacteria from individual insects. To take a step towards solving this problem, we adapted a protocol from a commercially available PCR-based system that detects foodborne pathogens from food and environmental samples, to detect foodborne pathogens from individual flies.Using this standardized protocol, we surveyed 100 wild-caught flies for the presence of Cronobacter spp., Salmonella enterica, and Listeria monocytogenes and demonstrated that it was possible to detect and further isolate these pathogens from the body surface and the alimentary canal of a single fly. Twenty-two percent of the alimentary canals and 8% of the body surfaces from collected wild flies were positive for at least one of the three foodborne pathogens. The prevalence of Cronobacter spp. on either body part of the flies was statistically higher (19%) than the prevalence of S. enterica (7%) and L.monocytogenes (4%). No false positives were observed when detecting S. enterica and L. monocytogenes using this PCR-based system because pure bacterial cultures were obtained from all PCR-positive results. However, pure Cronobacter colonies were not obtained from about 50% of PCR-positive samples, suggesting that the PCR-based detection system for this pathogen cross-reacts with other Enterobacteriaceae present among the highly complex microbiota carried by wild flies. The standardized protocol presented here will allow laboratories to detect bacterial foodborne pathogens from aseptically collected insects, thereby giving public health officials another line of evidence to find out how the food was contaminated when performing foodborne outbreak investigations.

A PCR-based protocol was adapted to detect Cronobacter spp., Salmonella enterica, and Listeria monocytogenes from body surfaces and alimentary canals of individual wild-caught flies. The goal of this protocol is to detect and isolate bacterial pathogens from individual insects collected as part of an environmental sampling program during foodborne outbreak investigations.

There is unanimous consensus that insects are important vectors of foodborne pathogens. However, linking insects as vectors of the pathogen causing a ...

Environment

Isolation of Genomic DNA from Mouse Tails

So this is a 10 day old mouse pup and I'm going to be taking a tail biopsy and then I'm going to extract genomic DNA from its tail. So what I'm gonna do is snip a little bit of its tail off, roughly about three millimeters, and then I'll place the piece of tail in an einor tube and I'll place the einor tube on dry ice. Now, to avoid contamination from one mouse to another, I usually mark the razor blade at the part in which I made the last cut.That way for the next mouse, I'll be sure to use a clean piece of razor blade for taking the next tail biopsy. In order to distinguish between the different mice in your litter, you're gonna need a way to identify the mice. One way to do that is by punching a hole in their ears using an ear hole puncher that's shown here.Gently take the mouse by the scruff of its neck like so turn it over and pinch its tail between your fingers. Take the ear hole puncture in the other hand and make a quick snip in the mouse's ear there. See how painless that was?Okay, so now you can see I've got some pieces of tail in these einor tubes and now I'm gonna add the solutions that will help them to digest. First I'm going to add 720 microliters of STE solution, and then I'm going to add 30 microliters of protein. Ace K.So here's a look at the piece of tail that we've cut prior to digestion.Now I'm gonna place the tail pieces on a 55 degree heating block. Many protocols call for continuous motion rocking at 55 degrees, but for my purposes this won't be necessary because I'll be vortexing the tail pieces. Now I'm gonna vortex the piece of tail for two seconds.One, two. So after vortexing, here's a look at what's left inside the einor tube here, and you could see that the piece of tail has been completely dissolved and activate the proteinase K at 70 degrees Celsius for five minutes. Quench on ice for five minutes.Spin down tail pieces in a micro centrifuge for 10 minutes at full speed. In this micro centrifuge, full speed is 13, 000 RPMs. While the digestive tails are spinning down, label some einor tubes fill the einor tubes with 750 microliters of isopropanol.After spinning down the digested tails, the hair and undigested material will form a pellet at the bottom of the tube decant. The solution containing the digested material, STE and proteinase K into the einor tube containing the isopropanol DNA will begin to come out of solution, will appear ghostlike and feather like, and right there swimming around that bubble is genomic DNA that's been isolated from the mouse's tail. After mixing the isopropanol and STE solution, the genomic DNA will come out of solution and it is appear as this little ball right here, spin down the precipitated genomic DNA for five minutes at full speed in a micro centrifuge.There at the bottom of the tube is a look at our pelleted genomic DNA. Now I'm going to aspirate out the solution inside the tube, leaving only the pellet of genomic DNA behind. Each time I aspirate another tube, I'll change the pipe.Pet tip on the tip of this aspirator. After aspirating away the STE and isopropanol, I'll add one milliliter of 70%ethanol to wash the genomic DNA pellet. Because the pellet of genomic DNA usually adheres to the side of a micro fuge tube and is difficult to get off to thoroughly wash it in the 70%ethanol, you'll need to rake it across the micro fuge tube rack I have here.You can do that like so. So here's a look at the genomic DNA after it's been pelleted and washed in 70%ethanol. I'm gonna spin this down again at full speed for five minutes and then aspirate away the 70%ethanol spin down the genomic DNA pellets after they've been washed.Their 70%ethanol five minutes at full speed, going to aspirate the 70%ethanol and let the DNA dry for five minutes. There's a look at the genomic DNA pellet at the bottom of the tube, and that's about as dry as you want to get it. So I've dried out the pellets of genomic DNA from the mouse tails, and now I'm gonna add a hundred microliters of 40 millimolar triss at pH eight.So I've got the genomic DNA at 50 degrees Celsius, where it will go into solution more rapidly than add room temperature. After about an hour or so at 50 degrees, I'll either freeze it or put it at four degrees until I want to run my PCR reactions to actually figure out which mice are positive for my transgene.

Isolation and Analysis of Hematopoietic Stem Cells from the Placenta

Hematopoietic stem cells (HSCs) have the ability to self-renew and generate all cell types of the blood lineages throughout the lifetime of an individual. All HSCs emerge during embryonic development, after which their pool size is maintained by self-renewing cell divisions. Identifying the anatomical origin of HSCs and the critical developmental events regulating the process of HSC development has been complicated as many anatomical sites participate during fetal hematopoiesis. Recently, we identified the placenta as a major hematopoietic organ where HSCs are generated and expanded in unique microenvironmental niches (Gekas, et al 2005, Rhodes, et al 2008). Consequently, the placenta is an important source of HSCs during their emergence and initial expansion.
In this article, we show dissection techniques for the isolation of murine placenta from E10.5 and E12.5 embryos, corresponding to the developmental stages of initiation of HSCs and the peak in the size of the HSC pool in the placenta, respectively. In addition, we present an optimized protocol for enzymatic and mechanical dissociation of placental tissue into single-cell suspension for use in flow cytometry or functional assays. We have found that use of collagenase for single-cell suspension of placenta gives sufficient yields of HSCs. An important factor affecting HSC yield from the placenta is the degree of mechanical dissociation prior to, and duration of, enzymatic treatment.
We also provide a protocol for the preparation of fixed-frozen placental tissue sections for the visualization of developing HSCs by immunohistochemistry in their precise cellular niches. As hematopoietic specific antigens are not preserved during preparation of paraffin embedded sections, we routinely use fixed frozen sections for localizing placental HSCs and progenitors.

We have identified the placenta as a major hematopoietic organ during development. We found that hematopoietic stem cells (HSCs) are both generated and expanded in the placenta in unique microenvironmental niches. Here, we describe experimental techniques required for isolation and visualization of HSCs in the mouse placenta.

Hematopoietic stem cells (HSCs) have the ability to self-renew and generate all cell types of the blood lineages throughout the lifetime of an individual. ...

Enrichment and Detection of Clostridium perfringens Toxinotypes in Retail Food Samples

Clostridium perfringens (C. perfringens) is a prolific toxin producer and causes a wide range of diseases in various hosts. C. perfringens is categorized into five different toxinotypes, A through E, based on the carriage of four major toxin genes. The prevalence and distribution of these various toxinotypes is understudied, especially their pervasiveness in American retail food. Of particular interest to us are the type B and D strains, which produce epsilon toxin, an extremely lethal toxin suggested to be the environmental trigger of multiple sclerosis in humans. To evaluate the presence of different C. perfringens toxinotypes in various food samples, we developed an easy method to selectively culture these bacteria without the use of an anaerobic container system only involving three culturing steps. Food is purchased from local grocery stores and transported to the laboratory under ambient conditions. Samples are minced and inoculated into modified rapid perfringens media (RPM) and incubated overnight at 37 &#176;C in a sealed, airtight conical tube. Overnight cultures are inoculated onto a bottom layer of solid Tryptose Sulfite Cycloserine (TSC) agar, and then overlaid with a top layer of molten TSC agar, creating a &#34;sandwiched&#34;, anaerobic environment. Agar plates are incubated overnight at 37 &#176;C and then evaluated for appearance of black, sulfite-reducing colonies. C. perfringens-suspected colonies are removed from the TSC agar using sterile eye droppers, and inoculated into RPM and sub-cultured overnight at 37 &#176;C in an airtight conical tube. DNA is extracted from the RPM subculture, and then analyzed for the presence of C. perfringens toxin genes via polymerase chain reaction (PCR). Depending on the type of food sampled, typically 15&#8211;20% of samples test positive for C. perfringens.

Enrichment and Detection of Clostridium perfringens Toxinotypes in Retail Food Samples

The objective of this protocol is to detect different Clostridium perfringens toxinotypes in locally purchased foods, particularly epsilon toxin producing strain types B and D, without the use of anaerobic chambers.

Clostridium perfringens (C. perfringens) is a prolific toxin producer and causes a wide range of diseases in various hosts. C. perfringens is categorized ...

Development of an Electrochemical DNA Biosensor to Detect a Foodborne Pathogen

Vibrio parahaemolyticus (V. parahaemolyticus) is a common foodborne pathogen that contributes to a large proportion of public health problems globally, significantly affecting the rate of human mortality and morbidity. Conventional methods for the detection of V. parahaemolyticus such as culture-based methods, immunological assays, and molecular-based methods require complicated sample handling and are time-consuming, tedious, and costly. Recently, biosensors have proven to be a promising and comprehensive detection method with the advantages of fast detection, cost-effectiveness, and practicality. This research focuses on developing a rapid method of detecting V. parahaemolyticus with high selectivity and sensitivity using the principles of DNA hybridization. In the work, characterization of synthesized polylactic acid-stabilized gold nanoparticles (PLA-AuNPs) was achieved using X-ray Diffraction (XRD), Ultraviolet-visible Spectroscopy (UV-Vis), Transmission Electron Microscopy (TEM), Field-emission Scanning Electron Microscopy (FESEM), and Cyclic Voltammetry (CV). We also carried out further testing of stability, sensitivity, and reproducibility of the PLA-AuNPs. We found that the PLA-AuNPs formed a sound structure of stabilized nanoparticles in aqueous solution. We also observed that the sensitivity improved as a result of the smaller charge transfer resistance (Rct) value and an increase of active surface area (0.41 cm2). The development of our DNA biosensor was based on modification of a screen-printed carbon electrode (SPCE) with PLA-AuNPs and using methylene blue (MB) as the redox indicator. We assessed the immobilization and hybridization events by differential pulse voltammetry (DPV). We found that complementary, non-complementary, and mismatched oligonucleotides were specifically distinguished by the fabricated biosensor. It also showed reliably sensitive detection in cross-reactivity studies against various food-borne pathogens and in the identification of V. parahaemolyticus in fresh cockles.

A protocol for the development of an electrochemical DNA biosensor comprising a polylactic acid-stabilized, gold nanoparticles-modified, screen-printed carbon electrode to detect Vibrio parahaemolyticus is presented.

Vibrio parahaemolyticus (V. parahaemolyticus) is a common foodborne pathogen that contributes to a large proportion of public health problems globally, ...

Bioengineering

Culture Methods to Determine the Limit of Detection and Survival in Transport Media of Campylobacter Jejuni in Human Fecal Specimens

A culture from human stool for diagnosis of Campylobacter-based intestinal illness takes several days, a wait that taxes the fortitude of the physician and the patient. A culture is also prone to false negative results from random loss of viability during specimen handling, overgrowth of other fecal flora, and poor growth of several pathogenic Campylobacter species on traditional media. These problems can confound clinical decisions on patient treatment and have limited the field from answering fundamental questions on Campylobacter growth and infections. We describe a procedure that estimates the lower limit of bacterial numbers that can be detected by a culture and a method for quantifying survival of C. jejuni in media used for transport of this fragile organism. Knowing this information, it becomes possible to set clinically relevant detection thresholds for diagnostic tests and address unstudied issues of whether non-symptomatic colonization is prevalent, if co-infection with other enteric pathogens is common, or if bacterial load correlates with symptoms or serious sequelae. The study also included testing of 1,552 prospectively collected patient diarrheal fecal specimens that were initially classified by conventional culture and further tested by a new enzyme immunoassay. Positive and discrepant specimens were then screened by four molecular methods to assign true-positive or true-negative status. The 5 non-culture methods showed complete agreement on all 48 positive and discrepant specimens, while the culture mis-identified 14 (28%). The specimens that were incorrectly identified by culture included 13 false negative and 1 false positive sample. This basic protocol can be used with multiple Campylobacter spp. and will allow the numbers of Campylobacter bacteria that produce symptoms of gastroenteritis in humans to be determined and for prevalence rates to be updated.

Culture Methods to Determine the Limit of Detection and Survival in Transport Media of Campylobacter Jejuni in Human Fecal Specimens

Although stool culture for Campylobacter is imprecise, it is still considered the gold standard for identification. Methods to determine the limit of detection and survival in transport media of C. jejuni in human stool are described and compared with a new immunoassay with better accuracy.

A culture from human stool for diagnosis of Campylobacter-based intestinal illness takes several days, a wait that taxes the fortitude of the physician ...

Immunology and Infection

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

A unique open reading frame (ORF) Z3276 was identified as a specific genetic marker for E. coli O157:H7. A qPCR assay was developed for detection of E. coli O157:H7 by targeting ORF Z3276. With this assay, we can detect as low as a few copies of the genome of DNA of E. coli O157:H7. The sensitivity and specificity of the assay were confirmed by intensive validation tests with a large number of E. coli O157:H7 strains (n = 369) and non-O157 strains (n = 112). Furthermore, we have combined propidium monoazide (PMA) procedure with the newly developed qPCR protocol for selective detection of live cells from dead cells. Amplification of DNA from PMA-treated dead cells was almost completely inhibited in contrast to virtually unaffected amplification of DNA from PMA-treated live cells. Additionally, the protocol has been modified and adapted to a 96-well plate format for an easy and consistent handling of a large number of samples. This method is expected to have an impact on accurate microbiological and epidemiological monitoring of food safety and environmental source.

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

A qPCR assay was developed for detection of Escherichia coli O157:H7 targeting a unique genetic marker, Z3276. The qPCR was combined with propidium monoazide (PMA) treatment for live cell detection. This protocol has been modified and adapted to a 96-well plate format for easy and consistent handling of numerous samples

A unique open reading frame (ORF) Z3276 was identified as a specific genetic marker for E. coli O157:H7. A qPCR assay was developed for detection of E. ...

Loop-Mediated Isothermal Amplification for Screening Salmonella in Animal Food and Confirming Salmonella from Culture Isolation

Loop-mediated isothermal amplification (LAMP) has emerged as a powerful nucleic acid amplification test for the rapid detection of numerous bacterial, fungal, parasitic, and viral agents. Salmonella is a bacterial pathogen of worldwide food safety concern, including food for animals. Presented here is a multi-laboratory-validated Salmonella LAMP protocol that can be used to rapidly screen animal food for the presence of Salmonella contamination and can also be used to confirm presumptive Salmonella isolates recovered from all food categories. The LAMP assay specifically targets the Salmonella invasion gene (invA) and is rapid, sensitive, and highly specific. Template DNAs are prepared from enrichment broths of animal food or pure cultures of presumptive Salmonella isolates. The LAMP reagent mixture is prepared by combining an isothermal master mix, primers, DNA template, and water. The LAMP assay runs at a constant temperature of 65 &#176;C for 30 min. Positive results are monitored via real-time fluorescence and can be detected as early as 5 min. The LAMP assay exhibits high tolerance to inhibitors in animal food or culture medium, serving as a rapid, reliable, robust, cost-effective, and user-friendly method for screening and confirming Salmonella. The LAMP method has recently been incorporated into the U.S. Food and Drug Administration&#8217;s Bacteriological Analytical Manual (BAM) Chapter 5.

Loop-Mediated Isothermal Amplification for Screening Salmonella in Animal Food and Confirming Salmonella from Culture Isolation

Loop-mediated isothermal amplification (LAMP) is an isothermal nucleic acid amplification test (iNAAT) that has attracted broad interest in the pathogen detection field. Here, we present a multi-laboratory-validated Salmonella LAMP protocol as a rapid, reliable, and robust method for screening Salmonella in animal food and confirming presumptive Salmonella from culture isolation.

Loop-mediated isothermal amplification (LAMP) has emerged as a powerful nucleic acid amplification test for the rapid detection of numerous bacterial, ...

Modified Most Probable Number Assay to Quantify Salmonella in Raw and Ready-to-Cook Chicken Products

Salmonella is a leading cause of foodborne illness in the United States, particularly in poultry products. Traditional methods for detecting Salmonella focus on prevalence rather than quantification, which limits their utility in assessing contamination levels and risks. This study introduces a novel most probable number (MPN) assay designed to quantify Salmonella in ready-to-cook poultry products, such as chicken cordon bleu. The method involves washing the poultry sample, concentrating the rinse through centrifugation, and serially diluting it in a 48-well block. The MPN assay is integrated with the loop-mediated isothermal amplification (LAMP) method to provide a sensitive, accurate, and rapid quantification of Salmonella contamination within the same timeframe as existing Food Safety and Inspection Service (FSIS) protocols. Results show a strong linear correlation between the MPN-LAMP measurements and theoretical inoculation levels (R&#178; = 0.933). However, variability at lower concentrations highlights challenges in accurately detecting Salmonella at these levels, with the practical lower limit of detection estimated at approximately 300 CFU/g. Potential refinements to improve the protocol's applicability include increasing the quantity sampled to further improve the limit of detection, optimizing enrichment media formulations, and expanding molecular detection to target multiple Salmonella serovars. Overall, this study presents a practical tool for the food industry, enabling reliable quantification of Salmonella contamination in poultry products, contributing to improved food safety and public health.

Accurately quantifying Salmonella in poultry at low levels is a current industrial and regulatory challenge. This protocol describes an MPN assay that enables quantification of Salmonella in raw and ready-to-cook poultry products. This method is fast, sensitive, and aligns with FSIS guidelines, enhancing food safety and supporting public health efforts.

Salmonella is a leading cause of foodborne illness in the United States, particularly in poultry products. Traditional methods for detecting Salmonella ...

Detection and Isolation of Campylobacter spp. from Raw Meat

Summary

Explore More Videos

Chapters in this video

Subtyping of Campylobacter jejuni ssp. doylei Isolates Using Mass Spectrometry-based PhyloProteomics (MSPP)

Detection of Foodborne Bacterial Pathogens from Individual Filth Flies

Isolation of Genomic DNA from Mouse Tails

Isolation and Analysis of Hematopoietic Stem Cells from the Placenta

Enrichment and Detection of Clostridium perfringens Toxinotypes in Retail Food Samples

Development of an Electrochemical DNA Biosensor to Detect a Foodborne Pathogen

Culture Methods to Determine the Limit of Detection and Survival in Transport Media of Campylobacter Jejuni in Human Fecal Specimens

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

Loop-Mediated Isothermal Amplification for Screening Salmonella in Animal Food and Confirming Salmonella from Culture Isolation

Modified Most Probable Number Assay to Quantify Salmonella in Raw and Ready-to-Cook Chicken Products