Yazarlar Novo Nordisk Vakfı, Lundbeck Vakfı ve Danimarka Ulusal Araştırma Vakfı (DNRF120) Merkezi aracılığıyla gelen hibe tarafından bakteriyel stres tepkisi ve sebat (BASP) için finanse edilmiştir.

1. Transposon Kütüphane koleksiyonu Not: kromozom DARS2 odağı mini Tn 10 klonlanmış-transposon, NKBOR (pNKBOR üzerinde) 21 sonuçlanan, temel NKBOR:: DARS2 (pJFM1). pNKBOR online 22 elde edilebilir. pNKBOR çoğaltma 23 için başlatıcı protein π gerektirir bir intihar R6K tabanlı vektörü olduğu. Plazmid pJFM1 bu nedenle pir geni kromozom bir kopyasını içeren bir E. coli zorlanma içinde (Örneğin, Dh5α λ pir) çoğaltabilir. Ne zaman pJFM1 Pir-eksik wildtype MG1655 aktarılır, ancak, pJFM1, sefaloridin dayanıklı klonlar NKBOR rasgele eklemeleri tarafından oluşturulan seçim için önde gelen çoğaltamaz:: DARS2 bakteriyel kromozom içine. Kolaylık olması için bunlar DARS2 eklemeleri adlandırılır. Metodoloji şematik bir sunum için bkz: şekil 1.
<ol><li>Etkin bir şekilde büyümesini DARS2 hazırla electrocompetent MG1655 Δ hücreleri içinde 37 ° C 24, yetiştirilen Lysogeny suyu (LB).</li>
	<li>Electroporate pJFM1 electrocompetent MG1655 Δ içine DARS2, göre Gonzales vd. 24 <ol><li>(içinde su 1 µL) pJFM1 40 eklemek 1 µg µL electrocompetent E. coli MG1655 Δ, DARS2 ve bu karışım önceden soğutulmuş, steril 0,2 cm boşluk küvet için transfer. Küvet elektroporasyon odanın içine yerleştirin. Electroporate 18 kV, 500 Ω ve 25 µF; Saat sabit ~5.0 ms olmalıdır ve hiçbir arcing olmamalıdır.</li>
		<li>Bakteriyel süspansiyon Önceden ısıtılmış LB suyu ve 15 mL tüp bebek transfer 1 ml resuspending tarafından hızlı bir şekilde kurtarmak.</li>
		<li>İçin antibiyotik seçimi olmadan 30 dk 37 ° C'de gaz büyüme koşullar altında kuluçka kurtarmak hücreleri izin. Bakteri 50µg/mL sefaloridin ile desteklenmiş LB Ağar kaplamalar üzerine plaka ve 37 ° C'de gecede kuluçkaya.</li>
	</ol></li> <li>Kimden adım kolonileri saymak: bir koloni olarak kabul edilir bir kromozom transposon ekleme için eşit. 
	Not: Kolonileri göz veya bir koloni sayaç ile sayılabilir. Koloniler her klon kromozom içinde bulunan Transpozonlar ayıran ortalama mesafe ters orantılı numarasıdır.</li>
	<li>Ekleyin 1 mL LB suyu her plaka ve tüm kolonileri yıkayın; 1 mL LB suyu ~ 100.000 kolonileri yıkamak için yeterli olmalıdır. Aynı 1 mL LB suyu bakteri konsantrasyonu artırmak için yeniden kullanın. Aynı 50 mL tüp bütün kolonilerde havuz.</li>
	<li>Girdap tüp ve başlangıç malzeme dondurma (t = 0). Onu dondurmak için hücre süspansiyon 1 mL 1 mL % 50 gliserol buzda karıştırın. Tüplere 10 min için Buz Makinası aktarın. Kültürler dondurulur sonra onları bir-80 ° C dondurucu transfer. 
	Not: Bu adımda bir hücre konsantrasyonu en az 50.000 CFU/mL bekleniyor.</li>
</ol> 2. LB deneyde rekabet <ol><li>tezcan-80 ° C buz transposon kitaplığından. Pipetting tarafından Mix.</li>
	<li>Transfer 100 µL 15 mL tüp 10 mL lb için transposon Kütüphanesi.</li>
	<li>37 ° c durağan faz ile 8 h için sürekli (250 d/d), sallayarak gazlı hücreleri büyümek (Yani, OD 600 ~ 4.0 =). Bu parametreler farklı büyüme koşullarına, istediğiniz gibi ayarlayın.</li>
	<li>Bakteriyel nüfus her ~ 10 nesiller tarafından sürekli transferler taze prewarmed orta içine yayın. Bunu önceki durağan faz kültürünün 10 µL 10 mL taze lb aktarıp, durağan faz için başka bir 8 h büyüyen yapmak (Yani, OD 600 ~ 4.0 =). 
	Not: aynı başlangıç ve bitiş optik yoğunluk olduğu gibi 1000 kat seyreltme için ~ 10 nesil büyüme karşılık gelen (2 10 1024 =). Bakteriyel nüfus doğrudan taze prewarmed orta yayılır veya 0-4'te kaydedilen ° C (buzda) ve ertesi gün yayılır. LB burada kısa bir süre (22 dk yakın bir katlama zaman) olabildiğince çok hücresel doublings içinde emin olmak için kullanıldı.</li>
	<li>Kurtarmak rekabetin her 100 nesiller sonra beş 1 mL örnek-80 ° c (3.3 adımda anlatıldığı gibi).</li>
	<li>Bireysel transposon eklemeler içeren hücreler arasındaki fitness farklar küçük olması bekleniyor, yarışma süresi uzun; burada, 700 nesiller tutmak (t 700 =) kullanıldı.</li>
</ol> 3. Güney leke yere rekabet deney zaman izlemek için analiz <ol><li>sonda Güney için belirli primerler kullanılarak Polimeraz zincir reaksiyonu (PCR) amplifikasyon gerçekleştirerek leke (NKBOR bölümünde 1-kb) hazırlamak: NKBOR_Probe_FW : gatgttggacgagtcggaat ve NKBOR_Probe_RV: cgttacatccctggcttgtt.
	<ol><li>Incubate 30 98 ° C'de s ilk denatürasyon için. Sonra 10 için 98 ° C'de 35 döngü gerçekleştirin s, 30 60 ° C s ve 45 72 ° C s. Son uzantısı için 10 dk. 72 ° C kullanın 
		Not: Şablon PCR reaksiyon için saf pNKBOR plazmid 21 oldu.</li>
		<li>Sonuç PCR parçası rasgele astar sistemi kullanarak [α - 32 P] dATP ile Smith 25 göre etiketlemek.</li>
	</ol></li> <li>Løbner-Olesen ve von Freiesleben 26 göre toplam hücresel DNA t için hazırlamak kadar t = 0 ve seçili zaman Puan nesiller rekabet tahmini 700 =.</li>
	<li>ben bu ilgi bir kez sadece bir bölge bölge içeren değil NKBOR kesim yoklama ile kaplı Pvu ile toplam hücresel DNA sindirmek; 1 adet Pvu ben kullanılabilir için tamamen µg Özet 1, substrat DNA'sı. 
	Not: Sonda ile birlikte ekleme sitesi bağlı olarak çeşitli uzunlukları kromozom DNA transposon içeren parçaları tanıyacak.</li>
	<li>Løbner-Olesen ve von Freiesleben 26 göre % 0.7 özel jel kullanarak bir Southern blot gerçekleştirmek.</li>
</ol> 4. Kimlik Fittest klon <ol><li>kullanımı kolay gen yürümeye, Harrison ve ark. tarafından açıklandığı gibi DARS2 ekleme sitelerinden tek klonlar (LB Tabaklarda izole) rekabet 700 tahmini nesiller sonra tanımlamak için 27, daha fazla grup Güney leke daha fazla yalıtır tüm transposon eklemeleri karşılamak için gerekli.
	<ol><li>İzole etmek genomik DNA PCR şablonu için. 50 µg/mL sefaloridin içeren LB agar plaka üzerinde bakteri yaymak ve 37 ° C'de gecede kuluçkaya. Tek kolonilerde gecede LB suyu 37 ° C'de büyümek ve daha sonra 20 µL distile su autoclaved 200 µL aktarmak (veya DNA arıtma, adım 3.2 olduğu gibi kullanın).
		<ol><li>Girdap karıştırmak için. 10 min ve max hızda santrifüj 5 dakika süreyle hücre lysate-20 ° c ileride kullanmak üzere kaydetmek için mix 100 ° c ısı.</li>
		</ol></li> <li>Seçim transposon içinde tavlamak için üç iç içe astar tasarım (PCR strateji grafik gösterimi için bkz: Şekil 2). 
		Not: İç içe astar tasarımı iç içe astar 3 bilinen 5'e yakın yatıyor sağlamalıdır &#39; ardından iç içe astar 2 ve 1 transposon DNA, sonu. İç içe astar 3 ile 5 arasındaki boşluğu &#39; bilinen t sonuransposon DNA (belirli kromozom transposon ekleme site bulmak için) bilinmeyen DNA için bilinen DNA bir sıra okuma yoluyla için yeterli olmalıdır. NKBOR için aşağıdaki iç içe astar kullanılmıştır: pNKBOR_Nested3_RV: gcagggctttattgattcca, pNKBOR_Nested2_RV: tcagcaacaccttcttcacg ve pNKBOR_Nested1_RV: actttctggctggatgatgg. Bilinen enzimleri tanıma siteleri içeren rasgele Astar boyaları da kullanılır. Bir sonuç sağlamak için en az iki farklı rasgele astar kullanmanız gerekir. Kısıtlama siteleri enzimleri (e.g.,Sau 3AI ve Hin DIII) için saat 3'te bulunacağını &#39; sonu ve on rasgele bazlar tarafından bu kadar öncesinde 5 &#39; - NNNNNNNNNNGATC - 3 &#39; ve 5 &#39; - NNNNNNNNNNAAGCTT - 3 &#39; astar vardır Sau 3AI sitesi (GATC) ve Hin DIII sitesi (AAGCTT), sırasıyla içeren nerede N = A, T, G veya C.</li>
		<li>Kullanım 200 ng genomik DNA bir 20 µL PCR reaksiyon. 30 98 ° C'de kuluçkaya s ilk denatürasyon için. 25 döngüleri 98 ° C'de 30 için gerçekleştirmek s, 50 ° C 15 s ve 72 ° C 4 dk için. Son uzantısı için 72 ° C için 10 dk. kullanım astar çiftleri oluşan iç içe astar 1 ve rasgele astar birini kullanın.</li>
		<li>Oluşan iç içe astar 2 ve ikinci amplifikasyon üzerinden aynı rasgele astar astar çiftleri onun önceki tepki 1 µL şablon olarak kullanıp kullanın.</li>
		<li>Tekrarlama adım 4.1.4 oluşan iç içe astar 3 ve aynı rasgele astar astar çiftleriyle.</li>
		<li>Ürünleri son PCR reaksiyon gelen % 1.5 özel jel ve leke etidyum bromür ile çalıştırın. Kesip bir bant aralığı 100-800 bp ve herhangi bir ticari DNA jel seti üreticiye göre açılan kullanarak DNA izole &#39; yönünde. DNA içinde su 15 µL resuspend. 
		Not: dikkat. Etidyum bromür toksik ve bakımı ile ele alınması gerekir.</li>
		<li>Önceki adımda (Adım 4.1.6), iç içe astar 3 Sanger kullanarak sıralama astar, izole bant sıra ticari sağlayıcısındaki sıralama.</li>
	</ol></li> <li>WGS gerçekleştirmek.
	<ol><li>Gerçekleştirmek WGS DNA çıkarılan toplam Seçili yarışma deneme sırasında toplanan örnekleri Frimodt-Møller ve ark 4 tarafından açıklandığı gibi.</li>
	</ol></li> <li>Sıralama çözümlemesi yapma.
	<ol><li>Hizala eşleştirilmiş uç okur 150 Ns NKBOR, AF310136.1 1,904 bitişik &#8230; tohum alt dizeleri (S, 1, 1,15) ve belirsiz karakter (L, 0, 0,9) en fazla sayısı arasında bir süre ile Bowtie2 28 kullanarak 2,204.</li>
		<li>Hizalanmış okuma seçin ve her iki MG1655 ref yeniden hizalamak | NC_000913.3 ve NKBOR gb | AF310136 blastN 29 kullanarak</li> <li>transpozisyonu kavşak MG1655-NKBOR ekleme pozisyonlarında atama.</li>
	</ol></li></ol> 5. Akış Sitometresi <ol><li>toplamak için Akış Sitometresi örneği.
	En az 10 nesiller için üstel büyüme aşamasında Bakımı tarafından <ol><li>denge her kültür. OD 600 kontrol edin ve asla 0,3 aştığını olun.</li>
		<li>İki tür akış örnekleri toplamak.
		<ol><li>Gezinti RIF-boşluğu, kültür 1 mL 30 µL RIF-CEF (300 µg/mL Rifampisin ve 36 µg/mL sefaleksin 12,5 mM NaOH çözünmüş) içeren bir 15 mL tüp aktarın. Sallayarak 4 h en az 37 ° C'de bırakın. 
			Not: Rifampisin dolaylı olarak kromozom çoğaltma çoğaltma devam eden tur için fesih için devam etmek için izin verirken başlatılmasını engeller. Sefaleksin çoğaltma gezinti boşluğu (RIF gezinti boşluğu) ve tam olarak çoğaltılmış kromozom içeren hücreleri birikimi hücre bölünmesini önler. Tam olarak çoğaltılmış kromozom sayısı Rifampisin ve sefaleksin 20 ile tedavi esnasında kökenleri sayıya eşittir.</li>
			<li>EXP-örnek, transfer katlanarak büyüyen kültür buz bir 1.5 mL tüp için 1 mL için</li>
		</ol></li></ol></li> <li>Hücreleri aşağıdaki gibi düzeltin. 15.000 x g 5 min için de aralıklarla 4 tarafından hücreleri hasat ° C. Pelet buz gibi 10 mM Tris pH 7.5 100 µL içinde Resuspend ve buz gibi % 77 etanol 1 mL ekleyin. 4 ° C'de örnekleri kullanmak kadar saklamak.</li>
	<li>Hücreleri aşağıdaki gibi leke. 15.000 x g 15 dk. çıkarmak için de Santrifüjü tarafından 100-300 µL sabit hücre süpernatant hasat ve Pelet 130 µL resuspend &#34; çözüm DNA boyama &#34; (90 µg/mL mithramycin, 20 µg/mL arasında etidyum bromür, 10 mM MgCl 2 ve 10 mM Tris pH 7.5). Örnekleri buz ve karanlıkta koymak; örnekleri 10 dk. sonra Akış Sitometresi Analizi için hazır 
	Not: Diğer DNA etidyum bromür lekeleri ve mithramycin de kullanılan 30 , 31 olabilir.</li>
	<li>Kökenli başına hücre, göreli hücre kütlesi ve göreli DNA içeriği Akış Sitometresi Analizi ile belirlemek.
	<ol><li>Gerçekleştir Akış Sitometresi, 32 daha önce açıklandığı gibi. RIF gezinti boşluğu ve EXP-Akış Sitometresi üretici kullanarak örnekleri çalıştırmak &#39; s talimatları . Mithramycin - ve etidyum bromür lekeli hücrelerin uyarma dalga boylarında 395 ve 440 nm kullanın ve floresan 565 yukarıda toplamak nm.
		Mutlak ve göreceli kitle ve göreli DNA içeriği, belirlemek çalıştırmak için tek parametreli ileri-ışık saçılma karşı hücre sayı çubuk grafikler ve hücre sayı çubuk grafikler en az 30.000 olayların karşı floresan yoğunluğu elde etmek için EXP örnekleri <ol><li> hücre sinyal için karşılık gelen.</li>
			<li>Ortalama göreli ölçmek için kullanım ileri dağınık ışık tek parametre dağıtım hücre Mass 
			Not: İleri dağınık ışık ortalama hücre kitle 20 ölçüsüdür.</li>
			<li>Kullanım floresan yoğunluğu tek parametreli dağıtımları ortalama DNA ölçmek için içerik 20.</li>
			<li>Ortalama DNA içeriği ortalama hücre kitle 20 DNA konsantrasyon oranı olarak elde edilir.</li>
		</ol></li> <li>Kökenleri hücre başına sayısını belirleyin.
		<ol><li>Karşı tek parametreli floresan yoğunluğu elde etmek için Çalıştır RIF gezinti boşluğu örnekleri en az 30.000 olayların hücre sinyal için karşılık gelen sayı çubuk grafikler hücre.</li>
			<li>Kullanım floresan yoğunluğu tek parametreli dağılımları her kromozom sayısını belirlemek için hücre 20.</li>
		</ol></li></ol></li> <li>Eşzamansız Endeksi (AI) hesaplanır.
	<ol><li>Hesaplama Løbner-Olesen vd tarafından açıklandığı gibi Ai 32 RIF gezinti boşluğu örnekleri ve formül AI floresan yoğunluğu tek parametre dağılımları kullanarak, = (f3 + f5 + f6 + f7) / (f2 + f4 + f8), fx x tam olarak çoğaltılmış kromozom sayısı kesir hücrelerle nerede. Girişimlerine ne zaman zaman uyumsuz düşünün A &#62; 0,1.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Frimodt-Moller, J., Charbon, G., Lobner-Olesen, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Control+of+bacterial+chromosome+replication+by+non-coding+regions+outside+the+origin.">Control of bacterial chromosome replication by non-coding regions outside the origin.</a> Curr Genet. , (2016).</li><li>Sherratt, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recombination+and+chromosome+segregation.">Recombination and chromosome segregation.</a> Philos Trans R Soc Lond B Biol Sci. 359 (1441), 61-69 (2004).</li><li>Bigot, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+motifs+that+control+E.+coli+chromosome+segregation+by+orienting+the+FtsK+translocase.">DNA motifs that control E. coli chromosome segregation by orienting the FtsK translocase.</a> EMBO J. 24 (21), 3770-3780 (2005).</li><li>Frimodt-Moller, J., Charbon, G., Krogfelt, K. A., Lobner-Olesen, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+Replication+Control+Is+Linked+to+Genomic+Positioning+of+Control+Regions+in+Escherichia+coli.">DNA Replication Control Is Linked to Genomic Positioning of Control Regions in Escherichia coli.</a> PLoS Genet. 12 (9), 1006286 (2016).</li><li>Kornberg, A., Baker, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> DNA Replication, Second Edition. , (1992).</li><li>Kaguni, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Replication+initiation+at+the+Escherichia+coli+chromosomal+origin.">Replication initiation at the Escherichia coli chromosomal origin.</a> Curr Opin Chem Biol. 15 (5), 606-613 (2011).</li><li>Leonard, A. C., Grimwade, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+DnaA+assembly+and+activity:+taking+directions+from+the+genome.">Regulation of DnaA assembly and activity: taking directions from the genome.</a> Annu Rev Microbiol. 65, 19-35 (2011).</li><li>Kurokawa, K., Nishida, S., Emoto, A., Sekimizu, K., Katayama, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Replication+cycle-coordinated+change+of+the+adenine+nucleotide-bound+forms+of+DnaA+protein+in+Escherichia+coli.">Replication cycle-coordinated change of the adenine nucleotide-bound forms of DnaA protein in Escherichia coli.</a> EMBO J. 18 (23), 6642-6652 (1999).</li><li>Sekimizu, K., Bramhill, D., Kornberg, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ATP+activates+dnaA+protein+in+initiating+replication+of+plasmids+bearing+the+origin+of+the+E.+coli+chromosome.">ATP activates dnaA protein in initiating replication of plasmids bearing the origin of the E. coli chromosome.</a> Cell. 50 (2), 259-265 (1987).</li><li>Brendler, T., Austin, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Binding+of+SeqA+protein+to+DNA+requires+interaction+between+two+or+more+complexes+bound+to+separate+hemimethylated+GATC+sequences.">Binding of SeqA protein to DNA requires interaction between two or more complexes bound to separate hemimethylated GATC sequences.</a> EMBO J. 18 (8), 2304-2310 (1999).</li><li>Lu, M., Campbell, J. L., Boye, E., Kleckner, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SeqA:+a+negative+modulator+of+replication+initiation+in+E.+coli.">SeqA: a negative modulator of replication initiation in E. coli.</a> Cell. 77 (3), 413-426 (1994).</li><li>Katayama, T., Kubota, T., Kurokawa, K., Crooke, E., Sekimizu, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+initiator+function+of+DnaA+protein+is+negatively+regulated+by+the+sliding+clamp+of+the+E.+coli+chromosomal+replicase.">The initiator function of DnaA protein is negatively regulated by the sliding clamp of the E. coli chromosomal replicase.</a> Cell. 94 (1), 61-71 (1998).</li><li>Kato, J., Katayama, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hda,+a+novel+DnaA-related+protein,+regulates+the+replication+cycle+in+Escherichia+coli.">Hda, a novel DnaA-related protein, regulates the replication cycle in Escherichia coli.</a> EMBO J. 20 (15), 4253-4262 (2001).</li><li>Kasho, K., Katayama, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DnaA+binding+locus+datA+promotes+DnaA-ATP+hydrolysis+to+enable+cell+cycle-coordinated+replication+initiation.">DnaA binding locus datA promotes DnaA-ATP hydrolysis to enable cell cycle-coordinated replication initiation.</a> Proc Natl Acad Sci U S A. 110 (3), 936-941 (2013).</li><li>Kitagawa, R., Ozaki, T., Moriya, S., Ogawa, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Negative+control+of+replication+initiation+by+a+novel+chromosomal+locus+exhibiting+exceptional+affinity+for+Escherichia+coli+DnaA+protein.">Negative control of replication initiation by a novel chromosomal locus exhibiting exceptional affinity for Escherichia coli DnaA protein.</a> Genes Dev. 12 (19), 3032-3043 (1998).</li><li>Fujimitsu, K., Senriuchi, T., Katayama, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+genomic+sequences+of+E.+coli+promote+replicational+initiation+by+directly+reactivating+ADP-DnaA.">Specific genomic sequences of E. coli promote replicational initiation by directly reactivating ADP-DnaA.</a> Genes Dev. 23 (10), 1221-1233 (2009).</li><li>Kasho, K., Fujimitsu, K., Matoba, T., Oshima, T., Katayama, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Timely+binding+of+IHF+and+Fis+to+DARS2+regulates+ATP-DnaA+production+and+replication+initiation.">Timely binding of IHF and Fis to DARS2 regulates ATP-DnaA production and replication initiation.</a> Nucleic Acids Res. 42 (21), 13134-13149 (2014).</li><li>Frimodt-Moller, J., Charbon, G., Krogfelt, K. A., Lobner-Olesen, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Control+regions+for+chromosome+replication+are+conserved+with+respect+to+sequence+and+location+among+Escherichia+coli+strains.">Control regions for chromosome replication are conserved with respect to sequence and location among Escherichia coli strains.</a> Front Microbiol. 6, 1011 (2015).</li><li>Bergthorsson, U., Ochman, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distribution+of+chromosome+length+variation+in+natural+isolates+of+Escherichia+coli.">Distribution of chromosome length variation in natural isolates of Escherichia coli.</a> Mol Biol Evol. 15 (1), 6-16 (1998).</li><li>Boye, E., Steen, H. B., Skarstad, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Flow+cytometry+of+bacteria:+a+promising+tool+in+experimental+and+clinical+microbiology.">Flow cytometry of bacteria: a promising tool in experimental and clinical microbiology.</a> J Gen Microbiol. 129 (4), 973-980 (1983).</li><li>Rossignol, M., Basset, A., Espeli, O., Boccard, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NKBOR,+a+mini-Tn10-based+transposon+for+random+insertion+in+the+chromosome+of+Gram-negative+bacteria+and+the+rapid+recovery+of+sequences+flanking+the+insertion+sites+in+Escherichia+coli.">NKBOR, a mini-Tn10-based transposon for random insertion in the chromosome of Gram-negative bacteria and the rapid recovery of sequences flanking the insertion sites in Escherichia coli.</a> Res Microbiol. 152 (5), 481-485 (2001).</li><li>Shafferman, A., Helinski, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+properties+of+the+beta+origin+of+replication+of+plasmid+R6K.">Structural properties of the beta origin of replication of plasmid R6K.</a> J Biol Chem. 258 (7), 4083-4090 (1983).</li><li>Gonzales, M. F., Brooks, T., Pukatzki, S. U., Provenzano, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+protocol+for+preparation+of+electrocompetent+Escherichia+coli+and+Vibrio+cholerae.">Rapid protocol for preparation of electrocompetent Escherichia coli and Vibrio cholerae.</a> J Vis Exp. (80), (2013).</li><li>Smith, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Random+primed+labeling+of+DNA.">Random primed labeling of DNA.</a> Methods Mol Biol. 18, 445-447 (1993).</li><li>Lobner-Olesen, A., von Freiesleben, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromosomal+replication+incompatibility+in+Dam+methyltransferase+deficient+Escherichia+coli+cells.">Chromosomal replication incompatibility in Dam methyltransferase deficient Escherichia coli cells.</a> EMBO J. 15 (21), 5999-6008 (1996).</li><li>Harrison, R. W., Miller, J. C., D'Souza, M. J., Kampo, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Easy+gene+walking.">Easy gene walking.</a> Biotechniques. 22 (4), 650-653 (1997).</li><li>Langmead, B., Salzberg, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+gapped-read+alignment+with+Bowtie+2.">Fast gapped-read alignment with Bowtie 2.</a> Nat Methods. 9 (4), 357-359 (2012).</li><li>Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Basic+local+alignment+search+tool.">Basic local alignment search tool.</a> J Mol Biol. 215 (3), 403-410 (1990).</li><li>Stepankiw, N., Kaidow, A., Boye, E., Bates, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+right+half+of+the+Escherichia+coli+replication+origin+is+not+essential+for+viability,+but+facilitates+multi-forked+replication.">The right half of the Escherichia coli replication origin is not essential for viability, but facilitates multi-forked replication.</a> Mol Microbiol. 74 (2), 467-479 (2009).</li><li>Lobner-Olesen, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distribution+of+minichromosomes+in+individual+Escherichia+coli+cells:+implications+for+replication+control.">Distribution of minichromosomes in individual Escherichia coli cells: implications for replication control.</a> EMBO J. 18 (6), 1712-1721 (1999).</li><li>Lobner-Olesen, A., Skarstad, K., Hansen, F. G., von Meyenburg, K., Boye, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+DnaA+protein+determines+the+initiation+mass+of+Escherichia+coli+K-12.">The DnaA protein determines the initiation mass of Escherichia coli K-12.</a> Cell. 57 (5), 881-889 (1989).</li><li>Carver, T., Thomson, N., Bleasby, A., Berriman, M., Parkhill, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNAPlotter:+circular+and+linear+interactive+genome+visualization.">DNAPlotter: circular and linear interactive genome visualization.</a> Bioinformatics. 25 (1), 119-120 (2009).</li><li>Eckert, S. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retrospective+application+of+transposon-directed+insertion+site+sequencing+to+a+library+of+signature-tagged+mini-Tn5Km2+mutants+of+Escherichia+coli+O157:H7+screened+in+cattle.">Retrospective application of transposon-directed insertion site sequencing to a library of signature-tagged mini-Tn5Km2 mutants of Escherichia coli O157:H7 screened in cattle.</a> J Bacteriol. 193 (7), 1771-1776 (2011).</li><li>van Opijnen, T., Bodi, K. L., Camilli, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tn-seq:+high-throughput+parallel+sequencing+for+fitness+and+genetic+interaction+studies+in+microorganisms.">Tn-seq: high-throughput parallel sequencing for fitness and genetic interaction studies in microorganisms.</a> Nat Methods. 6 (10), 767-772 (2009).</li><li>van Opijnen, T., Camilli, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transposon+insertion+sequencing:+a+new+tool+for+systems-level+analysis+of+microorganisms.">Transposon insertion sequencing: a new tool for systems-level analysis of microorganisms.</a> Nat Rev Microbiol. 11 (7), 435-442 (2013).</li><li>Jeong, H., Lee, S. J., Kim, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Procedure+for+Adaptive+Laboratory+Evolution+of+Microorganisms+Using+a+Chemostat.">Procedure for Adaptive Laboratory Evolution of Microorganisms Using a Chemostat.</a> J Vis Exp. (115), (2016).</li><li>Bryant, J. A., Sellars, L. E., Busby, S. J., Lee, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromosome+position+effects+on+gene+expression+in+Escherichia+coli+K-12.">Chromosome position effects on gene expression in Escherichia coli K-12.</a> Nucleic Acids Res. 42 (18), 11383-11392 (2014).</li><li>Blattner, F. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+complete+genome+sequence+of+Escherichia+coli+K-12.">The complete genome sequence of Escherichia coli K-12.</a> Science. 277 (5331), 1453-1462 (1997).</li></ol>

Yazarlar rakip mali ilgilenmiyorum.

Burada kullanılan metodoloji ile ilgili genetik bir öğenin en uygun genomik konumunu zor bir soruyu cevaplamak için state-of--art teknikleri yararlanır. (Transposon tarafından aracılı) genetik öğesi rasgele yerleştirilmesi için incelenen genetik öğesinin konumu en iyi seçmek için birbirlerine karşı rekabet yapılabilir klonlar binlerce hızlı ve kolay toplama sağlar (Yani fittest klon).
Burada, DARS2 mini-Tn10eklenmiş-transposon, NKBOR dayalı. T...

Genetik herhangi bir öğe işlev genom konumunda etkilenebilir. Bakterilerde bu esas olarak müdahalelerden komşu genler, yerel DNA topoloji ve/veya çoğaltma ilişkili gen dozaj transkripsiyon tarafından neden olur. Özellikle, DNA ikileşmesi ve segregasyon süreçleri, en azından bölümünde kontrol edilir, kromozom bölgeleri kodlamayan1ve bu bölgeler düzgün genomik konumu/içeriğine bağlıdır. E.coliiçinde kardeşi için gerekli DIF site örnekler kromozom çözüm2; Kromozom segregasyon3için gereken KOPS serilerini; ve veri, DARS1ve DARS2 bölgeleri, uygun kromozom çoğaltma denetimi (aşağıda; için gerekli 4). biz izin rasgele tehcir, seçim ve genetik verilen herhangi bir öğe, en uygun genetik bağlamında belirlenmesi için örneği burada kodlamayan DARS2 bölgesinin çalışma odasına bir yöntem mevcut.
E. coli, DnaA başlatıcı protein DNA dizisi tek çoğaltma kökenoriCaçılış ve helikaz DnaB5,6,7alımı sorumludur. AAA+ (Yani, çeşitli aktiviteler ile ilişkili ATPases) kime ait DnaA proteinler ve ATP ve ADP ile benzer yüksek bağlayabilirsiniz benzeşim5. DnaAATP düzeyini doruklarına başlatma8nerede DnaAATP oluşturan bir multimer üzerinde oriC DNA çift yönlü açılış9tetikler. Başlatma sonra oriC bağlama hemimethylated için SeqA protein içeren bir mekanizma geçici olarak kullanım dışı haciz nedeniyle yeniden başlatma için yapılır oriC10,11. Haciz sırasında en az iki mekanizma ile DnaAATP düzeyi azalır: DnaA (RIDA)12,13 ve veridüzenleme inactivation-bağımlı DnaAATP hidroliz (DDAH)14 ,15. RIDA ve DDAH DnaAATP dönüştürmeye DnaAADPtanıtmak. Önce yeni bir tur başlatma DnaAADP DnaAATP belirli DnaA yeniden etkinleştirme dizileri (DARS) yeniden aktif: DARS1 ve DARS216,17. Kromozom veri, DARS1ve DARS2 bölgeleri kodlamayan ve hareket DnaAATPmodüle için bir refakatçi benzeri şekilde /DnaAADP şekilde. Çoğaltma, kökeni dışında yer alan bu bölgeler, karmaşık bir DnaA Meclisi etkinleştirmek için de inactivation (veri; 14) ya da harekete geçirmek (DARS1 ve DARS2; 17), DnaA. DARS2 hücrede silme kitle katlama zaman ama sonuçları zaman uyumsuz çoğaltma başlatma15,16,18değiştirmez. Ancak, DARS2-eksik hücrelerin bir fitness var aksi halde isogenic bir wildtype için her iki sürekli büyüme rekabet zengin Orta veya fare bağırsak18kolonizasyon kurulması sırasında karşılaştırıldığında maliyet. Bu eşzamansız/kökenli konsantrasyon bile küçük değişiklikler bakteriyel fitness üzerinde olumsuz bir etkisi gösterir. E. coli, kromozom simetri (Yani, iki neredeyse eşit uzunlukta çoğaltma kol)19korumak için seçici bir basınç vardır. Veri, DARS1ve DARS2 bölgeleri aynı göreli uzaklık var oriC içinde tüm E. coli suşları18, kromozom boyutu büyük değişimler rağmen sıralı.
Burada, kromozom pozisyon(lar) için işlevini en iyi tanımlanması için bir örnek olarak E. coli DARS2 bölge kullanırız. DARS2 NKBOR transposon ve sonuç NKBOR içine eklenen:: daha sonra rastgele MG1655 genom eklenenDARS2 transposon ΔDARS2. Böylece hücre koleksiyonu üretilen, kromozom üzerinde farklı bir yerde her sahip DARS2 yerleştirilir. Nerede koleksiyondaki tüm hücreleri havuza alınmış ve birbirlerine karşı sırasında LB sürekli büyüme tahmini 700 nesiller için yarıştı, vitro rekabet deney, gerçekleştirildi. Rekabet denemenin sonucu izlenen/Southern blot, kolay gen yürüyüş ve bütün-genom sıralama (WGS; kullanarak tespit edildi Şekil 1). Kolay gen yürüyerek çözüldü son nokta klonlar hücre döngüsü parametreleri değerlendirmek için Akış Sitometresi tarafından karakterize. Bir akış sitometrik analizinde çok sayıda hücre için hücre boyutu, DNA içeriği ve inisiyasyon senkronizasyonu ölçülebilir. Akış Sitometresi sırasında bir akış tek hücre sonra aynı anda verilmiş Floresans DNA içeriği, bir ölçü birimi toplamak photomultipliers tarafından sağlanan kayıtlı lekeli DNA heyecanlandırmak için uygun dalga boyu bir ışık huzmesi geçer. hücreleri DNA için lekeli. İleri dağınık ışık hücre kitle20ölçüsüdür.
Burada mevcut vitro rekabet deney kromozom pozisyon ve genomik genetik öğesi bağlamında önemi ile ilgili soruları gidermek için kullanılır. Tarafsız ve kolay yöntemdir.

<table><tbody><tr><td>Autoclaved Mili-Q water</td><td></td><td>None</td><td></td></tr><tr><td>Electroporation Cuvettes, 0.1 cm</td><td>Thermo Fisher Scientific</td><td>P41050</td><td></td></tr><tr><td>Bio-Rad MicroPulser Electroporation System</td><td>Bio-Rad</td><td>165-2100</td><td></td></tr><tr><td>LB Broth</td><td>Thermo Fisher Scientific</td><td>12780029&amp;nbsp;</td><td></td></tr><tr><td>LB Agar, powder (Lennox L agar)</td><td>Thermo Fisher Scientific</td><td>22700025</td><td></td></tr><tr><td>Glycerol</td><td>Thermo Fisher Scientific</td><td>17904</td><td></td></tr><tr><td>Fisherbrand&amp;nbsp;Plastic Petri Dishes</td><td>Fisher Scientific</td><td>S33580A</td><td></td></tr><tr><td>Falcon 50mL Conical Centrifuge Tubes</td><td>Fisher Scientific</td><td>14-432-22</td><td></td></tr><tr><td>Falcon 15mL Conical Centrifuge Tubes</td><td>Fisher Scientific</td><td>14-959-53A</td><td></td></tr><tr><td>Nunc&amp;nbsp;CryoTubes</td><td>Sigma-Aldrich</td><td>V7634&amp;nbsp;</td><td></td></tr><tr><td>Phusion High-Fidelity DNA Polymerase (2 U/&amp;micro;L)</td><td>Thermo Fisher Scientific</td><td>F530S</td><td></td></tr><tr><td>dATP, [&amp;alpha;-32P]- 3000Ci/mmol 10mCi/ml, 250 &amp;micro;Ci</td><td>PerkinElmer</td><td>BLU012H250UC</td><td></td></tr><tr><td>DECAprime II DNA Labeling Kit</td><td>Thermo Fisher Scientific</td><td>AM1455</td><td></td></tr><tr><td>Spectrophotometer&amp;nbsp; SF/MBV/03.32</td><td>Pharmacia</td><td></td><td></td></tr><tr><td>Hermle Centrifuge&amp;nbsp;&amp;nbsp;&amp;nbsp; SF/MBV/03.46</td><td>Hermle</td><td></td><td></td></tr><tr><td>Ole Dich Centrifuge&amp;nbsp; SF/MBV/03.29</td><td>Ole Dich</td><td></td><td></td></tr><tr><td>Eppendorftubes 1.5 mL</td><td>Sigma-Aldrich</td><td>T9661</td><td></td></tr><tr><td>Eppendorftubes 2.0 mL</td><td>Sigma-Aldrich</td><td>T2795</td><td></td></tr><tr><td>Sodium Chloride</td><td>Merck</td><td>6404</td><td></td></tr><tr><td>96% Ethanol</td><td>Sigma-Aldrich</td><td>16368</td><td></td></tr><tr><td>Trizma HCl</td><td>Sigma-Aldrich</td><td>T-3253</td><td></td></tr><tr><td>Phenol Ultra Pure</td><td>BRL</td><td>5509UA</td><td></td></tr><tr><td>Chloroform</td><td>Merck</td><td>2445</td><td></td></tr><tr><td>Ribonuclease A type II A</td><td>Sigma-Aldrich</td><td>R5000</td><td></td></tr><tr><td>Sodiumdodecylsulphate (SDS)</td><td>Merck</td><td>13760</td><td></td></tr><tr><td>Lysozyme</td><td>Sigma-Aldrich</td><td>L 6876</td><td></td></tr><tr><td>Isopropanol</td><td>Sigma-Aldrich</td><td>405-7</td><td></td></tr><tr><td>0.5M Na-EDTA pH 8.0</td><td>BRL</td><td>5575 UA</td><td></td></tr><tr><td>Kanamycin sulfate</td><td>Sigma-Aldrich</td><td>10106801001</td><td></td></tr><tr><td>PvuI (10 U/&amp;micro;L)</td><td>Thermo Fisher Scientific</td><td>ER0621</td><td></td></tr><tr><td>UltraPure Agarose</td><td>Thermo Fisher Scientific</td><td>16500500</td><td></td></tr><tr><td>DNA Gel Loading Dye (6X)</td><td>Thermo Fisher Scientific</td><td>R0611</td><td></td></tr><tr><td>Tris-Borate-EDTA buffer</td><td>Sigma-Aldrich</td><td>T4415</td><td></td></tr><tr><td>Ethidium bromide</td><td>Sigma-Aldrich</td><td>E7637</td><td></td></tr><tr><td>Hydrochloric acid</td><td>Sigma-Aldrich</td><td>433160</td><td></td></tr><tr><td>Sodium Hydroxide</td><td>Sigma-Aldrich</td><td>71687</td><td></td></tr><tr><td>Whatman&amp;nbsp;3MM papers</td><td>Sigma-Aldrich</td><td>WHA3030931</td><td></td></tr><tr><td>SSC Buffer 20&amp;times; Concentrate</td><td>Sigma-Aldrich</td><td>S6639</td><td></td></tr><tr><td>Amersham Hybond-N+</td><td>GE Healthcare</td><td>RPN119B</td><td></td></tr><tr><td>Ficoll&amp;nbsp;400</td><td>Sigma-Aldrich</td><td>F8016</td><td></td></tr><tr><td>Polyvinylpyrrolidone</td><td>Sigma-Aldrich</td><td>PVP40</td><td></td></tr><tr><td>Bovine Serum Albumin - Fraction V</td><td>Sigma-Aldrich</td><td>85040C</td><td></td></tr><tr><td>Deoxyribonucleic acid sodium salt from salmon testes</td><td>Sigma-Aldrich</td><td>D1626</td><td></td></tr><tr><td>Carestream Kodak &amp;nbsp;BioMax &amp;nbsp;light film</td><td>Sigma-Aldrich</td><td>Z373494</td><td></td></tr><tr><td>GenElute &amp;nbsp;Gel Extraction Kit</td><td>Sigma-Aldrich</td><td>NA1111&amp;nbsp;</td><td></td></tr><tr><td>GenElute &amp;nbsp;PCR Clean-Up Kit</td><td>Sigma-Aldrich</td><td>NA1020</td><td></td></tr><tr><td>T100&amp;nbsp; Thermal Cycler</td><td>Bio-Rad</td><td></td><td></td></tr><tr><td>SmartSpec Plus Spectrophotometer</td><td>Bio-Rad</td><td></td><td></td></tr><tr><td>Rifampicin</td><td>Serva</td><td>34514.01</td><td></td></tr><tr><td>Cephalexin</td><td>Sigma-Aldrich</td><td>C4895</td><td></td></tr><tr><td>Mithramycin</td><td>Serva</td><td>29803.02</td><td></td></tr><tr><td>Magnesium chloride hexahydrate</td><td>Sigma-Aldrich</td><td>246964</td><td></td></tr><tr><td>Apogee A10 instrument</td><td>Apogee</td><td></td><td></td></tr></tbody></table>

determination of the optimal chromosomal location(s) for a dna element in escherichia coli using a novel transposon-mediated approach

Belirli bir DNA öğeyi en iyi kromozom pozisyon(lar)/rasgele ekleme transposon-aracılı fitness seçime göre takip tarafından belirlendi. Bakterilerde genetik bir öğe işlev genetik içeriğine etkisini değerlendirmek zor olabilir. Topolojik etkileri, komşu genler ve/veya çoğaltma ilişkili gen dozaj, transkripsiyon müdahalelerden de dahil olmak üzere çeşitli mekanizmalar belirli bir genetik öğeyi işlevini etkileyebilir. Burada, kromozom Escherichia coli ve basit büyüme rekabet kullanarak en uygun konumları deneme Seç rasgele entegrasyonu, bir DNA öğesi izin veren bir yöntem açıklanmaktadır. Yöntem rasgele ekleme, büyüme avantajı, deneysel ihtiyaçlarına kolayca ayarlanabilir bir yordam tarafından fittest clone(s) bir seçim ile birleştiğinde iyi tarif bir transposon tabanlı sistem yararlanır. Fittest clone(s) doğası karmaşık bir çok klonal nüfusun bütün-genom sıralama veya seçili klonlar hızlı tanımlanması için yürüyüş kolay gen tarafından belirlenebilir. Burada, kodlamayan DNA bölge E. colikromozom çoğaltması başlatma kontrol, DARS2, örnek olarak kullanılmıştır. DARS2 fonksiyonu çoğaltma ilişkili gen dozaj tarafından etkilendiği bilinmektedir; daha yakın DARS2 DNA ikileşmesi, kökeni daha etkin hale gelir alır. DARS2 rasgele bir DARS2kromozom eklenen-zorlanma silinmiş. Bireysel eklemeler içeren sonuç klonlar havuza alınmış ve birbirlerine karşı yüzlerce nesiller için yarıştı. Son olarak, fittest klonlar ile karakterize ve yakın özgün DARS2 konumuna eklenen DARS2 içerecek şekilde bulundu.

Southern blot DARS2 kromozom transposon kütüphanede boyunca rasgele dağıtılan doğrulamak için yapılır (t = 0) ve fittest klonlar zamanla kalıcı. Southern blot ilk transposon havuzundan çıkarılan DNA üzerinde gerçekleştirildi (t = 0) ve rekabet (şekil 3) 700 nesiller dışarı tahmin edilen her 100. Burada, her zaman noktasından toplam hücresel DNA'sı sindirilmiş ile Pvuben restriksiyon enzimi, transposon NKBOR kesmek i?...

Watch this Scientific Journal Video about Determination of the Optimal Chromosomal Locations for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach at JoVE.com

Determination of the Optimal Chromosomal Locations for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach

Burada, bir transposon-aracılı rasgele ekleme kodlamayan DNA öğesinin gücünü en iyi kromozom konumunu gidermek için kullanıldı.

En iyi kromozom Location(s) belirlenmesi için yeni bir Transposon-aracılı yaklaşımın kullanarak Escherichia coli DNA öğesinde

The optimal chromosomal position(s) of a given DNA element was/were determined by transposon-mediated random insertion followed by fitness selection. In ...

determination-optimal-chromosomal-location-s-for-dna-element

Universidad de Cartagena UDEC

Research

JoVE Journal

Genetics

Determination of the Optimal Chromosomal Location(s) for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach

7.5K Görüntüleme.  University of Copenhagen. Burada, bir transposon-aracılı rasgele ekleme kodlamayan DNA öğesinin gücünü en iyi kromozom konumunu gidermek için kullanıldı.

Video: Determination of the Optimal Chromosomal Locations for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach

Conjugative Mating Assays for Sequence-specific Analysis of Transfer Proteins Involved in Bacterial Conjugation

The transfer of genetic material by bacterial conjugation is a process that takes place via complexes formed by specific transfer proteins. In Escherichia coli, these transfer proteins make up a DNA transfer machinery known as the mating pair formation, or DNA transfer complex, which facilitates conjugative plasmid transfer. The objective of this paper is to provide a method that can be used to determine the role of a specific transfer protein that is involved in conjugation using a series of deletions and/or point mutations in combination with mating assays. The target gene is knocked out on the conjugative plasmid and is then provided in trans through the use of a small recovery plasmid harboring the target gene. Mutations affecting the target gene on the recovery plasmid can reveal information about functional aspects of the target protein that result in the alteration of mating efficiency of donor cells harboring the mutated gene. Alterations in mating efficiency provide insight into the role and importance of the particular transfer protein, or a region therein, in facilitating conjugative DNA transfer. Coupling this mating assay with detailed three-dimensional structural studies will provide a comprehensive understanding of the function of the conjugative transfer protein as well as provide a means for identifying and characterizing regions of protein-protein interaction.

Here, we present a protocol to knockout a gene of interest involved in plasmid conjugation and subsequently analyze the impact of its absence using mating assays. The function of the gene is further explored to a specific region of its sequence using deletion or point mutations.

Bakteriyel Konjugasyon ilgilendim Transferi Proteinlerin Dizi özgü Analiz konjugatif Çiftleşme Tahliller

The transfer of genetic material by bacterial conjugation is a process that takes place via complexes formed by specific transfer proteins. In Escherichia ...

Genetik

Site-specific Bacterial Chromosome Engineering: &#934;C31 Integrase Mediated Cassette Exchange (IMCE)

The bacterial chromosome may be used to stably maintain foreign DNA in the mega-base range1. Integration into the chromosome circumvents issues such as plasmid replication, plasmid stability, plasmid incompatibility, and plasmid copy number variance. This method uses the site-specific integrase from the Streptomyces phage (&Phi;) C312,3. The &Phi;C31 integrase catalyzes a direct recombination between two specific DNA sites: attB and attP (34 and 39 bp, respectively)4. This recombination is stable and does not revert5. A "landing pad" (LP) sequence consisting of a spectinomycin- resistance gene, aadA (SpR), and the E. coli &szlig;-glucuronidase gene (uidA) flanked by attP sites has been integrated into the chromosomes of Sinorhizobium meliloti, Ochrobactrum anthropi, and Agrobacterium tumefaciens in an intergenic region, the ampC locus, and the tetA locus, respectively. S. meliloti is used in this protocol. Mobilizable donor vectors containing attB sites flanking a stuffer red fluorescent protein (rfp) gene and an antibiotic resistance gene have also been constructed. In this example the gentamicin resistant plasmid pJH110 is used. The rfp gene6 may be replaced with a desired construct using SphI and PstI. Alternatively a synthetic construct flanked by attB sites may be sub-cloned into a mobilizable vector such as pK19mob7. The expression of the &Phi;C31 integrase gene (cloned from pHS628) is driven by the lac promoter, on a mobilizable broad host range plasmid pRK78139.
A tetraparental mating protocol is used to transfer the donor cassette into the LP strain thereby replacing the markers in the LP sequence with the donor cassette. These cells are trans-integrants. Trans-integrants are formed with a typical efficiency of 0.5%. Trans-integrants are typically found within the first 500-1,000 colonies screened by antibiotic sensitivity or blue-white screening using 5-bromo-4-chloro-3-indolyl-beta-D-glucuronic acid (X-gluc). This protocol contains the mating and selection procedures for creating and isolating trans-integrants.

A quick and efficient method to integrate foreign DNA of interest into pre-made acceptor strains, termed landing pad strains, is described. The method allows site-specific integration of a DNA cassette into the engineered landing pad locus of a given strain, through conjugation and expression of the &#934;C31 integrase.

Siteye özgü Bakteriyel Kromozom Mühendislik: ΦC31 integraz Aracılı Kaset Borsası (IMCE)

The bacterial chromosome may be used to stably maintain foreign DNA in the mega-base range1. Integration into the chromosome circumvents issues such as ...

Biyomühendislik

High-Resolution Comparison of Bacterial Conjugation Frequencies

Bacterial conjugation is an important step in the horizontal transfer of antibiotic resistance genes via a conjugative DNA element. In-depth comparisons of conjugation frequency under different conditions are required to understand how the conjugative element spreads in nature. However, conventional methods for comparing conjugation frequency are not appropriate for in-depth comparisons because of the high background caused by the occurrence of additional conjugation events on the selective plate. We successfully reduced the background by introducing a most probable number (MPN) method and a higher concentration of antibiotics to prevent further conjugation in selective liquid medium. In addition, we developed a protocol for estimating the probability of how often donor cells initiate conjugation by sorting single donor cells into recipient pools by fluorescence-activated cell sorting (FACS). Using two plasmids, pBP136 and pCAR1, the differences in conjugation frequency in Pseudomonas putida cells could be detected in liquid medium at different stirring rates. The frequencies of conjugation initiation were higher for pBP136 than for pCAR1. Using these results, we can better understand the conjugation features in these two plasmids.

With an aim to understand the behaviors of various bacterial conjugative DNA elements under different conditions, we describe a protocol for detecting differences in conjugation frequency, with high resolution, to estimate how efficiently the donor bacterium initiates conjugation.

Bakteriyel konjugasyon frekans yüksek çözünürlüklü karşılaştırma

Bacterial conjugation is an important step in the horizontal transfer of antibiotic resistance genes via a conjugative DNA element. In-depth comparisons ...

Producing Gene Deletions in Escherichia coli by P1 Transduction with Excisable Antibiotic Resistance Cassettes

A first approach to study the function of an unknown gene in bacteria is to create a knock-out of this gene. Here, we describe a robust and fast protocol for transferring gene deletion mutations from one Escherichia coli strain to another by using generalized transduction with the bacteriophage P1. This method requires that the mutation be selectable (e.g., based on gene disruptions using antibiotic cassette insertions). Such antibiotic cassettes can be mobilized from a donor strain and introduced into a recipient strain of interest to quickly and easily generate a gene deletion mutant. The antibiotic cassette can be designed to include flippase recognition sites that allow the excision of the cassette by a site-specific recombinase to produce a clean knock-out with only a ~100-base-pair-long scar sequence in the genome. We demonstrate the protocol by knocking out the tamA gene encoding an assembly factor involved in autotransporter biogenesis and test the effect of this knock-out on the biogenesis and function of two trimeric autotransporter adhesins. Though gene deletion by P1 transduction has its limitations, the ease and speed of its implementation make it an attractive alternative to other methods of gene deletion.

Producing Gene Deletions in Escherichia coli by P1 Transduction with Excisable Antibiotic Resistance Cassettes

Here we present a protocol for the use of pre-existing antibiotic resistance-cassette deletion constructs as a basis for making deletion mutants in other E. coli strains. Such deletion mutations can be mobilized and inserted into the corresponding locus of a recipient strain using P1 bacteriophage transduction.

Escherichia coli Excisable antibiyotik direnci kasetleri ile P1 iletim tarafından üreten gen silme

A first approach to study the function of an unknown gene in bacteria is to create a knock-out of this gene. Here, we describe a robust and fast protocol ...

Creation of a Dense Transposon Insertion Library Using Bacterial Conjugation in Enterobacterial Strains Such As Escherichia Coli or Shigella flexneri

Transposon mutagenesis is a method that allows gene disruption via the random genomic insertion of a piece of DNA called a transposon. The protocol below outlines a method for high efficiency transfer between bacterial strains of a plasmid harboring a transposon containing a kanamycin resistance marker. The plasmid-borne transposase is encoded by a variant tnp gene that inserts the transposon into the genome of the recipient strain with very low insertional bias. This method thus allows the creation of large mutant libraries in which transposons have been inserted into unique genomic positions in a recipient strain of either Escherichia coli or Shigella flexneri bacteria. By using bacterial conjugation, as opposed to other methods such as electroporation or chemical transformation, large libraries with hundreds of thousands of unique clones can be created. This yields high-density insertion libraries, with insertions occurring as frequently as every 4-6 base pairs in non-essential genes. This method is superior to other methods as it allows for an inexpensive, easy to use, and high efficiency method for the creation of a dense transposon insertion library. The transposon library can be used in downstream applications such as transposon sequencing (Tn-Seq), to infer genetic interaction networks, or more simply, in mutational (forward genetic) screens.

Creation of a Dense Transposon Insertion Library Using Bacterial Conjugation in Enterobacterial Strains Such As Escherichia Coli or Shigella flexneri

Presented here is a simple method for creating a high-density transposon insertion library in Escherichia coli or Shigella flexneri using bacterial conjugation. This protocol allows the creation of a collection of hundreds of thousands of unique mutants in bacteria by the random genomic insertion of a transposon.

Bir yoğun Transposon ekleme kütüphane kullanarak bakteriyel konjugasyon Escherichia Coli Enterobacterial suşları gibi veya Shigella flexneri oluşturulması

Transposon mutagenesis is a method that allows gene disruption via the random genomic insertion of a piece of DNA called a transposon. The protocol below ...

İmmünoloji ve Enfeksiyon

Mapping Bacterial Functional Networks and Pathways in Escherichia Coli using Synthetic Genetic Arrays

Phenotypes are determined by a complex series of physical (e.g. protein-protein) and functional (e.g. gene-gene or genetic) interactions (GI)1. While physical interactions can indicate which bacterial proteins are associated as complexes, they do not necessarily reveal pathway-level functional relationships1. GI screens, in which the growth of double mutants bearing two deleted or inactivated genes is measured and compared to the corresponding single mutants, can illuminate epistatic dependencies between loci and hence provide a means to query and discover novel functional relationships2. Large-scale GI maps have been reported for eukaryotic organisms like yeast3-7, but GI information remains sparse for prokaryotes8, which hinders the functional annotation of bacterial genomes. To this end, we and others have developed high-throughput quantitative bacterial GI screening methods9, 10.
Here, we present the key steps required to perform quantitative E. coli Synthetic Genetic Array (eSGA) screening procedure on a genome-scale9, using natural bacterial conjugation and homologous recombination to systemically generate and measure the fitness of large numbers of double mutants in a colony array format. Briefly, a robot is used to transfer, through conjugation, chloramphenicol (Cm) - marked mutant alleles from engineered Hfr (High frequency of recombination) 'donor strains' into an ordered array of kanamycin (Kan) - marked F- recipient strains. Typically, we use loss-of-function single mutants bearing non-essential gene deletions (e.g. the 'Keio' collection11) and essential gene hypomorphic mutations (i.e. alleles conferring reduced protein expression, stability, or activity9, 12, 13) to query the functional associations of non-essential and essential genes, respectively. After conjugation and ensuing genetic exchange mediated by homologous recombination, the resulting double mutants are selected on solid medium containing both antibiotics. After outgrowth, the plates are digitally imaged and colony sizes are quantitatively scored using an in-house automated image processing system14. GIs are revealed when the growth rate of a double mutant is either significantly better or worse than expected9. Aggravating (or negative) GIs often result between loss-of-function mutations in pairs of genes from compensatory pathways that impinge on the same essential process2. Here, the loss of a single gene is buffered, such that either single mutant is viable. However, the loss of both pathways is deleterious and results in synthetic lethality or sickness (i.e. slow growth). Conversely, alleviating (or positive) interactions can occur between genes in the same pathway or protein complex2 as the deletion of either gene alone is often sufficient to perturb the normal function of the pathway or complex such that additional perturbations do not reduce activity, and hence growth, further. Overall, systematically identifying and analyzing GI networks can provide unbiased, global maps of the functional relationships between large numbers of genes, from which pathway-level information missed by other approaches can be inferred9.

Mapping Bacterial Functional Networks and Pathways in Escherichia Coli using Synthetic Genetic Arrays

Systematic, large-scale synthetic genetic (gene-gene or epistasis) interaction screens can be used to explore genetic redundancy and pathway cross-talk. Here, we describe a high-throughput quantitative synthetic genetic array screening technology, termed eSGA that we developed for elucidating epistatic relationships and exploring genetic interaction networks in Escherichia coli.

Bakteriyel Fonksiyonel Ağlar ve tanımında Haritalama<em&gt; Escherichia Coli</em&gt; Sentetik Genetik Diziler kullanarak

Phenotypes  are determined by a complex series of physical (e.g. protein-protein) and  functional (e.g. gene-gene or genetic) interactions (GI)1. While ...

Biyoloji

Generation of Enterobacter sp. YSU Auxotrophs Using Transposon Mutagenesis

Prototrophic bacteria grow on M-9 minimal salts medium supplemented with glucose (M-9 medium), which is used as a carbon and energy source. Auxotrophs can be generated using a transposome. The commercially available, Tn5-derived transposome used in this protocol consists of a linear segment of DNA containing an R6K&#947; replication origin, a gene for kanamycin resistance and two mosaic sequence ends, which serve as transposase binding sites. The transposome, provided as a DNA/transposase protein complex, is introduced by electroporation into the prototrophic strain, Enterobacter sp. YSU, and randomly incorporates itself into this host&#8217;s genome. Transformants are replica plated onto Luria-Bertani agar plates containing kanamycin, (LB-kan) and onto M-9 medium agar plates containing kanamycin (M-9-kan). The transformants that grow on LB-kan plates but not on M-9-kan plates are considered to be auxotrophs. Purified genomic DNA from an auxotroph is partially digested, ligated and transformed into a pir+ Escherichia coli (E. coli) strain. The R6K&#947; replication origin allows the plasmid to replicate in pir+ E. coli strains, and the kanamycin resistance marker allows for plasmid selection. Each transformant possesses a new plasmid containing the transposon flanked by the interrupted chromosomal region. Sanger sequencing and the Basic Local Alignment Search Tool (BLAST) suggest a putative identity of the interrupted gene. There are three advantages to using this transposome mutagenesis strategy. First, it does not rely on the expression of a transposase gene by the host. Second, the transposome is introduced into the target host by electroporation, rather than by conjugation or by transduction and therefore is more efficient. Third, the R6K&#947; replication origin makes it easy to identify the mutated gene which is partially recovered in a recombinant plasmid. This technique can be used to investigate the genes involved in other characteristics of Enterobacter sp. YSU or of a wider variety of bacterial strains.

Generation of Enterobacter sp. YSU Auxotrophs Using Transposon Mutagenesis

Enterobacter sp. YSU grows in glucose minimal salts medium. Auxotrophs are generated by transforming it with a transposome which randomly inserts itself into the host genome. Mutants are found by replica plating from complex medium to minimal medium. Interrupted genes are identified by gene rescue and sequencing.

Üretilmesi<em&gt; Enterobacter</em&gt; Sp. YSU oksotroflan transpozon mutajenezi kullanarak,

Prototrophic bacteria grow on M-9 minimal salts medium supplemented with glucose (M-9 medium), which is used as a carbon and energy source. Auxotrophs can ...

Generating Transposon Insertion Libraries in Gram-Negative Bacteria for High-Throughput Sequencing

Transposon sequencing (Tn-seq) is a powerful method that combines transposon mutagenesis and massive parallel sequencing to identify genes and pathways that contribute to bacterial fitness under a wide range of environmental conditions. Tn-seq applications are extensive and have not only enabled examination of genotype-phenotype relationships at an organism level but also at the population, community and systems levels. Gram-negative bacteria are highly associated with antimicrobial resistance phenotypes, which has increased incidents of antibiotic treatment failure. Antimicrobial resistance is defined as bacterial growth in the presence of otherwise lethal antibiotics. The &#8220;last-line&#8221; antimicrobial colistin is used to treat Gram-negative bacterial infections. However, several Gram-negative pathogens, including Acinetobacter baumannii can develop colistin resistance through a range of molecular mechanisms, some of which were characterized using Tn-seq. Furthermore, signal transduction pathways that regulate colistin resistance vary within Gram-negative bacteria. Here we propose an efficient method of transposon mutagenesis in A. baumannii that streamlines generation of a saturating transposon insertion library and amplicon library construction by eliminating the need for restriction enzymes, adapter ligation, and gel purification. The methods described herein will enable in-depth analysis of molecular determinants that contribute to A. baumannii fitness when challenged with colistin. The protocol is also applicable to other Gram-negative ESKAPE pathogens, which are primarily associated with drug resistant hospital-acquired infections.

We describe a method to generate saturating transposon mutant libraries in Gram-negative bacteria and subsequent preparation of DNA amplicon libraries for high-throughput sequencing. As an example, we focus on the ESKAPE pathogen, Acinetobacter baumannii, but this protocol is amenable to a wide range of Gram-negative organisms.

Yüksek İşlem Likör Sıralaması Için Gram-Negatif Bakterilerde Transposon Ekleme Kitaplıkları Oluşturma

Transposon sequencing (Tn-seq) is a powerful method that combines transposon mutagenesis and massive parallel sequencing to identify genes and pathways ...

Transposon-insertion Sequencing as a Tool to Elucidate Bacterial Colonization Factors in a Burkholderia gladioli Symbiont of Lagria villosa Beetles

Inferring the function of genes by manipulating their activity is an essential tool for understanding the genetic underpinnings of most biological processes. Advances in molecular microbiology have seen the emergence of diverse mutagenesis techniques for the manipulation of genes. Among them, transposon-insertion sequencing (Tn-seq) is a valuable tool to simultaneously assess the functionality of many candidate genes in an untargeted way. The technique has been key to identify&#160;molecular mechanisms for the colonization of eukaryotic hosts in several pathogenic microbes and a few beneficial symbionts.
Here, Tn-seq is established as a method to identify colonization factors in a mutualistic Burkholderia gladioli symbiont of the beetle Lagria villosa. By conjugation, Tn5 transposon-mediated insertion of an antibiotic-resistance cassette is&#160;carried out at random genomic locations in B. gladioli. To identify the effect of gene disruptions on the ability of the bacteria to colonize the beetle host, the generated B. gladioli transposon-mutant library is inoculated on the beetle eggs, while a control is grown in vitro in a liquid culture medium. After allowing sufficient time for colonization, DNA is extracted from the in vivo and in vitro grown libraries. Following a DNA library preparation protocol, the DNA samples are prepared for transposon-insertion sequencing. DNA fragments that contain the transposon-insert edge and flanking bacterial DNA are selected, and the mutation sites are determined by sequencing away from the transposon-insert edge. Finally, by analyzing and comparing the frequencies of each mutant between the in vivo and in vitro libraries, the importance of specific symbiont genes during beetle colonization can be predicted.

Transposon-insertion Sequencing as a Tool to Elucidate Bacterial Colonization Factors in a Burkholderia gladioli Symbiont of Lagria villosa Beetles

This is an adapted method for identifying candidate insect colonization factors in a Burkholderia beneficial symbiont. The beetle host is infected with a random mutant library generated via transposon mutagenesis, and library complexity after colonization is compared to a control grown in vitro.

Lagria villosa Böcekleri burkholderia gladioli Symbiont Bakteriyel Kolonizasyon Faktörlerini Elucidate için Bir Araç Olarak Transposon-ekleme Dizileme

Inferring the function of genes by manipulating their activity is an essential tool for understanding the genetic underpinnings of most biological ...

Real-Time Quantification of the Effects of IS200/IS605 Family-Associated TnpB on Transposon Activity

Here, a protocol is outlined to perform live, real-time imaging of transposable element activity in live bacterial cells using a suite of fluorescent reporters coupled to transposition. In particular, it demonstrates how real-time imaging can be used to assess the effects of the accessory protein TnpB on the activity of the transposable element IS608, a member of the IS200/IS605 family of transposable elements. The IS200/IS605 family of transposable elements are abundant mobile elements connected with one of the most innumerable genes found in nature, tnpB. Sequence homologies propose that the TnpB protein may be an evolutionary precursor to CRISPR/Cas9 systems. Additionally, TnpB has received renewed interest, having been shown to act as a Cas-like RNA-guided DNA endonuclease. The effects of TnpB on the transposition rates of IS608 are quantified, and it is demonstrated that the expression of TnpB of IS608 results in ~5x increased transposon activity compared to cells lacking TnpB expression.

A protocol is outlined to perform live real-time imaging to quantify how the accessory protein TnpB affects the dynamics of transposition in individual live Escherichia coli cells.

IS200/IS605 Ailesi ile İlişkili TnpB'nin Transpozon Aktivitesi Üzerindeki Etkilerinin Gerçek Zamanlı Ölçümü

Here, a protocol is outlined to perform live, real-time imaging of transposable element activity in live bacterial cells using a suite of fluorescent ...

En iyi kromozom Location(s) belirlenmesi için yeni bir Transposon-aracılı yaklaşımın kullanarak Escherichia coli DNA öğesinde

Özet

Daha Fazla Video Keşfet

Bu videodaki bölümler