This work has been funded in part with Federal funds from the National Institutes of Health, Office of Director, Innovator (No.: DP2OD06514) (PCS) and from the National Institute of Allergy and Infectious Diseases, National Institutes of Health, Department of Health and Human Services, under Contracts (No:HHSN272200900018C, HHSN272200900049C and U19AI110818).

Ethik-Anweisung: Lassa-Fieber-Patienten wurden für diese Studie rekrutiert unter Verwendung von Protokollen von menschlichen Probanden Ausschüsse an der Tulane Universität genehmigt, Harvard University, Broad Institute, Irrua Fach Teaching Hospital (ISTH), Kenema Regierungskrankenhaus (KGH), Oyo Staatsministerium für Gesundheit, Ibadan , Nigeria und Sierra Leone Ministerium für Gesundheit. Alle Patienten wurden mit einem ähnlichen Standard der Behandlung behandelt und das Medikament Ribavirin angeboten, auch nicht entschieden, sie in der Studie teilzunehmen. Für Lassa-Fieber (LF) der Patienten, die Behandlung mit Ribavirin folgte den derzeit empfohlenen Richtlinien und wurde in der Regel so schnell wie LF angeboten wurde stark vermutet. Aufgrund der schweren Ausbruch für Ebola-Virus-Krankheit (EVD), Patienten, die nicht durch unsere Standardprotokolle zugestimmt werden konnte. Verwendung von klinischen überschüssigen Proben von EVD Patienten Stattdessen wurde von Institutional Review Boards in Sierra Leone und an der Harvard University bewertet und genehmigt. Die Office des Sierra Leone Ethik und Scientific Review Committee, die Sierra Leone Ministerium für Gesundheit und Hygiene, und der Harvard Ausschuss für die Verwendung von menschlichen Probanden haben einen Verzicht auf Zustimmung erteilt zu sequenzieren und öffentlich verfügbaren viralen Sequenzen von Patienten und Kontaktproben erhalten machen während des Ebola-Ausbruch in Sierra Leone gesammelt. Diese Stellen auch die Verwendung von klinischen und epidemiologischen Daten für de-identifizierte Proben aus allen Verdacht EVD Patienten während des Ausbruchs Antwort zu erhalten Pflege gesammelt gewährt. Die Sierra Leone Ministerium für Gesundheit und Hygiene auch die Verbringung von nicht-infektiösen, nicht-biologische Proben von Sierra Leone auf dem Broad Institute und der Harvard University für genomischen Untersuchungen bei Ausbruch Proben genehmigt. 1. DNase-Behandlung der Proben-RNA (bis zu 55 &amp; mgr; l Extrahierte Gesamt-RNA, ~ 4 h) <ol><li> Stellen Sie die DNase - Reaktion in einer 96-Well PCR - Platte auf Eis in einem Bio - Sicherheitsschrank nach oben , wie in Tabelle 1 beschrieben , </strong&gt;, Schritt 1.1 (Gesamtvolumen 70 ul / Vertiefung). Hinweis: Ein Master-Mix hergestellt werden können. </li><li> Vortex sanft und gründlich, dann bei 280 × g bei RT Zentrifuge für 1 min. </li><li> für 30 min bei 37 ° C inkubieren. </li><li> Cleanup unter Verwendung von RNA Solid Phase Reversible Immobilisation (SPRI) Perlen. <ol><li> Warm RNA Perlen für 30 min auf RT. </li><li> Sanft RNA Perlen Flasche schütteln alle magnetischen Partikel zu suspendieren, die bereits gelöst haben. In 1.8x Volumen (126 ul) von RNA-Perlen zu DNase behandelten RNA (70 &amp; mgr; l), mischen Sie mit einer Pipette 10-mal und Inkubation für 5 min bei RT (Gesamtvolumen in gut 196 ul). </li><li> Setzen Sie Mischung auf dem Magnetstation. Warten, bis die Lösung klar (5 - 10 min). </li><li> Entfernen gelöscht Lösung, während auf der Station mit einer Pipette und entsorgen. Während auf der Station, waschen Perlen durch Pellet mit 70% Ethanol bedeckt und für 1 min inkubiert. Entfernen Ethanol mit Pipette und entsorgen. Wiederholen für insgesamt zwei Waschungen. Hinweis: Die Verwendung genau 70% frisch zubereitet etHANOL ist kritisch, da ein höherer Prozentsatz in ineffizienten Waschen von kleineren Molekülen führen, während &lt;70% Ethanolverlust der Probe 7 führen könnte. </li><li> Halten Sie Platte auf der Station und offen lassen, an der Luft trocknen. Hinweis: Stellen Sie sicher, dass die Kügelchen vollständig trocknen lassen, bis Perlen zu knacken beginnen. </li><li> In 55 ul Nuklease-freies Wasser auf die Platte RNA zu eluieren. Entfernen Platte von der Station die Perlen zu mischen und Wasser durch sorgfältiges Pipettieren. Hinweis: Alternativ können Sie auch weniger Wasser (≤ 10 &amp; mgr; l), um die Gesamt-RNA zu konzentrieren. </li><li> Legen Sie die Platte wieder auf die Station. Warten Sie, bis die Lösung mit einer Pipette auf neue Schraubverschluss Rohr für die Langzeitlagerung (-80 ° C) zu übertragen löscht. Platz 5 ul RNA in neue 96-Well-PCR-Platte zur Abreicherung (Schritt. 2.4). </li><li> Optional:. Speichern und verdünnen 1 ul in 19 &amp; mgr; l Wasser (1:20) für qRT-PCR von rRNA (zB 18S, 28S rRNA) (Tabelle 2) und Virusmarker 5 &lt;/ Li&gt; </ol></li></ol> 2. Selektive Depletion von ribosomalen und Carrier-RNA aus Viral RNA-Probe (ca. 4 h) <ol><li> Machen Sie 5x Hybridisierung und 10x RNase H Reaktionspuffer und nukleasefreiem Wasser mit linearen Acrylamid Träger , wie in Tabelle 1 beschrieben. </li><li> Set up Hybridisierungsreaktion von RNA mit rRNA Verarmungs Oligos (Tabelle 3) und Oligo (dT) auf Eis in einem 96-Well - PCR - Platte kombiniert , wie in Tabelle 1 beschrieben. Hinweis: Ein Master-Mix hergestellt werden können. 50 Femtogramm (fg) einer einzigartigen synthetischen RNA (ERCCs 8) für die Verfolgung sowohl der viralen Sequenzierung und potenziellen Index gelesen Kreuzkontamination hinzugefügt werden. <ol><li> Vortex sanft und gründlich, dann bei 280 × g bei RT Zentrifuge für 1 min. bei 95 ° C inkubieren für 2 min, langsam erhöhende bis 45 ° C bei -0,1 ° C pro sec. Halten Sie den Thermocycler bei 45 ° C. </li></ol></li><li> Richten Sie RNase H-Reaktionsmischung auf Eis, wie beschreibenVorwärmen d in Tabelle 1, dann bei 45 ° C für 2 min. Hinweis: Ein Master-Mix hergestellt werden können. <ol><li> Fügen Sie die vorgewärmte RNase H-Mix in die Hybridisierungsreaktion in der Platte, während die Platte bei 45 ° C in den Thermocycler zu halten. </li><li> Gut mischen durch vorsichtiges Pipettieren 6 - 8 mal. für weitere 30 min bei 45 ° C inkubieren. Legen Sie auf dem Eis. </li></ol></li><li> Stellen Sie die DNase - Reaktionsmischung auf Eis, wie in Tabelle 1 beschrieben . Hinweis: Ein Master - Mix hergestellt werden können. <ol><li> In der RNase H-Reaktion in der Platte, Wirbel sanft und gründlich, dann bei 280 × g bei RT Zentrifuge für 1 min. für 30 min bei 37 ° C inkubieren. </li><li> Stopp DNase Reaktion durch Zugabe von 5 ul 0,5 M EDTA. Vortex sanft und gründlich, dann bei 280 × g bei RT Zentrifuge für 1 min. </li></ol></li><li> Cleanup unter Verwendung von RNA-Kügelchen (siehe Schritt 1.3) mit einem 1,8x Volumen (144 ul) Perlen. Eluieren in 11 ul Nuklease-freies Wasser. Hinweis: Für einen sicheren Kaltlagerung, Lager abgereichertem RNA-Proben bei -80 ° C O / N. </li></ol> 3. cDNA Synthesis (~ 6 h) <ol><li> Mix rRNA / Träger-verarmten RNA mit zufälligen Primern auf Eis in einer 96-Well PCR - Platte , wie in Tabelle 1 beschrieben, Wirbel sanft und gründlich, dann bei 280 × g bei RT Zentrifuge für 1 min. <ol><li> Das Gemisch wird auf 70 ° C für 10 min in einem Thermocycler. Unmittelbar nach Hitzedenaturierung, legen Sie die RNA auf Eis für 1 - 5 min. Nicht in die RNA (auch auf Eis) stehen für länger als 5 Minuten vor dem ersten Strang Reaktion. </li></ol></li><li> Erstes Strangsynthese - Reaktionsmischung auf Eis, wie in Tabelle 1 beschrieben. Hinweis: Ein Master-Mix hergestellt werden können. <ol><li> In den RNA / Random-Primer-Mix in der Platte, Wirbel sanft und gründlich, dann bei 280 × g bei RT Zentrifuge für 1 min. Inkubieren bei 22 - 25 ° C für 10 min. </li><li> bei 55 ° C inkubieren für 60 min in einem Luft Inkubator. Legen Sie die Platte auf Eis, um die Reaktion zu beenden. Nichte: Die Verwendung eines Luft-Inkubator wird empfohlen die Glühung Primern während dessen allmähliche Erwärmung der Erststrang-Reaktion zu erzeugen, und der erste Strang zu dehnen beginnt. </li></ol></li><li> Set Zweitstrangsynthese - Reaktionsmischung auf Eis, wie in Tabelle 1 beschrieben. Hinweis: Ein Master-Mix hergestellt werden können. <ol><li> In den ersten Strangsynthesereaktion in der Platte, Wirbel sanft und gründlich, dann bei 280 × g bei RT Zentrifuge für 1 min. Inkubieren für 2 Stunden bei 16 ° C (halten Deckel bei 25 ° C). Lassen Sie nicht die Temperatur über 16 ° C steigen. </li><li> Legen Sie die Platte auf Eis, dann inaktivieren Reaktion durch Zugabe von 5 ul 0,5 M EDTA, vorsichtig mischen und gründlich, dann Zentrifuge bei 280 × g bei RT für 1 min. </li></ol></li><li> Cleanup mit DNA-Kügelchen (Schritt 1.3 für Protokoll sehen) unter Verwendung von 1,8x Volumen (153 ul) von Perlen. Eluieren in 9 &amp; mgr; l Elutionspuffer (EB). Speichern 1 ul für die Quantifizierung. Verwenden Sie 1 ng cDNA für subsequent Schritte. Wenn cDNA-Konzentration zu niedrig ist, zu erfassen, verwenden 4 ul cDNA für tagmentation (siehe Schritt 4.1). </li><li> Für einen sicheren Kaltlagerung, zu speichern doppelsträngige cDNA bei 4 ° CO / N oder -20 ° C zur Langzeitlagerung. </li></ol> 4. Bibliothek Vorbereitung - DNA Library Construction (~ 4 h) <ol><li> Transfer 4 ul cDNA in eine 96-Well-Platte und die verbleibende cDNA für einen zweiten Versuch zu speichern, wenn nötig. </li><li> Stellen Sie die tagmentation Reaktion auf Eis, wie in Tabelle 1 beschrieben. Hinweis: Ein Master-Mix hergestellt werden können. Um Hintergrund und die Gesamtkosten, das Gesamtvolumen der tagmentation Reaktion reduzieren wird von 20 auf 10 &amp; mgr; l reduziert. Wie cDNA der begrenzende Faktor ist, wird die Menge von ATM verwendet (dh transposome) in der Reaktion ebenfalls verringert die Zahl der Integrationsstellen zu verringern. <ol><li> Hinzufügen tagmentation Mischung cDNA in der Platte, vortex sanft und gründlich und Zentrifuge bei 280 xg (bei RT) für 1 min.Inkubieren bei 55 ° C für 5 min Halten bei 10 ° C. </li><li> Nachdem bei 10 ° C, fügen Sie sofort 2,5 ul Neutralize Tagment Buffer (NT), um die Reaktion zu beenden. Mischen durch Pipettieren von oben und unten, dann Zentrifuge bei 280 xg (bei RT) für 1 min. </li><li> 5 min bei RT inkubiert. </li></ol></li><li> Set up PCR Amplifikationsreaktion auf Eis , wie in Tabelle 1 beschrieben. <ol><li> Vortex sanft und gründlich, dann bei 280 × g bei RT Zentrifuge für 1 min. </li><li> Führen PCR auf Thermocycler unter Verwendung der Bedingungen , die in Tabelle 1. Hinweis: 12 PCR-Zyklen werden für 1 ng cDNA tagmented vorgeschlagen; jedoch virale klinischen Proben haben oft nicht nachweisbar Mengen an cDNA. Für geringe Mengen an cDNA (&lt;1 ng), verwenden Sie bis 18 PCR-Zyklen bis genug Bibliothek für die Sequenzierung erstellen. </li></ol></li><li> Bibliothek Vorbereitung - Bereinigung und Bündelung für die Sequenzierung <ol><li> Bringen Probe bis zu 50 &amp; mgr; l mit EB. </li><li> Cleanup mitDNA-Kügelchen (Schritt 1.3 für Protokoll sehen) unter Verwendung von 0,6x Volumen (30 ul) Perlen. Eluieren in 15 ul EB. </li><li> Die Konzentration der Bibliothek (Abbildung 3) durch die Durchführung Bereichsanalyse (150 bis 1.000 bp) mit Bioanalyzer Software 9, ohne Primer - Dimere (~ 120 bp) aus der Region Analyse. Hinweis: Alternativ können qPCR verwendet werden , um Bibliotheken zu quantifizieren 10. </li><li> Pool-Bibliotheken auf der niedrigsten molaren Konzentration von 1 nM oder mehr beträgt. Wenn Bibliothek unter 1 nM ist, fügen Sie ein kleines Volumen von Bibliothek Pool (~ 1x Volumen von anderen Bibliotheken) Sequenzinformationen aus diesen Bibliotheken zu erfassen. </li><li> Cleanup-Pool mit 0,7x DNA Perlen wie oben beschrieben (siehe Schritt 2). Eluieren in 15 ul EB. Hinweis: Volumen der Perlen auf dem endgültigen Volumen des Beckens ab. </li><li> Analysieren Pool 9. Bestimmen Sie molare Konzentration nach Regionen Analyse der Durchführung (150 bis 1.000 bp) 9. Hinweis: Alternativ können qPCR verwendet werden Bibliothek Pool zu quantifizieren 10 &lt;/ Sup&gt;. </li><li> Last - Sequenzer auf 10.00 Uhr Bibliothek Konzentration 101 bp zu erzeugen, gepaart-End liest mit Dual - Barcode 11 liest. </li></ol></li></ol><img alt="Figur 3" src="/files/ftp_upload/54117/54117fig3.jpg" /> Abbildung 3. Bibliotheken Hergestellt aus Ebola Virus klinischen Proben. Gel - Bild von 4 repräsentativen Ebola - Virus (EBOV) Bibliotheken. Regionen der Bibliothek und der Primer - Dimere werden angezeigt. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/54117/54117fig3large.jpg" target="_blank">Bitte hier klicken</a> , um <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/54117/54117fig3large.jpg" target="_blank">eine größere Version dieser Figur zu sehen.</a>

<ol>
	<li>Stremlau, M. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+novel+rhabdoviruses+in+the+blood+of+healthy+individuals+from+West+Africa.">Discovery of novel rhabdoviruses in the blood of healthy individuals from West Africa.</a> PLoS Negl Trop Dis. 9, e0003631 (2015).</li><li>Gire, S. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomic+surveillance+elucidates+Ebola+virus+origin+and+transmission+during+the+2014+outbreak.">Genomic surveillance elucidates Ebola virus origin and transmission during the 2014 outbreak.</a> Science. 345, 1369-1372 (2014).</li><li>Morlan, J. D., Qu, K., Sinicropi, D. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+depletion+of+rRNA+enables+whole+transcriptome+profiling+of+archival+fixed+tissue.">Selective depletion of rRNA enables whole transcriptome profiling of archival fixed tissue.</a> PLoS One. 7, e42882 (2012).</li><li>Park, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ebola+Virus+Epidemiology,+Transmission,+and+Evolution+during+Seven+Months+in+Sierra+Leone.">Ebola Virus Epidemiology, Transmission, and Evolution during Seven Months in Sierra Leone.</a> Cell. 161, 1516-1526 (2015).</li><li>Andersen, K. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical+Sequencing+Uncovers+Origins+and+Evolution+of+Lassa+Virus.">Clinical Sequencing Uncovers Origins and Evolution of Lassa Virus.</a> Cell. 162, 738-750 (2015).</li><li>Matranga, C. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhanced+methods+for+unbiased+deep+sequencing+of+Lassa+and+Ebola+RNA+viruses+from+clinical+and+biological+samples.">Enhanced methods for unbiased deep sequencing of Lassa and Ebola RNA viruses from clinical and biological samples.</a> Genome Biol. 15, 519 (2014).</li><li>Tang, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-Seq+analysis+to+capture+the+transcriptome+landscape+of+a+single+cell.">RNA-Seq analysis to capture the transcriptome landscape of a single cell.</a> Nat Protoc. 5, 516-535 (2010).</li><li>Jiang, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+spike-in+standards+for+RNA-seq+experiments.">Synthetic spike-in standards for RNA-seq experiments.</a> Genome Res. 21, 1543-1551 (2011).</li><li>. Kapa Biosystems Available from: <a target="_blank" href="https://www.kapabiosystems.com/product-applications/products/next-generation-sequencing-2/library-quantification/">https://www.kapabiosystems.com/product-applications/products/next-generation-sequencing-2/library-quantification/</a> (2015)</li><li>. Illumina Technologies Available from: <a target="_blank" href="https://support.illumina.com/content/dam/illumina-support/documents/documentation/system_documentation/miseq/preparing-libraries-for-sequencing-on-miseq-15039740-d.pdf">https://support.illumina.com/content/dam/illumina-support/documents/documentation/system_documentation/miseq/preparing-libraries-for-sequencing-on-miseq-15039740-d.pdf</a> (2015)</li><li>Kircher, M., Sawyer, S., Meyer, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Double+indexing+overcomes+inaccuracies+in+multiplex+sequencing+on+the+Illumina+platform.">Double indexing overcomes inaccuracies in multiplex sequencing on the Illumina platform.</a> Nucleic Acids Res. 40, 3 (2012).</li><li>Trombley, A. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comprehensive+panel+of+real-time+TaqMan+polymerase+chain+reaction+assays+for+detection+and+absolute+quantification+of+filoviruses,+arenaviruses,+and+New+World+hantaviruses.">Comprehensive panel of real-time TaqMan polymerase chain reaction assays for detection and absolute quantification of filoviruses, arenaviruses, and New World hantaviruses.</a> Am J Trop Med Hyg. 82, 954-960 (2010).</li><li>Hu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serial+high-resolution+analysis+of+blood+virome+and+host+cytokines+expression+profile+of+a+patient+with+fatal+H7N9+infection+by+massively+parallel+RNA+sequencing.">Serial high-resolution analysis of blood virome and host cytokines expression profile of a patient with fatal H7N9 infection by massively parallel RNA sequencing.</a> Clin Microbiol Infect. 21, 713 (2015).</li><li>Simon-Loriere, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+lineages+of+Ebola+virus+in+Guinea+during+the+2014+West+African+epidemic.">Distinct lineages of Ebola virus in Guinea during the 2014 West African epidemic.</a> Nature. 524, 102-104 (2015).</li><li>Folarin, O. A., Happi, A. N., Happi, C. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Empowering+African+genomics+for+infectious+disease+control.">Empowering African genomics for infectious disease control.</a> Genome Biol. 15, 515 (2014).</li><li>Blainey, P. C., Quake, S. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+MDA+for+enumeration+of+total+nucleic+acid+contamination.">Digital MDA for enumeration of total nucleic acid contamination.</a> Nucleic Acids Res. 39, 19 (2011).</li><li>Malboeuf, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Complete+viral+RNA+genome+sequencing+of+ultra-low+copy+samples+by+sequence-independent+amplification.">Complete viral RNA genome sequencing of ultra-low copy samples by sequence-independent amplification.</a> Nucleic Acids Res. 41, 13 (2013).</li><li>Gonzalez, I. L., Sylvester, J. E., Smith, T. F., Stambolian, D., Schmickel, R. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ribosomal+RNA+gene+sequences+and+hominoid+phylogeny.">Ribosomal RNA gene sequences and hominoid phylogeny.</a> Mol Biol Evol. 7, 203-219 (1990).</li><li>Adiconis, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+analysis+of+RNA+sequencing+methods+for+degraded+or+low-input+samples.">Comparative analysis of RNA sequencing methods for degraded or low-input samples.</a> Nat Methods. 10, 623-629 (2013).</li></ol>

The authors have no competing financial interests.

Das skizzierte Ansatz ermöglicht robuste, universelle, schnelle Sequenzierung und wurde zur Sequenzierung von Ebola - Virus während der 2014 Ausbruch 2,4 verwendet. Durch die Kopplung selektive Depletion und cDNA-Synthese mit tagmentation Bibliothekskonstruktion wurde die Gesamtprozesszeit um ~ 2 Tage reduziert von früheren Methoden Adaptorligation. In jüngerer Zeit wurde dieses Protokoll , das von internationalen Mitarbeiter und andere mit großem Erfolg 15,16 und wird eingesetzt , um Labors in Westafrika zu unterstützen lokale Genomik-basierte Studien und Diagnostik 17 eingesetzt. Das hier beschriebene Protokoll verwendet Zufallsprimer cDNA-RNA-seq-Bibliotheken für die virale vorzubereiten. Im Gegensatz zu früheren viralen RNA-seq Ansätze, es erfordert keine a priori Kenntnis von Sequenzdaten oder aufwendige und zeitraubende Primerdesign für einen bestimmten Virus oder Klade. Das Verfahren kann auf jede viral RNA Probe angewendet werden. Beispielsweise wurde es verwendet, viralen Gehalt von sowohl Ebola zu erzeugenund Lassa Proben 6. Das Protokoll kann auch Projekte für Host transkriptomischen, Metagenom und Erreger Entdeckung Sequenzierung 1 verwendet werden. Ein kritischer Schritt des Protokolls wird RNase H Verdau gezielte, ein Hochdurchsatz, kostengünstiges Verfahren zum Entfernen von unerwünschten Träger- und Host-RNA aus viralen Proben. Die selektive Depletion Schritt des Protokolls verwendet viele Komponenten und erfordert Geschicklichkeit und Genauigkeit. Extra-Zeit und Sorgfalt sollte bei der Ersteinrichtung genommen werden. Da die meisten klinischen Serum- und Plasmaproben oft sehr wenig Nukleinsäurematerial aufweisen, sind Verunreinigungen und Probenverlust gemeinsam. Um diese Probleme zu vermeiden, sollten Sie besonders vorsichtig sein, wenn dieses Protokoll verwenden. Zunächst wird RNA sehr anfällig für Degradation; Daher sollten alle Bereiche sauber und frei von Nukleasen sein. Zweitens, um Proben zu identifizieren geeignet für den Einsatz in diesem Protokoll qRT-PCR - Assays für sowohl Wirts - RNA und Virus sollte zur Quantifizierung 5,6 verwendet werden </sup&gt;. Wenn der Eingang Vergleich beträgt mit Sequenzierung ergibt sich aus dem Protokoll, Sequenzierung Erfolg (dh die Erzeugung von genügend Daten für die vollständige virale Montage) korreliert mit Proben , die mindestens 100 pg Gesamt - RNA und 1.000 Kopien des Virus enthalten. Drittens Einwirkung von Umweltquellen von Nukleinsäuren sollten vermieden werden. Das Protokoll hier skizzierte in einem Biosicherheitsschrank für Sicherheitsvorkehrungen durchgeführt und zur Begrenzung der Umweltschadstoffe. Darüber hinaus haben unsere Gruppe und anderen bemerkt , dass kommerzielle Enzyme bakterielle Nukleinsäuren in niedrigen Eingangsproben von verunreinigenden 6,18 eine andere Quelle sein kann. Die Verwendung eines sauberen Arbeitsplatz (zB PCR - Haube, biologische Sicherheit Kabinett) und Negativkontrollen (zB Wasser oder Puffer) wird dazu beitragen , lindern und Verschmutzung zu verfolgen sind. Bei Proben mit &lt;100 pg Gesamt-RNA, nur Poly (rA) Carrier-RNA, nicht rRNA, sollte eine hohe Qualität Sequenzierergebnisse erschöpft sein, um sicherzustellen, während Materialverlust zu begrenzen. Für sehrniedrige Eingangsproben cDNA-Amplifikationsverfahren können 19 besser geeignet sein, obwohl Poly (rA) Träger sollte vor der cDNA - Synthese entfernt werden. Die Abreicherung von Wirts rRNA reichert für virale Gehalt in Sequenzierungsbibliotheken und ist anwendbar auf verschiedene Probensammlungen einschließlich Serum oder Plasma, und mehrere Arten von Gewebe von Nagern und nicht-menschlichen Primaten 5,6. In nicht-menschlichen Organismen, liest Ausrichten zu 28S rRNA nach Erschöpfung blieb, was darauf hindeutet 28S rRNA ist weniger konserviert zwischen Menschen und anderen Spezies 6,20. Bei Verwendung dieser Methode mit nicht-humanen Isolate, kann es notwendig sein , mit DNA - Oligos zu ergänzen , die komplementär zu den divergierenden rRNA - Sequenzen der spezifischen Wirts 3,21. Da das Protokoll unvoreingenommen ist, liest virale nur einen kleinen Bruchteil der gesamten Bibliothek Inhalt darstellen. Obwohl rRNA ist die häufigste Art des Wirts RNA und nur ein kleiner Prozentsatz der rRNA liest (0; 1%) werden nach der selektiven Erschöpfung, alle anderen Wirts - RNA (zB mRNA) bleiben nach Erschöpfung und Konto kann für viele Sequenzierung liest aus der Probe gefunden. Daher &quot;Überabtasten&quot; (dh oversequencing) wird einzelne Bibliotheken benötigt , um für Anrufe virale Montage und Variante genügend Deckung zu haben. Für unsere Studien versuchen wir zu Folge ~ 20 Millionen liest pro Probe 2,5 ausreichende Tiefe für die Analyse von viralen genomischen und die damit verbundenen Varianten sowie metagenomic Inhalt zu haben. Für metagenomic und Studien Entdeckung pathogen ist es wichtig, dass kontaminierende Wirts-DNA zu beachten, durch DNase-Verdau entfernt. Daher Viren und andere Pathogene, die DNA-Genome enthalten kann während des Prozesses jedoch RNA Zwischenprodukte können noch sequenzierenden verloren.

Next Generation Sequenzierung von Viren aus klinischen Quellen kann die Übertragung und die Epidemiologie von Infektionen informieren, sowie dazu beitragen, Unterstützung neuer diagnostischer, Impfstoff und therapeutische Entwicklung. cDNA - Synthese unter Verwendung von Zufallsprimer hat den Nachweis und die Montage von Genomen von divergent, Coinfizierung oder auch neuartige Viren 1,2 erlaubt. Wie bei anderen unvoreingenommene Methoden, besetzen unerwünschte Verunreinigungen viele Sequenzierung liest und negativ Sequenzierungsergebnisse auswirken. Host-und Poly (rA) Carrier-RNA sind Verunreinigungen, die in vielen bestehenden viralen Musterkollektionen. Das Protokoll beschreibt eine effiziente und kostengünstige Möglichkeit der tiefen Sequenzierung Genomen RNA Virus basiert auf unvoreingenommene total RNA-seq. Das Verfahren nutzt eine RNase H selektive Depletion Schritt 3 unerwünschte Wirt ribosomalen und Carrier - RNA zu entfernen. Selektive Depletion reichert für virale Gehalt (Abbildung 1) und verbessert die Gesamtqualität der Sequenzierungsdaten(Abbildung 2) aus klinischen Proben. Außerdem wird tagmentation dem Protokoll angewendet, wie es deutlich Bibliothek Bauzeit reduziert. Diese Methoden wurden verwendet , um schnell große Datenmengen von Ebola und Lassa - Virus - Genome 2,4,5 erzeugen und kann verwendet werden , um ein breites Spektrum von RNA - Viren zu untersuchen. Schließlich wird der Ansatz nicht auf menschlichen Proben beschränkt; Die Nützlichkeit der selektive Depletion wurde auf Gewebeproben von Lassa-infizierte Nager und nicht-menschlichen Primaten - Krankheitsmodellen 5,6 gesammelt gezeigt. <img alt="Abbildung 1" src="/files/ftp_upload/54117/54117fig1.jpg" /> Abbildung 1. Die Gesamt - RNA Inhalt Reflektiert Anreicherung von Lassa - Virus von Inhalt mit Selective Depletion. Beginnend Gesamtinhalt (RNA - Eingang) und Anreicherung von einzigartigen Lassa - Virus (LASV) liest (Library Inhalt) auf rRNA Depletion von neun verschiedenen klinischen Isolaten. Diese Zahl wurde von 6 geändert <em&gt;. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/54117/54117fig1large.jpg" target="_blank">Bitte hier klicken</a> , um <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/54117/54117fig1large.jpg" target="_blank">eine größere Version dieser Figur zu sehen.</a> <img alt="Figur 2" src="/files/ftp_upload/54117/54117fig2.jpg" /> Abbildung 2. Höhere Qualität Sequenzierung Nach Carrier - RNA Depletion. Median Basisqualitäten pro Sequenzierzyklus von Poly (rA) -contaminated Bibliotheken Lassa - Virus (rot) und Kontrolle (kein Träger in der Bibliothek beobachtet, schwarz) von QC - Bericht 13. Beide lesen 1 und 2 gelesen gepaarter Ende liest in der Bibliothek BAM-Datei zusammengefügt und die Qualitätswerte werden an jeder Basis gezeigt. Diese Zahl hat sich von 6 geändert. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/54117/54117fig2large.jpg" target="_blank">Bitte klicken Sie hier</a> , um <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/54117/54117fig2large.jpg" target="_blank">eine größere Version dieser Figur zu sehen.</a> Die virale RNA-seq Protokoll Details Bau von Bibliotheken direkt aus extrahiertenRNA gesammelt aus klinischen und biologischen Proben. Um sicherzustellen, dass die persönliche Sicherheit, alle viralen Serum, Plasma und Gewebeproben sollten in geeigneten Puffern vor der RNA-Extraktion inaktiviert werden. In einigen Inaktivierung und Extraktion-Kits, Träger Poly (rA) RNA ist im Preis inbegriffen; Dies wird während der anfänglichen RNase H selektive Depletion Schritt entfernt werden. Basierend auf vollständige Genesung, ist die erwartete Konzentration von Carrier-RNA 100 ng / ul. In dem Protokoll, 110 ng / &amp; mgr; l Oligo-dT-RNA (1.1x Ladungsträgerkonzentration), zur Abreicherung eingesetzt. Wenn Poly (rA) Träger nicht in der Probe vorhanden ist, dann Oligo (dT) nicht hinzugefügt, um Erschöpfung vor werden. Das folgende Protokoll wird für 24 Reaktionen in PCR-Plattenformat ausgelegt (bis zu 250 &amp; mgr; l Volumen). Eine frühere Version dieses Protokolls wurde in Matranga, et al. 6.

<table><tbody><tr><td>96-well PCR Plates</td><td>VWR</td><td>47743-953</td><td></td></tr><tr><td>Strips of Eight Caps</td><td>VWR</td><td>47745-512</td><td></td></tr><tr><td>Nuclease-free water</td><td>Ambion</td><td>AM9937</td><td>50 ml bottle</td></tr><tr><td>TURBO DNase</td><td>Ambion</td><td>AM2238</td><td>post RNA extraction step, 2 U/&amp;micro;l, buffer included</td></tr><tr><td>PCR cycler</td><td></td><td></td><td>any PCR cyclers&amp;nbsp;</td></tr><tr><td>Agencourt RNAClean XP SPRI beads&amp;nbsp;</td><td>Beckman Coulter Genomics</td><td>A63987</td><td>beads for RNA cleanup</td></tr><tr><td>Real Time qPCR system</td><td></td><td></td><td>any system</td></tr><tr><td>DynaMag-96 Side Skirted Magnet</td><td>Invitrogen</td><td>12027</td><td></td></tr><tr><td>70% Ethanol</td><td></td><td></td><td>prepare fresh</td></tr><tr><td>qRT-PCR primers</td><td>IDT DNA</td><td></td><td>see &lt;strong&gt;Table 2&lt;/strong&gt;</td></tr><tr><td>5 M NaCl&amp;nbsp;</td><td>Ambion</td><td>AM9760G</td><td></td></tr><tr><td>1 M Tris-HCl pH 7.4&amp;nbsp;</td><td>Sigma</td><td>T2663-1L</td><td></td></tr><tr><td>1 M Tris-HCl pH 7.5&amp;nbsp;</td><td>Invitrogen</td><td>15567-027</td><td></td></tr><tr><td>1 M MgCl&lt;sub&gt;2&lt;/sub&gt;&amp;nbsp;</td><td>Ambion</td><td>AM9530G</td><td></td></tr><tr><td>Linear acrylamide&amp;nbsp;</td><td>Ambion&amp;nbsp;</td><td>AM9520</td><td></td></tr><tr><td>DNA oligos covering entire rRNA region</td><td>IDT DNA</td><td></td><td>see &lt;strong&gt;Table 3&lt;/strong&gt;, order lab-ready at 100 &amp;micro;M</td></tr><tr><td>Oligo (dT)</td><td>IDT DNA</td><td></td><td>40 nt long, desalted</td></tr><tr><td>Hybridase Thermostable RNase H&amp;nbsp;</td><td>Epicentre</td><td>H39100</td><td></td></tr><tr><td>RNase-free DNase Kit&amp;nbsp;</td><td>Qiagen</td><td>79254</td><td>post selective depletion step</td></tr><tr><td>SUPERase-In RNase Inhibitor</td><td>Ambion</td><td>AM2694</td><td></td></tr><tr><td>Random Primers&amp;nbsp;</td><td>Invitrogen</td><td>48190-011</td><td>mostly hexamers</td></tr><tr><td>10 mM dNTP mix</td><td>New England Biolabs</td><td>N0447L</td><td></td></tr><tr><td>SuperScript III Reverse Transcriptase&amp;nbsp;</td><td>Invitrogen</td><td>18080-093</td><td>with first-strand buffer, DTT</td></tr><tr><td>Air Incubator</td><td></td><td></td><td>any air incubator cyclers&amp;nbsp;</td></tr><tr><td>NEBNext Second Strand Synthesis (dNTP-free) Reaction Buffer</td><td>New England Biolabs</td><td>B6117S</td><td>10x</td></tr><tr><td>&lt;em&gt;E. coli&lt;/em&gt; DNA Ligase</td><td>New England Biolabs</td><td>M0205L</td><td>10 U/&amp;mu;l</td></tr><tr><td>&lt;em&gt;E. coli&lt;/em&gt; DNA Polymerase I&amp;nbsp;</td><td>New England Biolabs</td><td>M0209L</td><td>10 U/&amp;mu;l</td></tr><tr><td>&lt;em&gt;E. coli&lt;/em&gt; RNase H</td><td>New England Biolabs</td><td>M0297L</td><td>2 U/&amp;mu;l</td></tr><tr><td>0.5 M EDTA</td><td>Ambion</td><td>AM9261</td><td></td></tr><tr><td>Agencourt AMPure XP SPRI beads</td><td>Beckman Coulter Genomics</td><td>A63881</td><td>beads for DNA cleanup</td></tr><tr><td>Elution Buffer&amp;nbsp;</td><td>Qiagen</td><td></td><td>10 mM Tris HCl, pH 8.5</td></tr><tr><td>Quant-iT dsDNA HS Assay Kit&amp;nbsp;</td><td>Invitrogen</td><td>Q32854</td><td></td></tr><tr><td>Qubit fluorometer&amp;nbsp;</td><td>Invitrogen</td><td>Q32857</td><td></td></tr><tr><td>Nextera XT DNA Sample Prep Kit&amp;nbsp;</td><td>Illumina</td><td>FC-131-1096</td><td></td></tr><tr><td>Nextera XT DNA Index Kit&amp;nbsp;</td><td>Illumina</td><td>FC-131-1001</td><td></td></tr><tr><td>Tapestation 2200</td><td>Agilent</td><td>G2965AA</td><td></td></tr><tr><td>High Sensitivity D1000 reagents</td><td>Agilent</td><td>5067-5585</td><td></td></tr><tr><td>High Sensitivity D1000 ScreenTape</td><td>Agilent</td><td>5067-5584</td><td></td></tr><tr><td>BioAnalyzer 2100&amp;nbsp;</td><td>Agilent</td><td>G2939AA</td><td></td></tr><tr><td>High Sensitivity DNA reagents</td><td>Agilent</td><td>5067-4626</td><td></td></tr><tr><td>Library Quantification Complete kit (Universal)</td><td>Kapa Biosystems</td><td>KK4824</td><td>alternative to tapestation, bioanalyzer for library quantification</td></tr></tbody></table>

unbiased deep sequencing of rna viruses from clinical samples

Hier beschreiben wir eine Next-Generation - RNA - Sequenzierung Protokoll , das de novo Assemblierung und intra-Host - Variante Anrufe von viralen Genomen von klinischen und biologischen Quellen gesammelt werden können. Die Methode ist unvoreingenommen und universell; es verwendet zufällige Primer für die cDNA-Synthese und erfordert keine vorherige Kenntnis der viralen Sequenz Gehalt. Vor dem Aufbau der Bibliothek, selektive RNase H-basierte Verdauung wird verwendet, um unerwünschte RNA zu führen - einschließlich Poly (rA) Träger und ribosomale RNA - von der viralen RNA-Probe. Selective Depletion verbessert sowohl die Datenqualität und die Anzahl der eindeutigen liest in der viralen RNA-Sequenzierung Bibliotheken. Darüber hinaus ist ein Transposase-basierten &#39;tagmentation&#39; Schritt wird in dem Protokoll verwendet wird, wie es allgemeine Bibliothek Bauzeit reduziert. Das Protokoll hat eine rasante tiefe Sequenzierung von mehr als 600 Lassa und Ebola-Virusproben-Sammlungen einschließlich aktiviert sowohl von Blut und Gewebe isoliert-und ist im Großen und Ganzen auf andere mikrobielle Genomstudien.

Das beschriebene Protokoll ermöglicht die Erzeugung von qualitativ hochwertigen Sequenzierung liest aus Low-Input-Virus-RNA-Proben, während für einzigartige virale Inhalte zu bereichern. Wie in Abbildung 1 gezeigt, angereichert das Protokoll einzigartige Inhalte Lassa - Virus mindestens fünffach in allen Proben ( im Vergleich zu nicht-verarmte Kontrollen) mit mindestens einer Million Kopien von 18S rRNA (~ 100 pg Gesamt - RNA). Ebenso Sequenzierungs Erfolg auch mit der Menge des Virus in einer gegebenen Probe korreliert. Verwendung qRT-PCR als Surrogat für die Virusmenge, die Proben enthielten ~ 1.000 oder mehr viralen Genomkopien meist vollständige Baugruppen erstellt (Daten nicht gezeigt). Darüber hinaus Abreicherung von Poly (rA) Träger reduziert Homopolymer - Sequenzen A und T in Bibliotheken, in sauberer Vorbereitungen resultierende und eine bessere Qualität Sequenzierung sichergestellt liest (Abbildung 2). Endgültige Bibliotheken von extensiven viralen klinischen Proben haben oft ein breites Fragment Länge von 150 bis 1000 bp(Abbildung 3). Nach der Sequenzierung Probe misidentification und Übersprechens zwischen Bibliotheken innerhalb eines Pools 12, nur Index liest mit einer Basisqualitätsfaktor von 25 (q25) und sicherzustellen , Null - Fehlpaarungen gehalten werden während des Demultiplexprozess zu reduzieren. Virale Genome werden mit einer Bioinformatik Pipeline spezifisch für divergent Viren 2,4-6 montiert. Diese Werkzeuge sind in https://github.com/broadinstitute/viral-ngs oder durch kommerzielle Cloud - Plattformen 4. <table border="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Schritt 1.1: DNase Reaktion </td><td></td></tr><tr><td> Reagens </td><td> Volumen pro Reaktion (ul) </td></tr><tr><td> 10x DNase Puffer </td><td> 7 </td></tr><tr><td> Nuklease-freies Wasser </td><td> 6 </td></tr><tr><td> Heraus viralen RNA </td><td> 55 </td></tr><tr><td> DNase (2 U / &amp; #181; l) </td><td> 2 </td></tr><tr><td> Volle Lautstärke </td><td> 70 </td></tr><tr><td> Schritt 2.1: 5x Hybridisierungspuffer </td><td></td></tr><tr><td> Reagens </td><td> Volume 1 ml (ul) </td></tr><tr><td> 5 M NaCl </td><td> 200 </td></tr><tr><td> 1 M Tris-HCl (pH 7,4) </td><td> 500 </td></tr><tr><td> Nuklease-freies Wasser </td><td> 300 </td></tr><tr><td> Volle Lautstärke </td><td> 1000 </td></tr><tr><td> Schritt 2.1: 10x RNase H - Reaktionspuffer </td><td></td></tr><tr><td> Reagens </td><td> Volume 1 ml (ul) </td></tr><tr><td> 5 M NaCl </td><td> 200 </td></tr><tr><td> 1 M Tris-HCl (pH 7,5) </td><td> 500 </td></tr><tr><td> 1 M MgCl 2 </td><td> 200 </td></tr><tr><td> Nuklease-freies Wasser </td><td> 500 </td></tr><tr><td> Volle Lautstärke </td><td> 1000 </td></tr><tr><td> Schritt 2.1: Wasser wi-ten linearen Acrylamid </td><td></td></tr><tr><td> Reagens </td><td> Volume 1 ml Puffer (ul) </td></tr><tr><td> Nuklease-freies Wasser </td><td> 992 </td></tr><tr><td> Lineares Acrylamid (5 mg / ml) </td><td> 8 </td></tr><tr><td> Volle Lautstärke </td><td> 1000 </td></tr><tr><td colspan="2"> Schritt 2.2: Hybridisierungsreaktion für die selektive Depletion </td></tr><tr><td> Reagens </td><td> Volumen pro Reaktion (ul) </td></tr><tr><td> 5x Hybridisierungspuffer </td><td> 2 </td></tr><tr><td> rRNA-Depletion oligo-Mix (100 uM) </td><td> 1,22 </td></tr><tr><td> Oligo (d) T (550 ng / ul) </td><td> 1 </td></tr><tr><td> DNase-behandelte Gesamt-RNA </td><td> bis zu 5 </td></tr><tr><td> Spike-in-RNA (Dies ist optional) </td><td> 0,5 </td></tr><tr><td> Wasser (mit linearen acrylamid) </td><td> bringen bis zu 10 Gesamt </td></tr><tr><td> insgesamt Volumich </td><td> 10 </td></tr><tr><td colspan="2"> Schritt 2.3: RNase H - Reaktion für die selektive Depletion </td></tr><tr><td> Reagens </td><td> Volumen pro Reaktion (ul) </td></tr><tr><td> 10x RNase H Reaction Buffer </td><td> 2 </td></tr><tr><td> Wasser (mit linearen acrylamid) </td><td> 5 </td></tr><tr><td> Thermostabile RNase H (5 U / ul) </td><td> 3 </td></tr><tr><td> Volle Lautstärke </td><td> 10 </td></tr><tr><td colspan="2"> Schritt 2.4: DNase Reaktion Post selektive Depletion </td></tr><tr><td> Reagens </td><td> Volumen pro Reaktion (ul) </td></tr><tr><td> 10x DNase Buffer </td><td> 7.5 </td></tr><tr><td> Wasser (mit linearen acrylamid) </td><td> 44.5 </td></tr><tr><td> RNase-Inhibitor (20 U / ul) </td><td> 1 </td></tr><tr><td> RNase-freie DNase I (2,72 U / ul) </td><td> 2 </td></tr&gt; <tr><td> Das Gesamtvolumen (mit RNase H-Reaktion) </td><td> 75 </td></tr><tr><td colspan="2"> Schritt 3.1: cDNA - Synthese, Random - Primer - Hybridisierung </td></tr><tr><td> Reagens </td><td> Volumen pro Reaktion (ul) </td></tr><tr><td> rRNA / Träger-verarmten RNA </td><td> 10 </td></tr><tr><td> 3 ug Zufallsprimer </td><td> 1 </td></tr><tr><td> Volle Lautstärke </td><td> 11 </td></tr><tr><td> Schritt 3.2: Der erste Strang der cDNA - Synthesereaktion </td><td></td></tr><tr><td> Reagens </td><td> Volumen (ul) </td></tr><tr><td> 5x First Strand Reaction Buffer </td><td> 4 </td></tr><tr><td> 0,1 M DTT </td><td> 2 </td></tr><tr><td> 10 mM dNTP mix </td><td> 1 </td></tr><tr><td> RNase-Inhibitor (20 U / ul) </td><td> 1 </td></tr><tr><td> Reverse-Transkriptase (hinzufügen letzte) </td><td> 1 </td></tr><tr><td> Das Gesamtvolumen (mit RNA oben) &lt;/ Td&gt; <td> 20 </td></tr><tr><td colspan="2"> Schritt 3.3: Zweiter Strang cDNA - Synthesereaktion </td></tr><tr><td> Reagens </td><td> Volumen (ul) </td></tr><tr><td> RNase-freies Wasser </td><td> 43 </td></tr><tr><td> 10x Second-Strand Reaction Buffer </td><td> 8 </td></tr><tr><td> 10 mM dNTP mix </td><td> 3 </td></tr><tr><td> E. coli DNA - Ligase (10 U / ul) </td><td> 1 </td></tr><tr><td> E. coli DNA Polymerase I (10 U / ul) </td><td> 4 </td></tr><tr><td> E. coli RNase H (2 U / ul) </td><td> 1 </td></tr><tr><td> Das Gesamtvolumen (mit 1. Strang - Reaktion) </td><td> 80 </td></tr><tr><td> Schritt 4.2: Tagmentation Reaktion </td><td></td></tr><tr><td> Reagens </td><td> Volumen (ul) </td></tr><tr><td> Amplicon Tagment Mix (ATM) </td><td> 1 </td></tr><tr><td> Tagment DNA-Puffer (TD) </td&gt; <td> 5 </td></tr><tr><td> Das Gesamtvolumen (mit cDNA) </td><td> 10 </td></tr><tr><td> Schritt 4.3: Bibliothek PCR - Reaktion </td><td></td></tr><tr><td> Reagens </td><td> Volumen (ul) </td></tr><tr><td> PCR Master Mix (NPM) </td><td> 7.5 </td></tr><tr><td> Index 1 Primer (i7) </td><td> 2.5 </td></tr><tr><td> Index 2 Primer (i5) </td><td> 2.5 </td></tr><tr><td> Das Gesamtvolumen (mit tagmented cDNA) </td><td> 25 </td></tr><tr><td> Schritt 4.3.2: Bibliothek PCR - Bedingungen </td><td></td></tr><tr><td> 72 ° C, 3 min </td><td></td></tr><tr><td> 95 ° C, 30 sec </td><td></td></tr><tr><td colspan="2"> bis zu 18 Zyklen-10 sec bei 95 ° C, 30 sec bei 55 ° C, 30 sec bei 72 ° C </td></tr><tr><td> 72 ° C, 5 min </td><td></td></tr><tr><td> 10 ° C, für immer </td><td></td></tr></tbody></table>Tabelle 1:. Reaction Set-up und Puffer Schritt- für -Schritt - Tabellen mit Inhalten aller Puffer und Reaktionsmischungen. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Oligo - Name </td><td> Sequenz (5 &#39;bis 3&#39;) </td></tr><tr><td> Ebola KGH FW </td><td> GTCGTTCCAACAATCGAGCG </td></tr><tr><td> Ebola KGH RV </td><td> CGTCCCGTAGCTTTRGCCAT </td></tr><tr><td> Ebola kulesh FW </td><td> TCTGACATGGATTACCACAAGATC </td></tr><tr><td> Ebola kulesh RV </td><td> GGATGACTCTTTGCCGAACAATC </td></tr><tr><td> Lassa SL FW </td><td> GTA AGC CCA GCD GYA AAB CC </td></tr><tr><td> Lassa SL RV </td><td> AAG CCA CAG AAA RCT GGS AGC A </td></tr><tr><td> 18S rRNA FW </td><td> TCCTTTAACGAGGATCCATTGG </td></tr><tr><td> 18S rRNA RV </td><td> CGAGCTTTTTAACTGCAGCAACT </td></tr></tbody></tLage&gt; Tabelle 2: qRT-PCR - Primer - Sequenzen Primer für die Messung Host (18S rRNA) und virale (Ebola und Lassa) Inhalt.. &quot;KGH&quot; ist Kenema Regierungskrankenhaus in Sierra Leone, wo die Ebola - Primer 2 getestet wurden. &#39;Kulesh&#39; ist der Ermittler, der Primer 14 gesetzt entworfen. Tabelle 3: ribosomale RNA (rRNA) Depletion Oligos 195 50 Nukleotide lange Sequenzen , die komplementär zu menschlicher rRNA für die selektive Depletion Schritt 6.. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/54117/Table_3.xlsx" target="_blank">Bitte hier klicken</a> , um <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/54117/Table_3.xlsx" target="_blank">diese Datei herunterzuladen.</a>

Watch this Scientific Journal Video about Unbiased Deep Sequencing of RNA Viruses from Clinical Samples at JoVE.com

Unbiased Deep Sequencing of RNA Viruses from Clinical Samples

This protocol describes a rapid and broadly applicable method for unbiased RNA-sequencing of viral samples from human clinical isolates.

Unvoreingenommene Tiefe Sequenzierung von RNA-Viren aus klinischen Proben

Here we outline a next-generation RNA sequencing protocol that enables de novo assemblies and intra-host variant calls of viral genomes collected from ...

unbiased-deep-sequencing-of-rna-viruses-from-clinical-samples

Universidad de Cartagena UDEC

Research

JoVE Journal

Medicine

16.8K Aufrufe.  Broad Institute of MIT and Harvard. This protocol describes a rapid and broadly applicable method for unbiased RNA-sequencing of viral samples from human clinical isolates.

Serie: Unbiased Deep Sequencing of RNA Viruses from Clinical Samples

Using a Pan-Viral Microarray Assay (Virochip) to Screen Clinical Samples for Viral Pathogens

The diagnosis of viral causes of many infectious diseases is difficult due to the inherent sequence diversity of viruses as well as the ongoing emergence of novel viral pathogens, such as SARS coronavirus and 2009 pandemic H1N1 influenza virus, that are not detectable by traditional methods. To address these challenges, we have previously developed and validated a pan-viral microarray platform called the Virochip with the capacity to detect all known viruses as well as novel variants on the basis of conserved sequence homology1. Using the Virochip, we have identified the full spectrum of viruses associated with respiratory infections, including cases of unexplained critical illness in hospitalized patients, with a sensitivity equivalent to or superior to conventional clinical testing2-5. The Virochip has also been used to identify novel viruses, including the SARS coronavirus6,7, a novel rhinovirus clade5, XMRV (a retrovirus linked to prostate cancer)8, avian bornavirus (the cause of a wasting disease in parrots)9, and a novel cardiovirus in children with respiratory and diarrheal illness10. The current version of the Virochip has been ported to an Agilent microarray platform and consists of ~36,000 probes derived from over ~1,500 viruses in GenBank as of December of 2009. Here we demonstrate the steps involved in processing a Virochip assay from start to finish (~24 hour turnaround time), including sample nucleic acid extraction, PCR amplification using random primers, fluorescent dye incorporation, and microarray hybridization, scanning, and analysis.

Using a Pan-Viral Microarray Assay Virochip to Screen Clinical Samples for Viral Pathogens

The Virochip is a pan-viral microarray designed to simultaneously detect all known viruses as well as novel viruses on the basis of conserved sequence homology. Here we demonstrate how to run a Virochip assay to analyze clinical samples for the presence of both known and unknown viruses.

Mit einem Pan-Viral Microarray-Assay (Virochip) zur klinischen Proben, die für virale Erreger Bildschirm

The diagnosis of viral causes of many infectious diseases is difficult due to the inherent sequence diversity of viruses as well as the ongoing emergence ...

Forschung

Immunologie und Infektion

Amplifying and Quantifying HIV-1 RNA in HIV Infected Individuals with Viral Loads Below the Limit of Detection by Standard Clinical Assays

Amplifying viral genes and quantifying HIV-1 RNA in HIV-1 infected individuals with viral loads below the limit of detection by standard assays (below 50-75 copies/ml) is necessary to gain insight to viral dynamics and virus host interactions in patients who naturally control the infection and those who are on combination antiretroviral therapy (cART). 
Here we describe how to amplify viral genomes by single genome sequencing (the SGS protocol) 13, 19 and how to accurately quantify HIV-1 RNA in patients with low viral loads (the single-copy assay (SCA) protocol) 12, 20. 
The single-copy assay is a real-time PCR assay with sensitivity depending on the volume of plasma being assayed. If a single virus genome is detected in 7 ml of plasma, then the RNA copy number is reported to be 0.3 copies/ml. The assay has an internal control testing for the efficiency of RNA extraction, and controls for possible amplification from DNA or contamination. Patient samples are measured in triplicate.
The single-genome sequencing assay (SGS), now widely used and considered to be non-labor intensive 3, 7, 12, 14, 15,is a limiting dilution assay, in which endpoint diluted cDNA product is spread over a 96-well plate. According to a Poisson distribution, when less than 1/3 of the wells give product, there is an 80% chance of the PCR product being resultant of amplification from a single cDNA molecule. SGS has the advantage over cloning of not being subjected to resampling and not being biased by PCR-introduced recombination 19. However, the amplification success of SCA and SGS depend on primer design. Both assays were developed for HIV-1 subtype B, but can be adapted for other subtypes and other regions of the genome by changing primers, probes, and standards.

Quantifying levels of HIV-1 RNA in plasma and sequencing single HIV-1 genomes from individuals with viral loads below the limit of detection (50-75 copies/ml) is difficult. Here we describe how to extract and quantify plasma viral RNA using a real time PCR assay that reliably measures HIV-1 RNA down to 0.3 copies/ml and how to amplify viral genomes by single genome sequencing, from samples with very low viral loads.

Verstärkung und Quantifizierung von HIV-1 RNA in HIV-infizierten Personen mit Viruslast unter der Nachweisgrenze von Standard Clinical Assays

Amplifying viral genes and quantifying HIV-1 RNA in HIV-1 infected individuals with viral loads below the limit of detection by standard assays (below ...

High-throughput, Automated Extraction of DNA and RNA from Clinical Samples using TruTip Technology on Common Liquid Handling Robots

TruTip is a simple nucleic acid extraction technology whereby a porous, monolithic binding matrix is inserted into a pipette tip. The geometry of the monolith can be adapted for specific pipette tips ranging in volume from 1.0 to 5.0 ml. The large porosity of the monolith enables viscous or complex samples to readily pass through it with minimal fluidic backpressure. Bi-directional flow maximizes residence time between the monolith and sample, and enables large sample volumes to be processed within a single TruTip. The fundamental steps, irrespective of sample volume or TruTip geometry, include cell lysis, nucleic acid binding to the inner pores of the TruTip monolith, washing away unbound sample components and lysis buffers, and eluting purified and concentrated nucleic acids into an appropriate buffer. The attributes and adaptability of TruTip are demonstrated in three automated clinical sample processing protocols using an Eppendorf epMotion 5070, Hamilton STAR and STARplus liquid handling robots, including RNA isolation from nasopharyngeal aspirate, genomic DNA isolation from whole blood, and fetal DNA extraction and enrichment from large volumes of maternal plasma (respectively).

TruTip is a simple nucleic acid extraction technology whereby a porous, monolithic binding matrix is inserted into a pipette tip. Consequently, the sample preparation format is compatible with most liquid handling instruments, and can be used for many medium to high-throughput clinical applications and sample types.

Hochdurchsatz-, Automated Extraktion von DNA und RNA aus klinischen Proben mit TruTip Technologie Gemeinsames Liquid Handling Robots

TruTip is a simple nucleic acid extraction  technology whereby a porous, monolithic binding matrix is inserted into a  pipette tip. The geometry of the ...

Biotechnik

Sequencing of mRNA from Whole Blood using Nanopore Sequencing

Sequencing in remote locations and resource-poor settings presents unique challenges. Nanopore sequencing can be successfully used under such conditions, and was deployed to West Africa during the recent Ebola virus epidemic, highlighting this possibility. In addition to its practical advantages (low cost, ease of equipment transport and use), this technology also provides fundamental advantages over second-generation sequencing approaches, particularly the very long read length, ability to directly sequence RNA, and real-time availability of data. Raw read accuracy is lower than with other sequencing platforms, which represents the main limitation of this technology; however, this can be partially mitigated by the high read depth generated. Here, we present a field-compatible protocol for sequencing of the mRNAs encoding for Niemann-Pick C1, which is the cellular receptor for ebolaviruses. This protocol encompasses extraction of RNA from animal blood samples, followed by RT-PCR for target enrichment, barcoding, library preparation, and the sequencing run itself, and can be easily adapted for use with other DNA or RNA targets.

Nanopore sequencing is a novel technology that allows cost-effective sequencing in remote locations and resource-poor settings. Here, we present a protocol for sequencing of mRNAs from whole blood that is compatible with such conditions.

Sequenzierung von mRNA aus Vollblut mit Nanopore-Sequenzierung

Sequencing in remote locations and resource-poor settings presents unique challenges. Nanopore sequencing can be successfully used under such conditions, ...

Genetik

Validating Whole Genome Nanopore Sequencing, using Usutu Virus as an Example

Whole genome sequencing can be used to characterize and to trace viral outbreaks. Nanopore-based whole genome sequencing protocols have been described for several different viruses. These approaches utilize an overlapping amplicon-based approach which can be used to target a specific virus or group of genetically related viruses. In addition to confirmation of the virus presence, sequencing can be used for genomic epidemiology studies, to track viruses and unravel origins, reservoirs and modes of transmission. For such applications, it is crucial to understand possible effects of the error rate associated with the platform used. Routine application in clinical and public health settings require that this is documented with every important change in the protocol. Previously, a protocol for whole genome Usutu virus sequencing on the nanopore sequencing platform was validated (R9.4 flowcell) by direct comparison to Illumina sequencing. Here, we describe the method used to determine the required read coverage, using the comparison between the R10 flow cell and Illumina sequencing as an example.

We previously validated a protocol for amplicon-based whole genome Usutu virus (USUV) sequencing on a nanopore sequencing platform. Here, we describe the methods used in more detail and determine the error rate of the nanopore R10 flow cell.

Validierung der Nanoporensequenzierung des gesamten Genoms anhand des Usutu-Virus als Beispiel

Whole genome sequencing can be used to characterize and to trace viral outbreaks. Nanopore-based whole genome sequencing protocols have been described for ...

Quantification and Whole Genome Characterization of SARS-CoV-2 RNA in Wastewater and Air Samples

Wastewater-based epidemiology has emerged as a promising and efficacious surveillance system for SARS-CoV-2 and other infectious diseases in many nations. The process typically involves wastewater concentration, nucleic acid extraction, amplification of selected genomic segments, and detection and quantification of the amplified genomic segment. This methodology can similarly be leveraged to detect and quantify infectious agents, such as SARS-CoV-2, in air samples. Initially, SARS-CoV-2 was presumed to spread primarily through close personal contact with droplets generated by an infected individual while speaking, sneezing, coughing, singing, or breathing. However, a growing number of studies have reported the presence of SARS-CoV-2 RNA in the air of healthcare facilities, establishing airborne transmission as a viable route for the virus. This study presents a composite of established protocols to facilitate environmental detection, quantification, and sequencing of viruses from both wastewater and air samples.

This protocol aims to quantify SARS-CoV-2 RNA in wastewater and air samples to be used for wastewater-based epidemiology studies and to assess the exposure risk to SARS-CoV-2 in indoor and outdoor aerosols. This protocol also describes a tiled amplicon long-template sequencing approach for SARS-CoV-2 whole genome characterization.

Quantifizierung und Charakterisierung des gesamten Genoms von SARS-CoV-2-RNA in Abwasser- und Luftproben

Wastewater-based epidemiology has emerged as a promising and efficacious surveillance system for SARS-CoV-2 and other infectious diseases in many nations. ...

Umwelt

High-throughput Detection of Respiratory Pathogens in Animal Specimens by Nanoscale PCR

Nanoliter scale real-time PCR uses spatial multiplexing to allow multiple assays to be run in parallel on a single plate without the typical drawbacks of combining reactions together. We designed and evaluated a panel based on this principle to rapidly identify the presence of common disease agents in dogs and horses with acute respiratory illness. This manuscript describes a nanoscale diagnostic PCR workflow for sample preparation, amplification, and analysis of target pathogen sequences, focusing on procedures that are different from microliter scale reactions. In the respiratory panel presented, 18 assays were each set up in triplicate, accommodating up to 48 samples per plate. A universal extraction and pre-amplification workflow was optimized for high-throughput sample preparation to accommodate multiple matrices and DNA and RNA based pathogens. Representative data are presented for one RNA target (influenza A matrix) and one DNA target (equine herpesvirus 1). The ability to quickly and accurately test for a comprehensive, syndrome-based group of pathogens is a valuable tool for improving efficiency and ergonomics of diagnostic testing and for acute respiratory disease diagnosis and management.

High-throughput testing of DNA and RNA based pathogens by nanoscale PCR is described using a syndromic canine and equine respiratory PCR panel.

Hochdurchsatz-Nachweis von Respiratory Pathogens in Tier Proben durch nanoskalige PCR

Nanoliter scale real-time PCR uses spatial multiplexing to allow multiple assays to be run in parallel on a single plate without the typical drawbacks of ...

Combining Analysis of DNA in a Crude Virion Extraction with the Analysis of RNA from Infected Leaves to Discover New Virus Genomes

This metagenome approach is used to identify plant viruses with circular DNA genomes and their transcripts. Often plant DNA viruses that occur in low titers in their host or cannot be mechanically inoculated to another host are difficult to propagate to achieve a greater titer of infectious material. Infected leaves are ground in a mild buffer with optimal pH and ionic composition recommended for purifying most bacilliform Para retroviruses. Urea is used to break up inclusion bodies that trap virions and to dissolve cellular components. Differential centrifugation provides further separation of virions from plant contaminants. Then proteinase K treatment removes the capsids. Then the viral DNA is concentrated and used for next-generation sequencing (NGS). The NGS data are used to assemble contigs which are submitted to NCBI-BLASTn to identify a subset of virus sequences in the generated dataset. In a parallel pipeline, RNA is isolated from infected leaves using a standard column-based RNA extraction method. Then ribosome depletion is carried out to enrich for a subset of mRNA and virus transcripts. Assembled sequences derived from RNA sequencing (RNA-seq) were submitted to NCBI-BLASTn to identify a subset of virus sequences in this dataset. In our study, we identified two related full-length badnavirus genomes in the two datasets. This method is preferred to another common approach which extracts the aggregate population of small RNA sequences to reconstitute plant virus genomic sequences. This latter metagenomic pipeline recovers virus related sequences that are retro-transcribing elements inserted into the plant genome. This is coupled to biochemical or molecular assays to further discern the actively infectious agents. The approach documented in this study, recovers sequences representative of replicating viruses that likely indicate active virus infection.

Here we present a new approach to identify plant viruses with double-strand DNA genomes. We use standard methods to extract DNA and RNA from infected leaves and carry out next-generation sequencing. Bioinformatic tools assemble sequences into contigs, identify contigs representing virus genomes and assign genomes to taxonomic groups.

Kombination von Analyse von DNA in eine grobe Virion-Extraktion mit der Analyse der RNA aus den infizierten Blättern, entdecken neue Virus-Genom

This metagenome approach is used to identify plant viruses with circular DNA genomes and their transcripts. Often plant DNA viruses that occur in low ...

Swabbing the Urban Environment - A Pipeline for Sampling and Detection of SARS-CoV-2 From Environmental Reservoirs

To control community transmission of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) during the 2020 global pandemic, most countries implemented strategies based on direct human testing, face covering, and surface disinfection. Under the assumption that the main route of transmission includes aerosols and respiratory droplets, efforts to detect SARS-CoV-2 in fomites have focused on locations suspected of high prevalence (e.g., hospital wards, cruise ships, and mass transportation systems). To investigate the presence of SARS-CoV-2 on surfaces in the urban environment that are rarely cleaned and&#160;seldomly disinfected, 350 citizens were enlisted from the greater San Diego County. In total, these citizen scientists collected 4,080 samples. An online platform was developed to monitor sampling kit delivery and pickup, as well as to collect sample data. The sampling kits were mostly built from supplies available in pandemic-stressed stores. Samples were processed using reagents that were easy to access despite the recurrent supply shortage. The methods used were highly sensitive and resistant to inhibitors that are commonly present in environmental samples. The proposed experimental design and processing methods were successful at engaging numerous citizen scientists who effectively gathered samples from diverse surface areas. The workflow and methods described here are relevant to survey the urban environment for other viruses, which are of public health concern and pose a threat for&#160;future pandemics.

A citizen science project was designed to recruit San Diego residents to collect environmental samples for SARS-CoV-2. A multilingual web-based platform was created for data submission using a user-friendly mobile device interface. A laboratory information management system facilitated the collection of thousands of geographically diverse samples with real-time outcome tracking.

Swabbing the Urban Environment - Eine Pipeline zur Probenahme und zum Nachweis von SARS-CoV-2 aus Umweltreservoirs

To control community transmission of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) during the 2020 global pandemic, most countries ...

Biologie

Ein nanoporenbasierter genomischer Ansatz zur Kontrolle der Tollwut in Ländern mit niedrigem Einkommen

Whole Genome Sequencing for Rapid Characterization of Rabies Virus Using Nanopore Technology

Genomic data can be used to track the transmission and geographic spread of infectious diseases. However, the sequencing capacity required for genomic surveillance remains limited in many low- and middle-income countries (LMICs), where dog-mediated rabies and/or rabies transmitted by wildlife such as vampire bats pose major public health and economic concerns. We present here a rapid and affordable sample-to-sequence-to-interpretation workflow using nanopore technology. Protocols for sample collection and the diagnosis of rabies are briefly described, followed by details of the optimized whole genome sequencing workflow, including primer design and optimization for multiplex polymerase chain reaction (PCR), a modified, low-cost sequencing library preparation, sequencing with live and offline base calling, genetic lineage designation, and phylogenetic analysis. Implementation of the workflow is demonstrated, and critical steps are highlighted for local deployment, such as pipeline validation, primer optimization, inclusion of negative controls, and the use of publicly available data and genomic tools (GLUE, MADDOG) for classification and placement within regional and global phylogenies. The turnaround time for the workflow is 2-3 days, and the cost ranges from $25 per sample for a 96 sample run to $80 per sample for a 12 sample run. We conclude that setting up rabies virus genomic surveillance in LMICs is feasible and can support progress toward the global goal of zero dog-mediated human rabies deaths by 2030, as well as enhanced monitoring of wildlife rabies spread. Moreover, the platform can be adapted for other pathogens, helping to build a versatile genomic capacity that contributes to epidemic and pandemic preparedness.

Autor im Rampenlicht: Ein kostengünstiger genomischer Workflow zur Verbesserung der Tollwutkontrolle in ressourcenbegrenzten Umgebungen 

Here, we present a rapid and cost-effective workflow for characterizing rabies virus (RABV) genomes using nanopore technology. The workflow is intended to support genomics-informed surveillance at a local level, providing information on circulating RABV lineages and their placement within regional phylogenies to guide rabies control measures.

Sequenzierung des gesamten Genoms zur schnellen Charakterisierung des Tollwutvirus mittels Nanoporentechnologie

Genomic data can be used to track the transmission and geographic spread of infectious diseases. However, the sequencing capacity required for genomic ...