Research in Ansari lab was supported by the research grant (No. MCB 1020911) from National Science Foundation.

Not: Bu yöntem Medler, S ve Ansari, A. 2&#39;de bildirilen araştırma makalesinde kullanılmıştır. 1. Kültürleme ve Hasat Hücreler <ol><li> Yeni boyanmış bir Saccharomyces cerevisiae plakadan YPD ortamında (10 g / L maya ekstresi, 20 g / L pepton,% 2 dekstroz) hücre 5 ml&#39;lik bir kültürden başlatın. </li><li> 30 ° C ve 250 rpm&#39;de bir orbital çalkalayıcı içinde gece boyunca hücrelerin büyütün. </li><li> 250 mL&#39;lik bölmeli bir şişe içerisinde gece boyunca büyütülmüş kültürden YPD ortamı içinde 100 ml&#39;lik bir nihai hacme 100 kez seyreltilir. Not: kültür, 100 mL toplam TRO reaksiyon başına gerekli olan; Birden reaksiyonlar gerektiği takdirde, kültür daha büyük bir hacim kullanılmalıdır. </li><li> 0.8 bir optik yoğunluğa kadar hücreler büyümek - 1.0, 600 nm (600 ~ 0,8-1,0). </li><li> Bir steril 50 ml konik bir tüp içinde, 4 ° C&#39;de 5 dakika boyunca 820 x g&#39;de santrifüj ile hücreler hasat edilir. </li><li> buz TMN met 10 mL hücrelerin yeniden süspanseffer (10 mM Tris-HCI pH 7.5, 5 mM MgCl2, 100 mM NaCI) ve 5 dakika boyunca buz üzerinde inkübe edilir. </li><li> 4 ° C&#39;de 5 dakika boyunca 820 x g&#39;de santrifüj pelet hücreleri. Yavaşça aspirasyon ile süpernatantı kaldırmak. </li></ol> Deney çalışma üzerinde 2. permeabilizing ve hazırlanması Hücreler <ol><li> Yukarı ve aşağı pipetleme hafifçe kesilmiş bir P 1000 ucunu kullanarak% 0.6 sarkosil solüsyonu 1 ml hücrelerin tekrar. soğutulmuş bir 1.5 mL mikrosantrifüj tüpüne hücre süspansiyonu aktarın. </li><li> bir çalkalama platformunda 25 dakika boyunca 4 ° C &#39;de yavaşça hücreler çalkalayın. Not: mikrosantrifüj tüpleri bu aşamada promoteri meydana gelen yeni bir başlatma olaylarına olma olasılığı önlenmiş olur, soğuk sıcaklık korumak için buz ile 50 ml konik bir tüp içine paketlenmiş olmalıdır. </li><li> Bir masa soğutmalı santrifüj kullanılarak 4 ° C&#39;de 6 dakika boyunca 1200 x g&#39;de santrifüjleyin hücreleri. </li><li> Yavaşça per fazla suyu çıkarmak için süpernatant aspiremeabilized hücre topağı. </li></ol> 3. Transkripsiyon Run-on Tepki <ol><li> Transkripsiyon 150 mcL çalışma tampon çözelti (50 mM Tris-HCI pH 7.5, 100 mM KCI, 10 mM MgCl2, 2 mM DTT (ditiyotreitol), 0.75 mM ATP, CTP, GTP ve BrUTP, 200 U RNaz her permeabilize hücre pelletine inhibitörü). </li><li> Yukarı pipetleme ve kesik P 200 ucunu kullanarak aşağı yavaşça karıştırın. NOT: Birden fazla numune işleme, tüm numuneler hazır olana kadar buz üzerinde her şeyi tutmak ve sonra bir sonraki adıma geçin. </li><li> Bir su banyosu içinde 30 ° C&#39;de 5 dakika süreyle inkübe edilir. Not: olgunlaşmamış RNA&#39;ya BrUTP optimum dahil edilmesini sağlamak için 1 ila 5 dak arasında fırınlama süresi ayarlayın. </li><li> Soğuk hazır kullanım RNA izolasyon reaktif 500 uL ilave ederek reaksiyonu durdurun. Oda sıcaklığında 5 dakika süreyle inkübe edilir. </li></ol> 4. RNA Ekstraksiyon <ol><li> Hücre suspensi için asitle yıkanmış cam boncuklar 200 uL ekleyin(3.4 adım a) ve vorteks karıştırıcıda 4 ° C&#39;de 20 dakika boyunca kuvvetli bir şekilde çalkalanır ilgili. </li><li> Sıcak 22 G iğne kullanılarak mikrosantrifüj tüpü alt delme ve 15 ml steril konik tüp üzerine yerleştirin. </li><li> 4 ° C&#39;de 1 dakika boyunca 300 x g&#39;de santrifüjleyin hücre lizatı toplamak. 1.5 ml mikrosantrifüj tüpüne hücre lizat aktarın. </li><li> Soğuk RNA izolasyon reaktif 500 ul hücre lisatı kloroform 200 uL ekleyin. 4 ° C&#39;de 20 dakika boyunca 16.168 x g&#39;de vorteksli bir mikserde ve santrifüj içeriğini karıştırın. </li><li> Yeni bir mikrosantrifüj tüpü, üst sulu faz transfer. </li><li> pH 4-5 izoamil alkol / (: 24: 1 125), soğuk fenol / kloroform eşit hacim. 4 ° C&#39;de 15 dakika boyunca 16.168 x g&#39;de vorteksli bir mikserde ve santrifüj ile kuvvetli bir şekilde çalkalanır. </li><li> Yeni bir mikrosantrifüj tüpü, üst sulu faz ihtiva eden RNA aktarın. Adımı yineleyin 4.6 iki kez daha. </li><li> Nihai RNA içeren sulu faz için, 5 M NaCI stoc ekleme0.3 M bir son konsantrasyon RNA çökeltilmesi için 3 kez soğuk etanol hacim kazandırmak için k. <ol><li> 1 saat veya gece -20 ° C&#39;de inkübe edin. NOT: - anti-BrdU boncuklar (adım 5.3) engelleme inkübe edilirken 4.11 adımları 4.9 gerçekleştirin. </li></ol></li><li> 4 ° C&#39;de 20 dakika boyunca 16.168 x g&#39;de santrifüjleyin. Süpernatantı ve DEPC (diethylpyrocarbonate) su 100 ul RNA pelletini. </li><li> unincorporated BrUTP nükleotidlerden RNA ayırmak için bir RNA izolasyonu, mini kiti kullanın. RNaz içermeyen su, 100 uL ile kolondan RNA Zehir. </li><li> 5 dakika için 65 ° C su banyosu içinde RNA inkübe ve daha sonra en az 2 dakika süreyle buza transfer. </li></ol> BrUTP etiketli RNA 5. Affinity Arıtma <ol><li> 25 mcL anti-BrdU ekleyin, boncuk yerleşti 500 0.25X SSPE (Sodyum Salin Fosfat EDTA) bağlayıcı tampon (20x SSPE uL: 3 M NaCl, 0.2 M NaH 2 PO 4 </sub&gt;, 0.02 M EDTA, pH 7.4, 1 mM EDTA,% 0.05 Tween, 37.5 mM NaCI). 4 ° C sıcaklıkta 30 saniye boyunca 200 xg&#39;de santrifüj ve supernatant çıkarın. </li><li> Adımı yineleyin 5.1 üç kez. </li><li> tanelerine (1 mg ultra saf sığır serum albümini (BSA) tampon,% 0.1 polivinilpirolidon, 1 x bağlama) blokaj tamponu içinde 500 ul ilave edin ve yavaşça 1 çalkalayın - bir çalkalama platformunda 4 ° C&#39;de, 2 saat. </li><li> Adım 5.1&#39;de tarif edildiği gibi, bağlama tamponu, 500 uL boncuk iki kez daha yıkanır. </li><li> tanelere bağlayıcı tampon 400 ul ekle. </li><li> boncuk doğrudan (adım 4.11 itibaren) RNA 100 uL aktarın. bir çalkalama platformunda 4 ° C&#39;de 2 saat - yumuşak 1 çalkalayarak kuluçkalayın. </li><li> bağlama tamponu, 500 uL, düşük tuz tamponu 500 uL (0.2x SSPE, 1 mM EDTA,% 0.05 Tween), yüksek tuz tamponu 500 uL (0.25X SSPE, 1 mM EDTA,% 0.05 Tween ile boncuk birbiri ardına yıkandı, 100 mM NaCI) ve iki kez TET tampon 500 uL (1X TE,% 0.05 Tween), sıkma ileHer yıkama arasında 4 ° C sıcaklıkta 30 saniye boyunca 200 x g. </li><li> 150 ul iki kez sıralı boncuklardan BrUTP etiketli RNA Zehir ve bir kez yıkama tamponu (20 mM DTT, 150 mM NaCI, 50 mM Tris-HCI pH 7.5, 1 mM EDTA,% 0.1 SDS), 200 ul, inkübe edilerek süpernatandan boncuk ayırmak için kısa bir sıkma ve ardından bir su banyosu içinde 42 ° C &#39;de 4 dakika karıştırıldı. </li></ol> BrUTP Etiketli RNA 6. Yağış <ol><li> izoamil alkol / soğuk fenol / kloroform, 500 uL ekleyin (: 24: 125 1), pH 4 - 5 BrUTP saflaştınldı afinite RNA etiketli. 4 ° C&#39;de 15 dakika boyunca 16.168 x g&#39;de vorteksli bir mikserde ve santrifüj ile karıştırın. </li><li> Yeni bir mikrosantrifüj tüpü, üst sulu faz transfer. </li><li> RNA çökeltilmesi için soğuk etanol, 0.3 M 3 kez hacimli bir son konsantrasyon elde etmek için 5 M NaCI stok ekleyin. </li><li> -20 ° C sıcaklıkta gece boyunca inkübe edilir. </li><li> 4 ° C&#39;de 30 dakika boyunca 16.168 x g&#39;de santrifüje edilerek çöktürüldü RNA toplayın. &lt;/ Li&gt; <li> Süpernatantı ve 10 dakika boyunca havada kurumaya pelet izin verir. </li><li> DEPC su 26 uL RNA pelletini. </li><li> bir spektrofotometre kullanılarak 260 nm&#39;de absorbans ölçülerek son RNA konsantrasyonunun belirlenmesi. Ayrıca, 260/280 oranını belirlemek. A oranı yaklaşık 2 saf RNA numunesinin bir göstergesidir. </li><li> cDNA sentezi için gerekli olana kadar -80 ° C &#39;de parçalar halinde RNA örnekleri saklayın. </li></ol> BrUTP etiketli RNA 7. Arka Transkripsiyon <ol><li> 100 ng RNA konsantrasyonu ayarlama / uL DEPC su ile. Her cDNA sentez reaksiyonu için RNA, 0.5 ug kullanın. Not: RNA şablonu konsantrasyonunun uygun cDNA sentezi elde etmek için 0.5 ile 1.0 ug değişebilir. </li><li> Şekil 3A&#39;da gösterildiği gibi, aşağı doğru poli (A) alanı (sonlanma) tasarlanmış çok sayıda ters primerleri kullanılarak RNA nın ters transkripsiyonunu. </li><li> Her bir ters transkripsiyon reaksiyonu için RNA templat ul 5 eklemeE (0.5 ug), 1 pL dNTP karışımı (her biri 10 mM), revers primer C, D, E, F ya da G&#39;nin 2 uL (50 uM her biri) ve nükleaz serbest su (Şekil 3A). Her bir tüp içinde son reaksiyon hacmi 13 ml. Not: Ters transkripsiyon reaksiyonları sayısı cDNA sentezi için kullanılan ters primer sayısına bağlıdır. Örneğin, ASC1 beş ters primerler kullanılmıştır ve bu nedenle, beş, ters transkripsiyon reaksiyonları kurulmuştur. cDNA sentezi için kullanılan ters primer temelinde C, D, E, F ve G gibi bir tüp etiketleyin. </li><li> Herhangi bir ikincil yapısal yapıyı çıkarmak için 5 dakika boyunca 65 ° C sıcaklıkta bir PCR RNA şablonu, dNTP karışımı ve primerler ihtiva eden tüpler inkübe ve en az 2 dakika süreyle 4 ° C&#39;ye kadar soğutulur. </li><li> 1 pL transkriptazı (200 U / ml) ters ekleme, 4 ul tampon ve RNA şablon ve primer ihtiva eden her tüpe 0.1 M DTT 2 uL (7.4 adım). yukarı ve aşağı hafifçe pipetleme karıştırın. </li><li> 60 dakika boyunca 42 ° C &#39;de bir PCR reaksiyon karışımı inkübe edilerek ters transkripsiyon gerçekleştirin. </li><li> 20 dakika boyunca, 65 ° C&#39;de ters transkriptaz inaktive. </li><li> -20 ° C&#39;de cDNA Mağaza ya da bir sonraki adıma geçin. </li></ol> cDNA 8. amplifikasyonu <ol><li> Aşama 7.8, 1.0 uL ileri primer B (10 uM), 1.0 ul den 3.0 uL cDNA şablonu aşağıdaki gibidir: Aşama 7.8 (ASC1 C, D, E, F ve G etiketli) Her cDNA hazırlanması amplifikasyonu için PCR reaksiyonunu gerçekleştirmek ters primer C veya D veya E veya F veya G (10 uM), 2.5 uL 10x polimeraz PCR tamponu, 0.5 uL dNTP karışımı (10 mM), 1.0 uL MgCl2 (2.5 mM), 15.5 pL PCR dereceli su ve 0.5 uL termostabil polimeraz enzimi. Not: 5 ila 1: 1 arasında değişen bir cDNA şablonu değişik seyreltileri 100 PCR ürünü verimini optimize etmek için test edilmelidir. Tek bir promotör-yakın ileri primer cDNA yı çoğaltmak için kullanılırFarklı geri primerler kullanılarak elde edilmiştir. Örneğin, promotör yakınındaki tek ileri primer B ASC1 G C beş ters primerler ile birlikte kullanılmıştır. BC, BD, Şekil 3A&#39;da gösterildiği gibi, BF ve BG, sırasıyla C, D, E, F ve G olarak işaretlenmiş tüplere kullanılmıştır, BE. </li><li> Aşağıdaki termal döngü parametreleri kullanılarak PCR çalışması: 1 döngü 2 dakika süreyle, 95 ° C (polimeraz aktivasyonu için sıcak başlangıç), 30-40 döngü 30 saniye (cinsini değiştirme), 15 saniye için 54 ° C, 95 ° C (tavlama) 1 dakika (uzatma) ve 1 devir 5 dakika için 68 ° C (son uzatma) için 68 ° C&#39;dir. Not: bağlanma sıcaklığı kullanılan özel primerler bağlı olarak değişir ve uzatma süresi Beklenen ürün boyutuna bağlı olarak değişir. </li><li> % 0.8,% 1.5 ya da ürünün beklenen boyutuna bağlı olarak% 2 agaroz jelleri üzerinde elektroforez ile PCR ürünü ayırın. </li><li> El kaderi ve diğerleri de tarif edildiği gibi bir PCR ürünü ölçmek. 2012 11. NOT: Alternatif olarak, doğmakta olan transkript miktarını ölçmek için gerçek zamanlı RT-qPCR stratejisini kullanın. </li></ol>

<ol>
	<li>Birse, C. E., Minvielle-Sebastia, L., Lee, B. A., Keller, W., Proudfoot, N. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coupling+termination+of+transcription+to+messenger+RNA+maturation+in+yeast.">Coupling termination of transcription to messenger RNA maturation in yeast.</a> Science. 280 (5361), 298-301 (1998).</li><li>Medler, S., Ansari, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+looping+facilitates+TFIIH+kinase-mediated+termination+of+transcription.">Gene looping facilitates TFIIH kinase-mediated termination of transcription.</a> Sci Rep. 5, 12586 (2015).</li><li>Richard, P., Manley, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+termination+by+nuclear+RNA+polymerases.">Transcription termination by nuclear RNA polymerases.</a> Genes Dev. 23 (11), 1247-1269 (2009).</li><li>Mischo, H. E., Proudfoot, N. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Disengaging+polymerase:+terminating+RNA+polymerase+II+transcription+in+budding+yeast.">Disengaging polymerase: terminating RNA polymerase II transcription in budding yeast.</a> Biochim Biophys Acta. 1829 (1), 174-185 (2013).</li><li>Porrua, O., Libri, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+termination+and+the+control+of+the+transcriptome:+why,+where+and+how+to+stop.">Transcription termination and the control of the transcriptome: why, where and how to stop.</a> Nat Rev Mol Cell Biol. 16 (3), 190-202 (2015).</li><li>Jacquier, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+complex+eukaryotic+transcriptome:+unexpected+pervasive+transcription+and+novel+small+RNAs.">The complex eukaryotic transcriptome: unexpected pervasive transcription and novel small RNAs.</a> Nat Rev Genet. 10 (12), 833-844 (2009).</li><li>Xu, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bidirectional+promoters+generate+pervasive+transcription+in+yeast.">Bidirectional promoters generate pervasive transcription in yeast.</a> Nature. 457 (7232), 1033-1037 (2009).</li><li>Neil, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Widespread+bidirectional+promoters+are+the+major+source+of+cryptic+transcripts+in+yeast.">Widespread bidirectional promoters are the major source of cryptic transcripts in yeast.</a> Nature. 457 (7232), 1038-1042 (2009).</li><li>Clark, M. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+reality+of+pervasive+transcription.">The reality of pervasive transcription.</a> PLoS Biol. 9 (7), e1000625 (2011).</li><li>Goodman, A. J., Daugharthy, E. R., Kim, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pervasive+antisense+transcription+is+evolutionarily+conserved+in+budding+yeast.">Pervasive antisense transcription is evolutionarily conserved in budding yeast.</a> Mol Biol Evol. 30 (2), 409-421 (2013).</li><li>El Kaderi, B., Medler, S., Ansari, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+interactions+between+genomic+loci+through+Chromosome+Conformation+Capture+(3C).">Analysis of interactions between genomic loci through Chromosome Conformation Capture (3C).</a> Curr Protoc Cell Biol. Chapter 22, Unit22 15 (2012).</li><li>Core, L. J., Waterfall, J. J., Lis, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nascent+RNA+sequencing+reveals+widespread+pausing+and+divergent+initiation+at+human+promoters.">Nascent RNA sequencing reveals widespread pausing and divergent initiation at human promoters.</a> Science. 322 (5909), 1845-1848 (2008).</li></ol>

The authors have nothing to disclose.

Burada kullanılan iplikçik özgü TRO protokolü memeli hücrelerinde 12 Gro-Sek (Global Run On-Sıralama) analiz için kullanılan protokol uyarlanmıştır. Biz başarıyla maya tomurcuklanan doğmakta olan transkripsiyonu incelemek için protokol güncellenmiştir. Özellikle transkripsiyon sonlandırma kusur analiz etmek, biz RNA hidroliz adımı kurtularak daha protokolü ayarlanır. Bu bize özellikle promotör bölgenin yakınında transkripsiyon başlangıç ​​sitesinden başlatıla...

Ökaryotik transkripsiyon döngüsü üç ana adımdan oluşur; başlatma, uzama ve sonlanma. RNA polimeraz II transkripsiyonun sonlandırılması, iki farklı, birbirine Adım 3 oluşur. İlk adım, şablondan ayrılması, poliadenilasyonu ve mRNA&#39;nm salınmasını içerir ve hemen şablondan polimerazın ayrılma ile işaretlenmiş, ikinci aşama takip eder. Uygun sonlandırma ve RNA 4, 5 kodlayıcı olmayan yaygın transkripsiyonunu sınırlayarak kontrol anormal transkripsiyonu tutmak için aşağı genlerin transkripsiyonu müdahaleyi önlemek için, transkripsiyon başlama / yeniden başlatılması sırasında polimeraz geri dönüşümü için hayati önem taşımaktadır. Son gelişmelere rağmen, fesih RNA polimeraz II transkripsiyon döngüsü çok az anlaşılan adım olduğunu. Güvenilir bir sonlandırma tahlil mekanizmasını underlyin eğitim için gerekli olanin vivo RNA polimeraz II tarafından transkripsiyon g sonlandırma. Deneysel bir kısım yaklaşımlar, fizyolojik koşullar altında, bir aktif transkripsiyonu gen sonlandırma kusuru tespit etmek için kullanılır. Bunlar, Kuzey benek, fesih faktörü ChIP (Kromatin Immunoprecipitation) ve geleneksel TRO deneyini içerirler. Bu tekniklerin her biri bazı avantajları ve dezavantajları vardır. Kullanılan geleneksel TRO deney in vivo 1 bir transkripsiyon sonlandırma kusur tespiti için en güvenilir ve hassas bir yaklaşım olarak. Bu tahlil hücre içinde bir genin farklı bölgelerde transkripsiyonel olarak aktif polimeraz molekülleri lokalize. Normal koşullar altında, deney katı geni (Şekil 1A) promoter ve terminatör bölgesi arasında dağıtıldı transkripsiyonel kavranan polimeraz molekülleri gösterir. kusurlu sona ermesi üzerine, ancak, polimeraz sonlandırma sinyali okuyamıyorve gen (Şekil 1B) 3 &#39;ucunun alt baş bölgesinde saptanır. Bir transkripsiyon sonlandırma kusur promotör yakın bölgeden başlatılan duyu-transkripsiyon polimeraz mevcudiyetinde ortaya ve sonlandırma sinyali Okuyamamak olup, Şekil &#39;de gösterildiği gibi, bir genin 3&#39; ucunun alt baş bölgesi transkripsiyonu devam Şekil 2A. Genom ve bir genin 6, 7, 8, 9, 10 civarında ezici yaygın anlamda transkripsiyonu yanı sıra anti-sens yön gösteren gerçekleştirilmesi, yakında geleneksel TRO tahlil algılayamaz belli oldu polimeraz sinyali ise bir genin bir teşvikçinin akış aşağısına başlatılan transkript (Şekil 2A) ya da som başlatılan anormal RNA temsilbir gen ya da terminatör elemanı (Şekil 2B) ya da genin (Şekil 2C) 3 &#39;anti-sens yönünde polimeraz transkripsiyonu alt baş ortasına ewhere. gözlenen okuma domeyni polimeraz sinyal yükseltici tarafından başlatılan uzun sens mRNA veya inceleme konusu genin alt başlatılan bir anti-sens transkripti temsil ediyorsa kullanılarak BrUTP burada açıklanan şerit spesifik TRO deney ayırt edebilir. Biz başarıyla maya 2 tomurcuklanan transkripsiyon sonlandırılmasında Kin28 kinaz rolünü göstermek için bu yaklaşımı kullandık. Burada bir yaklaşımı uygulamak suretiyle Biz Rna14 maya tomurcuklanmasına ASC1 transkripsiyon sonlandırma için gerekli olduğunu göstermektedir.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Phenol -chloroform-isoamyl alcohol mixture</td>
			<td>Sigma-Aldrich</td>
			<td>77619</td>
			<td>pH 4-5</td>
		</tr>
		<tr>
			<td>TRIzol reagent</td>
			<td>Life technologies</td>
			<td>15596-026</td>
			<td></td>
		</tr>
		<tr>
			<td>RNase Inhibitor, human placenta</td>
			<td>New England Biolabs</td>
			<td>M0307S</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-BrdU beads</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-32323AC</td>
			<td></td>
		</tr>
		<tr>
			<td>Protoscript II</td>
			<td>New England Biolabs</td>
			<td>M03368L</td>
			<td>or an equivalent enzyme</td>
		</tr>
		<tr>
			<td>Advantage 2 polymerase Mix</td>
			<td>Clontech</td>
			<td>639201</td>
			<td>or an equivalent enzyme</td>
		</tr>
		<tr>
			<td>5-Bromouridine 5&#39; triphosphate sodium salt</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-214314A</td>
			<td></td>
		</tr>
		<tr>
			<td>RNeasy Mini kit</td>
			<td>Qiagen</td>
			<td>74104</td>
			<td></td>
		</tr>
		<tr>
			<td>ATP</td>
			<td>New England Biolabs</td>
			<td>N0451AA</td>
			<td></td>
		</tr>
		<tr>
			<td>CTP</td>
			<td></td>
			<td>N0454AA</td>
			<td></td>
		</tr>
		<tr>
			<td>GTP</td>
			<td></td>
			<td>N0452AA</td>
			<td></td>
		</tr>
		<tr>
			<td>Ultra-pure bovine serum albumin (BSA)</td>
			<td>MC Labs</td>
			<td>UBSA-100</td>
			<td></td>
		</tr>
		<tr>
			<td>Asc1 B</td>
			<td></td>
			<td></td>
			<td>AGATTCGTCGGTCACAAGTCC</td>
		</tr>
		<tr>
			<td>Asc1 C</td>
			<td></td>
			<td></td>
			<td>GAACTTTATACATATTCTTAGTT 
			AGCAGTC</td>
		</tr>
		<tr>
			<td>Asc1 D</td>
			<td></td>
			<td></td>
			<td>TGTACATATGTATTTTCGCAGCA</td>
		</tr>
		<tr>
			<td>Asc1 E</td>
			<td></td>
			<td></td>
			<td>GCCAAGGAGACTGAATTTAATG</td>
		</tr>
		<tr>
			<td>Asc1 F</td>
			<td></td>
			<td></td>
			<td>CTATGGAATGGGGGTTTTAAG</td>
		</tr>
		<tr>
			<td>Asc1 G</td>
			<td></td>
			<td></td>
			<td>GGTTATGGCAGACATGCCAC</td>
		</tr>
		<tr>
			<td>5s cDNA</td>
			<td></td>
			<td></td>
			<td>AGATTGCAGCACCTGAGT</td>
		</tr>
		<tr>
			<td>5&#8217; 5s reverse</td>
			<td></td>
			<td></td>
			<td>GGTTGCGGCCATATCTAC</td>
		</tr>
		<tr>
			<td>3&#8217; 5s reverse</td>
			<td></td>
			<td></td>
			<td>TGAGTTTCGCGTATGGTC</td>
		</tr>
	</tbody>
</table>

analysis of termination of transcription using brutp-strand-specific transcription run-on (tro) approach

Bu el yazması in vivo transkripsiyon sonlandırma kusuru tespit etmek için bir protokol tanımlamaktadır. kullanarak BrUTP Burada anlatılan iplikçik özgü TRO protokolü fizyolojik koşullar altında transkripsiyon sonlandırma kusuru analiz etmek için güçlü bir deneysel yaklaşımdır. Geleneksel TRO tahlilinde olduğu gibi, bir transkripsiyon sonlandırma kusuru 1 bir göstergesi olarak genin 3 &#39;ucunun ötesine, transkripsiyonal olarak aktif polimeraz varlığına dayanır. Geleneksel TRO testi ile karşılaştı iki büyük sorunlar üstesinden gelir. Birincisi, bu sonlandırma sinyalleri aracılığıyla okuma polimeraz promotör-proksimal bölgeden transkripsiyonu başlatılan biridir olmadığını algılamak, ya da basitçe bir yerde vücutta gelen non-spesifik olarak başlatılan yaygın bir transkripsiyonu polimeraz ya da 3 &#39;temsil eğer genin sonu. İkinci olarak, ayırt eğer ötesinde transkripsiyonel olarak aktif polimeraz sinyalisonlandırıcı bölge gerçek okuma domeyni sens mRNA transkripsiyonu polimeraz ya da bir terminatör başlatılan kodlayıcı olmayan anti-sens RNA sinyalidir. Kısaca, protokol, katlanarak büyüyen maya hücrelerini geçirimli afinite yaklaşımla BrUTP etiketli RNA saflaştırılması, BrUTP nükleotid mevcudiyetinde ince uzun in vivo olarak başlatılan transkript izin içerir saflaştırılmış Yeni oluşan RNA transkripsiyonu ve cDNA amplifiye kullanılarak ters promoteri ve gen 2&#39;nin sonlandırıcı bölgeleri çevreleyen tel-spesifik primerler.

Bir transkripsiyon sonlandırma kusur tespit BrUTP iplikli spesifik TRO prosedürü uygulanabilirliğini göstermek için, RNA14 bir sonlandırma arızalı, sıcaklığa duyarlı bir mutant rna14-1 adı kullanılır. RNA polimeraz II, transkripsiyon sona erdirilmesi Rna14 rolü seçilen gen 1 terminatör-proksimal bölgesinde RNA tespit geleneksel TRO tahlili kullanılarak ortaya çıkartılmıştır. Permisif olmayan sıcaklıkta rna14-1</em...

Watch this Scientific Journal Video about Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on TRO Approach at JoVE.com

Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on TRO Approach

We describe a basic experimental approach for analysis of termination of transcription by RNA polymerase II in vivo using BrUTP by the strand-specific transcription run-on (TRO) approach in budding yeast. This protocol can be extended to study transcription termination by other RNA polymerases both in yeast and higher eukaryotes.

BrUTP iplikli özgü Transkripsiyon Run-on (TRO) Yaklaşımı ile Transkripsiyon Feshi Analizi

This manuscript describes a protocol for detecting transcription termination defect in vivo. The strand-specific TRO protocol using BrUTP described here ...

analysis-termination-transcription-using-brutp-strand-specific

Universidad de Cartagena UDEC

Research

JoVE Journal

Genetics

Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on (TRO) Approach

9.8K Görüntüleme.  Wayne State University. We describe a basic experimental approach for analysis of termination of transcription by RNA polymerase II in vivo using BrUTP by the strand-specific transcription run-on (TRO) approach in budding yeast. This protocol can be extended to study transcription termination by other RNA polymerases both in yeast and higher eukaryotes. 

Video: Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on TRO Approach

In Vitro Transcription Assays and Their Application in Drug Discovery

In vitro transcription assays have been developed and widely used for many years to study the molecular mechanisms involved in transcription. This process requires multi-subunit DNA-dependent RNA polymerase (RNAP) and a series of transcription factors that act to modulate the activity of RNAP during gene expression. Sequencing gel electrophoresis of radiolabeled transcripts is used to provide detailed mechanistic information on how transcription proceeds and what parameters can affect it. In this paper we describe the protocol to study how the essential elongation factor NusA regulates transcriptional pausing, as well as a method to identify an antibacterial agent targeting transcription initiation through inhibition of RNAP holoenzyme formation. These methods can be used a as platform for the development of additional approaches to explore the mechanism of action of the transcription factors which still remain unclear, as well as new antibacterial agents targeting transcription which is an underutilized drug target in antibiotic research and development.

In Vitro Transcription Assays and Their Application in Drug Discovery

In this manuscript, we describe a protocol to functionally examine transcription and the inhibitory activity of antibacterial agents targeting bacterial transcription.

İn Vitro Transkripsiyon Tahliller ve İlaç Keşfi Onların Uygulama

In vitro transcription assays have been developed and widely used for many years to study the molecular mechanisms involved in transcription. This process ...

Genetik

Metagenomic Analysis of Silage

Metagenomics is defined as the direct analysis of deoxyribonucleic acid (DNA) purified from environmental samples and enables taxonomic identification of the microbial communities present within them. Two main metagenomic approaches exist; sequencing the 16S rRNA gene coding region, which exhibits sufficient variation between taxa for identification, and shotgun sequencing, in which genomes of the organisms that are present in the sample are analyzed and ascribed to "operational taxonomic units"; species, genera or families depending on the extent of sequencing coverage. 
In this study, shotgun sequencing was used to analyze the microbial community present in cattle silage and, coupled with a range of bioinformatics tools to quality check and filter the DNA sequence reads, perform taxonomic classification of the microbial populations present within the sampled silage, and achieve functional annotation of the sequences. These methods were employed to identify potentially harmful bacteria that existed within the silage, an indication of silage spoilage. If spoiled silage is not remediated, then upon ingestion it could be potentially fatal to the livestock.

Metagenomics was used to investigate the microbiome of silage cattle feed. Analysis was performed by shotgun sequencing. This approach was used to characterize the composition of the microbial community within the cattle feed.

Yemlerin metagenomic Analizi

Metagenomics is defined as the direct analysis of deoxyribonucleic acid (DNA) purified from environmental samples and enables taxonomic identification of ...

Analysis of the Ambient Particulate Matter-induced Chromosomal Aberrations Using an In Vitro System

Exposure to particulate matter (PM) is a major world health concern, which may damage various cellular components, including the nuclear genetic material. To assess the impact of PM on nuclear genetic integrity, structural chromosomal aberrations are scored in the metaphase spreads of mouse RAW264.7 macrophage cells. PM is collected from ambient air with a high volume total suspended particles sampler. The collected material is solubilized and filtered to retain the water-soluble, fine portion. The particles are characterized for chemical composition by nuclear magnetic resonance (NMR) spectroscopy. Different concentrations of particle suspension are added onto an in vitro culture of RAW264.7 mouse macrophages for a total exposure time of 72 hr, along with untreated control cells. At the end of exposure, the culture is treated with colcemid to arrest cells in metaphase. Cells are then harvested, treated with hypotonic solution, fixed in acetomethanol, dropped onto glass slides and finally stained with Giemsa solution. Slides are examined to assess the structural chromosomal aberrations (CAs) in metaphase spreads at 1,000X magnification using a bright-field microscope. 50 to 100 metaphase spread are scored for each treatment group. This technique is adapted for the detection of structural chromosomal aberrations (CAs), such as chromatid-type breaks, chromatid-type exchanges, acentric fragments, dicentric and ring chromosomes, double minutes, endoreduplication, and Robertsonian translocations in vitro after exposure to PM. It is a powerful method to associate a well-established cytogenetic endpoint to epigenetic alterations.

Analysis of the Ambient Particulate Matter-induced Chromosomal Aberrations Using an In Vitro System

This protocol describes techniques for the quantification and characterization of chromosomal aberrations in vitro in RAW264.7 mouse macrophages after treatment with ambient air particulate matter.

Bir Kullanarak Ortam Partikül Madde kaynaklı kromozomal anormallikler Analizi<em&gt; İn Vitro</em&gt; Sistem

Exposure to particulate matter (PM) is a major world health concern, which may damage various cellular components, including the nuclear genetic material. ...

Analysis of the c-KIT Ligand Promoter Using Chromatin Immunoprecipitation

Multiple cellular processes, including DNA replication and repair, DNA recombination, and gene expression, require interactions between proteins and DNA. Therefore, DNA-protein interactions regulate multiple physiological, pathophysiological, and biological functions, such as cell differentiation, cell proliferation, cell cycle control, chromosome stability, epigenetic gene regulation, and cell transformation. In eukaryotic cells, the DNA interacts with histone and nonhistone proteins and is condensed into chromatin. Several technical tools can be used to analyze DNA-protein interactions, such as the Electrophoresis (gel) Mobility Shift Assay (EMSA) and DNase I footprinting. However, these techniques analyze the protein-DNA interaction in vitro, not within the cellular context. Chromatin immunoprecipitation (ChIP) is a technique that captures proteins at their specific DNA binding sites, thereby allowing for the identification of DNA-protein interactions within their chromatin context. It is done by fixation&#160;of the DNA-protein interaction, followed by&#160;immunoprecipitation of the protein of interest. Subsequently, the genomic site that the protein was bound to is characterized. Here, we describe and discuss ChIP and demonstrate its analytical value for the identification of the Transforming Growth Factor-&#946; (TGF-&#946;)-induced binding of the transcription factor SMAD2 to SMAD Binding Elements (SBE) within the promoter region of the tyrosine-protein kinase Kit (c-KIT) receptor ligand Stem Cell Factor (SCF).

DNA-protein interactions are essential for multiple biological processes. During the evaluation of cellular functions, the analysis of DNA-protein interactions is indispensable for understanding gene regulation. Chromatin immunoprecipitation (ChIP) is a powerful tool to analyze such interactions in vivo.

Kromatin İmmunopresipitasyon Yöntemi Kullanılarak c-KIT Ligand Promotör Analizi

Multiple cellular processes, including DNA replication and repair, DNA recombination, and gene expression, require interactions between proteins and DNA. ...

Determination of the Optimal Chromosomal Location(s) for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach

The optimal chromosomal position(s) of a given DNA element was/were determined by transposon-mediated random insertion followed by fitness selection. In bacteria, the impact of the genetic context on the function of a genetic element can be difficult to assess. Several mechanisms, including topological effects, transcriptional interference from neighboring genes, and/or replication-associated gene dosage, may affect the function of a given genetic element. Here, we describe a method that permits the random integration of a DNA element into the chromosome of Escherichia coli and select the most favorable locations using a simple growth competition experiment. The method takes advantage of a well-described transposon-based system of random insertion, coupled with a selection of the fittest clone(s) by growth advantage, a procedure that is easily adjustable to experimental needs. The nature of the fittest clone(s) can be determined by whole-genome sequencing on a complex multi-clonal population or by easy gene walking for the rapid identification of selected clones. Here, the non-coding DNA region DARS2, which controls the initiation of chromosome replication in E. coli, was used as an example. The function of DARS2 is known to be affected by replication-associated gene dosage; the closer DARS2 gets to the origin of DNA replication, the more active it becomes. DARS2 was randomly inserted into the chromosome of a DARS2-deleted strain. The resultant clones containing individual insertions were pooled and competed against one another for hundreds of generations. Finally, the fittest clones were characterized and found to contain DARS2 inserted in close proximity to the original DARS2 location.

Determination of the Optimal Chromosomal Locations for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach

Here, the power of a transposon-mediated random insertion of a non-coding DNA element was used to resolve its optimal chromosomal position.

En iyi kromozom Location(s) belirlenmesi için yeni bir Transposon-aracılı yaklaşımın kullanarak Escherichia coli DNA öğesinde

The optimal chromosomal position(s) of a given DNA element was/were determined by transposon-mediated random insertion followed by fitness selection. In ...

Real-time Analysis of Transcription Factor Binding, Transcription, Translation, and Turnover to Display Global Events During Cellular Activation

Upon activation, cells rapidly change their functional programs and, thereby, their gene expression profile. Massive changes in gene expression occur, for example, during cellular differentiation, morphogenesis, and functional stimulation (such as activation of immune cells), or after exposure to drugs and other factors from the local environment. Depending on the stimulus and cell type, these changes occur rapidly and at any possible level of gene regulation. Displaying all molecular processes of a responding cell to a certain type of stimulus/drug is one of the hardest tasks in molecular biology. Here, we describe a protocol that enables the simultaneous analysis of multiple layers of gene regulation. We compare, in particular, transcription factor binding (Chromatin-immunoprecipitation-sequencing (ChIP-seq)), de novo transcription (4-thiouridine-sequencing (4sU-seq)), mRNA processing, and turnover as well as translation (ribosome profiling). By combining these methods, it is possible to display a detailed and genome-wide course of action.
Sequencing newly transcribed RNA is especially recommended when analyzing rapidly adapting or changing systems, since this depicts the transcriptional activity of all genes during the time of 4sU exposure (irrespective of whether they are up- or downregulated). The combinatorial use of total RNA-seq and ribosome profiling additionally allows the calculation of RNA turnover and translation rates. Bioinformatic analysis of high-throughput sequencing results allows for many means for analysis and interpretation of the data. The generated data also enables tracking co-transcriptional and alternative splicing, just to mention a few possible outcomes.
The combined approach described here can be applied for different model organisms or cell types, including primary cells. Furthermore, we provide detailed protocols for each method used, including quality controls, and discuss potential problems and pitfalls.

This protocol describes the combinatorial use of ChIP-seq, 4sU-seq, total RNA-seq, and ribosome profiling for cell lines and primary cells. It enables tracking changes in transcription-factor binding, de novo transcription, RNA processing, turnover and translation over time, and displaying the overall course of events in activated and/or rapidly changing cells.

Gerçek zamanlı analiz bağlama, transkripsiyon, çeviri ve ciro hücresel etkinleştirme sırasında küresel olayları görüntülemek üzere transkripsiyon faktörü

Upon activation, cells rapidly change their functional programs and, thereby, their gene expression profile. Massive changes in gene expression occur, for ...

Genome-wide Surveillance of Transcription Errors in Eukaryotic Organisms

Accurate transcription is required for the faithful expression of genetic information. Surprisingly though, little is known about the mechanisms that control the fidelity of transcription. To fill this gap in scientific knowledge, we recently optimized the circle-sequencing assay to detect transcription errors throughout the transcriptome of Saccharomyces cerevisiae, Drosophila melanogaster, and Caenorhabditis elegans. This protocol will provide researchers with a powerful new tool to map the landscape of transcription errors in eukaryotic cells so that the mechanisms that control the fidelity of transcription can be elucidated in unprecedented detail.

This protocol provides researchers with a new tool to monitor the fidelity of transcription in multiple model organisms.

Ökaryotlarda transkripsiyon hataları genom çapında gözetim

Accurate transcription is required for the faithful expression of genetic information. Surprisingly though, little is known about the mechanisms that ...

A Novel Saturation Mutagenesis Approach: Single Step Characterization of Regulatory Protein Binding Sites in RNA Using Phosphorothioates

Gene regulation plays an important role in development. Numerous DNA- and RNA-binding proteins bind their target sequences with high specificity to control gene expression. These regulatory proteins control gene expression either at the level of DNA (transcription) or at the level of RNA (pre-mRNA splicing, polyadenylation, mRNA transport, decay, and translation). Identification of regulatory sequences helps understand not only how a gene is switched on or off, but also which downstream genes are regulated by a particular regulatory protein. Here, we describe a one-step approach that allows saturation mutagenesis of a protein binding site in RNA. It involves doping DNA template with non-wild-type nucleotides within the binding site, synthesis of separate RNAs with each phosphorothioate nucleotide, and isolation of the bound fraction following incubation with protein. Interference from non-wild-type nucleotides results in their preferential exclusion from the protein-bound fraction. This is monitored by gel electrophoresis following selective chemical cleavage with iodine of phosphodiester bonds containing phosphorothioates (phosphorothioate mutagenesis or PTM). This single-step saturation mutagenesis approach is applicable to the characterization of any protein binding site in RNA.

Proteins that bind specific RNA sequences play critical roles in gene expression. Detailed characterization of these binding sites is crucial for our understanding of gene regulation. Here, a single-step approach for saturation mutagenesis of protein-binding sites in RNA is described. This approach is relevant for all protein-binding sites in RNA.

Bir roman doygunluk Mutagenesis yaklaşım: Tek adım karakterizasyonu düzenleyici protein RNA Phosphorothioates kullanarak siteleri bağlama

Gene regulation plays an important role in development. Numerous DNA- and RNA-binding proteins bind their target sequences with high specificity to ...

Reverse Transcription-Loop-mediated Isothermal Amplification (RT-LAMP) Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples

Infection with Zika virus (ZIKV) can be asymptomatic in adults, however, infection during pregnancy can lead to miscarriage and severe neurological birth defects. The goal of this protocol is to quickly detect ZIKV in both human and mosquito samples. The current gold standard for ZIKV detection is quantitative reverse transcription PCR (qRT-PCR); reverse transcription loop-mediated isothermal amplification (RT-LAMP) may allow for a more efficient and low-cost testing without the need for expensive equipment. In this study, RT-LAMP is used for ZIKV detection in various biological samples within 30 min, without first isolating the RNA from the sample. This technique is demonstrated using ZIKV infected patient urine and serum, and infected mosquito samples. 18S ribosomal ribonucleic acid and actin are used as controls in human and mosquito samples, respectively.

Reverse Transcription-Loop-mediated Isothermal Amplification RT-LAMP Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples

This protocol provides an efficient and low-cost method to detect Zika virus or control targets in human urine and serum samples or in mosquitoes by reverse transcription loop-mediated isothermal amplification (RT-LAMP). This method does not require RNA isolation and can be done within 30 min.

İzotermal amplifikasyon (RT-lamba) transkripsiyon-Loop-aracılı tahlil Zika virüs ve Housekeeping genler idrar, Serum ve sivrisinek örnekleri için ters

Infection with Zika virus (ZIKV) can be asymptomatic in adults, however, infection during pregnancy can lead to miscarriage and severe neurological birth ...

Determining 3'-Termini and Sequences of Nascent Single-Stranded Viral DNA Molecules during HIV-1 Reverse Transcription in Infected Cells

Monitoring of nucleic acid intermediates during virus replication provides insights into the effects and mechanisms of action of antiviral compounds and host cell proteins on viral DNA synthesis. Here we address the lack of a cell-based, high-coverage, and high-resolution assay that is capable of defining retroviral reverse transcription intermediates within the physiological context of virus infection. The described method captures the 3'-termini of nascent complementary DNA (cDNA) molecules within HIV-1 infected cells at single nucleotide resolution. The protocol involves harvesting of whole cell DNA, targeted enrichment of viral DNA via hybrid capture, adaptor ligation, size fractionation by gel purification, PCR amplification, deep sequencing, and data analysis. A key step is the efficient and unbiased ligation of adaptor molecules to open 3'-DNA termini. Application of the described method determines the abundance of reverse transcripts of each particular length in a given sample. It also provides information about the (internal) sequence variation in reverse transcripts and thereby any potential mutations. In general, the assay is suitable for any questions relating to DNA 3'-extension, provided that the template sequence is known.

Here we present a deep sequencing approach that provides an unbiased determination of nascent 3&#39;-termini as well as mutational profiles of single-stranded DNA molecules. The main application is the characterization of nascent retroviral complementary DNAs (cDNAs), the intermediates generated during the process of retroviral reverse transcription.

Ters transkripsiyon enfekte hücreleri içinde belirleyici 3'-Termini ve HIV-1 sırasında doğmakta olan tek iplikçikli Viral DNA moleküllerinin dizileri

Monitoring of nucleic acid intermediates during virus replication provides insights into the effects and mechanisms of action of antiviral compounds and ...