This work was funded by NIH (R01GM141395) and NSF (1656736) grants to DF and NIH fellowship (F32GM136170) to AW. Figure 1 was created with the help of BioRender.com.

<ol>
	<li>Haag, E. S., Fitch, D. H. A., Delattre, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+&amp;#34;the+worm&amp;#34;+to+&amp;#34;the+worms&amp;#34;+and+back+again:+the+evolutionary+developmental+biology+of+nematodes.">From &amp;#34;the worm&amp;#34; to &amp;#34;the worms&amp;#34; and back again: the evolutionary developmental biology of nematodes.</a> Genetics. 210 (2), 397-433 (2018).</li><li>Sommer, R. J., Bumbarger, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nematode+model+systems+in+evolution+and+development.">Nematode model systems in evolution and development.</a> Wiley Interdisciplinary Reviews: Developmental Biology. 1 (3), 389-400 (2012).</li><li>. WormBase Available from: <a target="_blank" href="https://wormbase.org/#012-3-6">https://wormbase.org/#012-3-6</a> (2022)</li><li>. WormAtlas Available from: <a target="_blank" href="https://wormatlas.org">https://wormatlas.org</a> (2022)</li><li>. WormBook in Genetics Available from: <a target="_blank" href="https://academic.oup.com/genetics/pages/wormbook">https://academic.oup.com/genetics/pages/wormbook</a> (2022)</li><li>Cao, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comprehensive+single-cell+transcriptional+profiling+of+a+multicellular+organism.">Comprehensive single-cell transcriptional profiling of a multicellular organism.</a> Science. 357 (6352), 661-667 (2017).</li><li>Kaletsky, R., Murphy, C. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional+profiling+of+C.+elegans+adult+cells+and+tissues+with+age.">Transcriptional profiling of C. elegans adult cells and tissues with age.</a> Methods in Molecular Biology. 2144, 177-186 (2020).</li><li>Kaletsky, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptome+analysis+of+adult+Caenorhabditis+elegans+cells+reveals+tissue-specific+gene+and+isoform+expression.">Transcriptome analysis of adult Caenorhabditis elegans cells reveals tissue-specific gene and isoform expression.</a> PLoS Genetics. 14 (8), 1007559 (2018).</li><li>Packer, J. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+lineage-resolved+molecular+atlas+of+C.+elegans+embryogenesis+at+single-cell+resolution.">A lineage-resolved molecular atlas of C. elegans embryogenesis at single-cell resolution.</a> Science. 365 (6459), 1971 (2019).</li><li>Kulkarni, A., Anderson, A. G., Merullo, D. P., Konopka, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Beyond+bulk:+a+review+of+single+cell+transcriptomics+methodologies+and+applications.">Beyond bulk: a review of single cell transcriptomics methodologies and applications.</a> Current Opinion in Biotechnology. 58, 129-136 (2019).</li><li>Von Stetina, S. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-specific+microarray+profiling+experiments+reveal+a+comprehensive+picture+of+gene+expression+in+the+C.+elegans+nervous+system.">Cell-specific microarray profiling experiments reveal a comprehensive picture of gene expression in the C. elegans nervous system.</a> Genome Biology. 8 (7), 135 (2007).</li><li>Baugh, L. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+homeodomain+protein+PAL-1+specifies+a+lineage-specific+regulatory+network+in+the+C.+elegans+embryo.">The homeodomain protein PAL-1 specifies a lineage-specific regulatory network in the C. elegans embryo.</a> Development. 132 (8), 1843-1854 (2005).</li><li>Haenni, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+C.+elegans+intestinal+gene+expression+and+polyadenylation+by+fluorescence-activated+nuclei+sorting+and+3'-end-seq.">Analysis of C. elegans intestinal gene expression and polyadenylation by fluorescence-activated nuclei sorting and 3'-end-seq.</a> Nucleic Acids Research. 40 (13), 6304-6318 (2012).</li><li>Zhang, S., Banerjee, D., Kuhn, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+culture+of+larval+cells+from+C.+elegans.">Isolation and culture of larval cells from C. elegans.</a> PLoS One. 6 (4), 19505 (2011).</li><li>Emmert-Buck, M. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laser+capture+microdissection.">Laser capture microdissection.</a> Science. 274 (5289), 998-1001 (1996).</li><li>Hashimshony, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CEL-Seq2:+sensitive+highly-multiplexed+single-cell+RNA-Seq.">CEL-Seq2: sensitive highly-multiplexed single-cell RNA-Seq.</a> Genome Biology. 17, 77 (2016).</li><li>Yanai, I., Hashimshony, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CEL-Seq2-single-cell+RNA+sequencing+by+multiplexed+linear+amplification.">CEL-Seq2-single-cell RNA sequencing by multiplexed linear amplification.</a> Methods in Molecular Biology. 1979, 45-56 (2019).</li><li>Porta-de-la-Riva, M., Fontrodona, L., Villanueva, A., Ceron, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Basic+Caenorhabditis+elegans+methods:+synchronization+and+observation.">Basic Caenorhabditis elegans methods: synchronization and observation.</a> Journal of Visualized Experiments: JoVE. (64), e4019 (2012).</li><li>Baugh, L. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=To+grow+or+not+to+grow:+nutritional+control+of+development+during+Caenorhabditis+elegans+L1+arrest.">To grow or not to grow: nutritional control of development during Caenorhabditis elegans L1 arrest.</a> Genetics. 194 (3), 539-555 (2013).</li><li>Baugh, L. R., Hu, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Starvation+responses+throughout+the+Caenorhabditis+elegans+life+cycle.">Starvation responses throughout the Caenorhabditis elegans life cycle.</a> Genetics. 216 (4), 837-878 (2020).</li><li>Pepper, A. S., Killian, D. J., Hubbard, E. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+analysis+of+Caenorhabditis+elegans+glp-1+mutants+suggests+receptor+interaction+or+competition.">Genetic analysis of Caenorhabditis elegans glp-1 mutants suggests receptor interaction or competition.</a> Genetics. 163 (1), 115-132 (2003).</li><li>Mok, D. Z., Sternberg, P. W., Inoue, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Morphologically+defined+sub-stages+of+C.+elegans+vulval+development+in+the+fourth+larval+stage.">Morphologically defined sub-stages of C. elegans vulval development in the fourth larval stage.</a> BMC Developmental Biology. 15, 26 (2015).</li><li>Lytal, N., Ran, D., An, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Normalization+methods+on+single-cell+RNA-seq+data:+an+empirical+survey.">Normalization methods on single-cell RNA-seq data: an empirical survey.</a> Frontiers in Genetics. 11, 41 (2020).</li><li>Vieth, B., Ziegenhain, C., Parekh, S., Enard, W., Hellmann, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=powsimR:+power+analysis+for+bulk+and+single+cell+RNA-seq+experiments.">powsimR: power analysis for bulk and single cell RNA-seq experiments.</a> Bioinformatics. 33 (21), 3486-3488 (2017).</li><li>Bolkova, J., Lanctot, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+gene+expression+analysis+in+Caenorhabditis+elegans+using+single+molecule+RNA+FISH.">Quantitative gene expression analysis in Caenorhabditis elegans using single molecule RNA FISH.</a> Methods. 98, 42-49 (2016).</li><li>Ji, N., van Oudenaarden, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+molecule+fluorescent+in+situ+hybridization+(smFISH)+of+C.+elegans+worms+and+embryos.">Single molecule fluorescent in situ hybridization (smFISH) of C. elegans worms and embryos.</a> WormBook. , 1-16 (2012).</li><li>Lee, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-molecule+RNA+fluorescence+in+situ+hybridization+(smFISH)+in+Caenorhabditis+elegans.">Single-molecule RNA fluorescence in situ hybridization (smFISH) in Caenorhabditis elegans.</a> Bio-Protocol. 7 (12), 2357 (2017).</li><li>Baird, S. E., Chamberlin, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Caenorhabditis+briggsae+methods.">Caenorhabditis briggsae methods.</a> WormBook. , 1-9 (2006).</li><li>Felix, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oscheius+tipulae.">Oscheius tipulae.</a> WormBook. , 1-8 (2006).</li><li>Han, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improving+transgenesis+efficiency+and+CRISPR-associated+tools+through+codon+optimization+and+native+intron+addition+in+Pristionchus+nematodes.">Improving transgenesis efficiency and CRISPR-associated tools through codon optimization and native intron addition in Pristionchus nematodes.</a> Genetics. 216 (4), 947-956 (2020).</li><li>Fernandes Povoa, E. E., Ebbing, A. L. P., Betist, M. C., vander Veen, C., Korswagen, H. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+optimized+dissociation+protocol+for+FACS-based+isolation+of+rare+cell+types+from+Caenorhabditis+elegans+L1+larvae.">An optimized dissociation protocol for FACS-based isolation of rare cell types from Caenorhabditis elegans L1 larvae.</a> MethodsX. 7, 100922 (2020).</li><li>Han, M., Wei, G., McManus, C. E., Hillier, L. W., Reinke, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolated+C.+elegans+germ+nuclei+exhibit+distinct+genomic+profiles+of+histone+modification+and+gene+expression.">Isolated C. elegans germ nuclei exhibit distinct genomic profiles of histone modification and gene expression.</a> BMC Genomics. 20 (1), 500 (2019).</li><li>Steiner, F. A., Henikoff, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+type-specific+affinity+purification+of+nuclei+for+chromatin+profiling+in+whole+animals.">Cell type-specific affinity purification of nuclei for chromatin profiling in whole animals.</a> Methods in Molecular Biology. 1228, 3-14 (2015).</li><li>Ebbing, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spatial+transcriptomics+of+C.+elegans+males+and+hermaphrodites+identifies+sex-specific+differences+in+gene+expression+patterns.">Spatial transcriptomics of C. elegans males and hermaphrodites identifies sex-specific differences in gene expression patterns.</a> Developmental Cell. 47 (6), 801-813 (2018).</li><li>R&#246;delsperger, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spatial+transcriptomics+of+nematodes+identifies+sperm+cells+as+a+source+of+genomic+novelty+and+rapid+evolution.">Spatial transcriptomics of nematodes identifies sperm cells as a source of genomic novelty and rapid evolution.</a> Molecular Biology and Evolution. 38 (1), 229-243 (2021).</li><li>Amini, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+optimised+protocol+for+isolation+of+RNA+from+small+sections+of+laser-capture+microdissected+FFPE+tissue+amenable+for+next-generation+sequencing.">An optimised protocol for isolation of RNA from small sections of laser-capture microdissected FFPE tissue amenable for next-generation sequencing.</a> BMC Molecular Biology. 18 (1), 22 (2017).</li></ol>

All authors declare that they have no conflicts of interest.

Critical steps of the method 
If performed correctly, the method described here will obtain robust RNA profiles with a relatively small number of laser-dissected samples (70 tail tips in this example). However, for samples from developing animals, tight synchronization is critical to reducing the variability between samples. For this reason, the protocol recommends the hatch-off method for worm-synchronization. Here, the researcher can determine and precisely control the age difference between indiv...

Nematodes&#8212;particularly the rhabditid nematodes related to the model system Caenorhabditis elegans&#8212;are a wonderful group of animals for evolutionary developmental biology (EDB) for many reasons1,2. Advantages include their small number of cells, defined and consistent cell lineages, transparency, and ease of culture and husbandry. There are also many resources available, including high-quality genomes for multiple species, and for C. elegans, extensive molecular genetic tools and knowledge about development, genetics, anatomy, and physiology3,4,5,6.
As with many other organisms, the ability to characterize transcriptome dynamics in single tissues or single cells has revolutionized the analysis of development in C. elegans7,8,9,10. Being able to compare single-cell transcriptomes across nematodes would similarly transform EDB using these organisms. For example, such comparisons would provide insight into how gene regulatory networks have evolved for characters (traits) that have been conserved, for characters that have diverged, or for characters that evolved independently.

However, isolating particular tissues or cells from nematodes is one of the big challenges. For many organisms, single cells can be dissociated from tissues and harvested in an unbiased way or can be labeled with tissue-specific expression of a fluorescent protein and sorted by fluorescence-activated cell sorting (FACS)11. In C. elegans, high-throughput (HTP) isolation of cells has been limited mostly to embryos because the tough outer cuticle (and hydrostatic skeleton) has hampered cell isolation from larvae and adults. To get around this challenge, some methods have employed genetic tools in whole C. elegans worms, such as tissue-specific mRNA-tagging12, and differential expression comparisons between wild-type and mutants affecting a cell type13. More recent methods have overcome the challenge by dissolving the cuticle to isolate nuclei14 or entire cells8,9,15. Cell isolation and cell culture have the obvious disadvantages, however, that cells are removed from their natural developmental or anatomical context&#8212;e.g., away from cell-cell signaling and contact with the extracellular matrix&#8212;which are expected to impact the gene expression profile15. Moreover, the genetic tools and tissue-specific markers are species-specific (i.e., they can only be used in C. elegans).
LMD provides an alternative method for isolating tissues without disrupting the natural context of cells. Significantly for EDB, LMD also allows transcriptomes from homologous tissues of different species to be compared without the need for species-specific genetic toolkits if genome or whole transcriptome sequences of these species are available. LMD involves targeting tissues by direct microscopical observation and using a laser microbeam&#8212;integrated into the microscope&#39;s optics&#8212;to cut out and harvest (capture) the tissue of interest16. Limitations of LMD are that it is not conducive to very HTP approaches (although the transcription profiles for tail tips, as described in this protocol, were robust with ~70 samples), certain samples might be difficult to dissect out, and cuts are limited to the precision of the laser and what can be visualized in the microscope.
The purpose of the present protocol is to describe how LMD, followed by single-tissue RNA-Seq, can be used to obtain stage- and tissue-specific transcriptome data from nematodes. Specifically, it demonstrates LMD for isolating tail tips from fourth-stage larvae (L4) of C. elegans. However, this method can be adapted to other tissues and, of course, different species.
In C. elegans, there are 4 cells that make the tail tip in both males and hermaphrodites. During the L4 stage in males&#8212;but not in hermaphrodites&#8212;the tail tip cells change their shape and migrate anteriorly and inwardly. This process also occurs in some but not all other rhabditid nematode species. Therefore, the tail tip is a good model for the evolution of sexual dimorphic morphogenesis. Because of its position, the tail tip is also easy to isolate by LMD.
To obtain transcriptome profiles from tail tips, the present protocol uses CEL-Seq2, an RNA-seq method developed for single cells17,18. This method has several advantages for LMD-derived tissues. CEL-Seq2 is highly sensitive and efficient, using unique molecular identifiers (UMIs) to allow straightforward quantification of mRNA reads, in vitro transcription to ensure linear amplification, and barcoding that allows multiplexing of individual tissue samples. The only limitation of CEL-Seq2 is that recovered reads are biased to the 3&#39; end of mRNAs, and most isoforms thus cannot be distinguished.

<table><tbody><tr><td>&amp;nbsp;0.5 &amp;micro;M PEN membrane glass slides RNase free</td><td>Leica</td><td>11600288</td><td>for LMD</td></tr><tr><td>500 &amp;micro;L PCR tubes (nuclease-free)</td><td>Axygen</td><td>732-0675</td><td>to cut the tail tips into</td></tr><tr><td>Compound microscope with 40x objective and DIC</td><td>any</td><td></td><td>to check age of worms</td></tr><tr><td>Desktop humidifier</td><td>any</td><td></td><td></td></tr><tr><td>Dissection microscope with transmitted light base</td><td>any</td><td></td><td>for all worm work</td></tr><tr><td>glass pasteur pipets</td><td>any</td><td></td><td>handle of worm pick</td></tr><tr><td>glass slides and coverslips</td><td>any</td><td></td><td>to check age of worms</td></tr><tr><td>LMD6 microdissection system</td><td>Leica</td><td>multiple</td><td>to cut tail tips</td></tr><tr><td>LoBind tubes 0.5 mL</td><td>Eppendorf</td><td>22431005</td><td></td></tr><tr><td>M9 Buffer</td><td></td><td></td><td>Recipe in WormBook</td></tr><tr><td>Methanol 99.8%</td><td>Sigma</td><td>322415</td><td>to fix worms</td></tr><tr><td>NGM growth medium</td><td>US Biological</td><td>N1000</td><td>Buffers and salts need to be added: Recipe in WormBook</td></tr><tr><td>P10 pipette variablle volume</td><td>e.g. Gilson</td><td></td><td></td></tr><tr><td>P1000 pipette variable volume</td><td>e.g. Gilson</td><td></td><td></td></tr><tr><td>P2 pipette variable volume</td><td>e.g. Gilson</td><td></td><td></td></tr><tr><td>Pipette tips 1,000 &amp;micro;L</td><td>any</td><td></td><td></td></tr><tr><td>Pipette tips 1-10 &amp;micro;L filtered</td><td>any</td><td></td><td></td></tr><tr><td>platinum iridium wire</td><td>Tritech</td><td>PT-9010</td><td>to make worm pick</td></tr><tr><td>sterile and nuclease-free 1 mL centrfuge tubes</td><td>any</td><td></td><td></td></tr><tr><td>Tween 20</td><td>Sigma</td><td>P9416</td><td>Add a very small amount to M9 buffer to prevent worms from sticking to the pipet tips</td></tr><tr><td>vented 6 mm plastic Petri dishes</td><td>any</td><td></td><td></td></tr><tr><td>&lt;strong&gt;For CEL-Seq2&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>4200 TapeStation System with reagents for high-sensitivity RNA and DNA detection</td><td>Aligent</td><td></td><td>automated electrophoresis system</td></tr><tr><td>AMPure XP beads</td><td>Beckman Coulter</td><td>A63880</td><td>DNA cleanup beads</td></tr><tr><td>Bead binding buffer&amp;nbsp; 20% PEG8000, 2.5 M NaCl</td><td></td><td></td><td></td></tr><tr><td>CEL-Seq2 primers (see Table S1)</td><td>Sigma Genosys Mastercycler Nexus GX2 Eppendorf</td><td>6335000020</td><td>Thermal cycler with programmable lid and block for 200 &amp;micro;l tubes.</td></tr><tr><td>DNA Polymerase I (&lt;em&gt;E. coli&lt;/em&gt;)</td><td>Invitrogen</td><td>18052-025</td><td></td></tr><tr><td>dNTP mix 10 mM</td><td>any</td><td></td><td></td></tr><tr><td>&lt;em&gt;E. coli&lt;/em&gt; DNA ligase</td><td>Invitrogen</td><td>18052-019</td><td></td></tr><tr><td>Ethanol</td><td></td><td></td><td></td></tr><tr><td>ExoSAP-IT For PCR Product Clean-Up</td><td>Affymetrix</td><td>78200</td><td>exonuclease solution</td></tr><tr><td>MEGAscript T7 Transcription Kit</td><td>Ambion</td><td>AM1334</td><td>For step 4.6.1</td></tr><tr><td>Nuclease-free water</td><td>any</td><td></td><td></td></tr><tr><td>Phusion High-Fidelity PCR Master Mix with HF Buffer</td><td>NEB</td><td>M0531</td><td>PCR mix step 4.9.7</td></tr><tr><td>random hexamer RT primer GCCTTGGCACCCGAGAATTCCA&lt;br/&gt; NNNNNN</td><td>IDT</td><td></td><td>a primer with 6 nucleotides that are random</td></tr><tr><td>RNA Fragmentation buffer</td><td>NEB</td><td>E6150S</td><td></td></tr><tr><td>RNA Fragmentation stop buffer</td><td>NEB</td><td>E6150S</td><td></td></tr><tr><td>RNA PCR Index Primers (RPI1&amp;ndash;RPI48)</td><td>Illumina, NEB, or IDT</td><td></td><td>RPIX in protocol step 4.9.7, sequences available from Illumina</td></tr><tr><td>RNAClean XP beads</td><td>Beckman Coulter</td><td>A63987</td><td></td></tr><tr><td>RNase AWAY Surface Decontaminant</td><td>Thermo Scientific</td><td>7000TS1</td><td>or any other similar product</td></tr><tr><td>RNaseH (&lt;em&gt;E. coli&lt;/em&gt;)</td><td>Invitrogen</td><td>18021-071</td><td></td></tr><tr><td>RNaseOUT Recombinant Ribonuclease Inhibitor</td><td>Invitrogen</td><td>10777-019</td><td></td></tr><tr><td>Second strand buffer</td><td>Invitrogen</td><td>10812-014</td><td></td></tr><tr><td>Superscripit II</td><td>Invitrogen</td><td>18064-014</td><td>reverse transcriptase</td></tr></tbody></table>

laser microdissection for species-agnostic single-tissue applications

Single-cell methodologies have revolutionized the analysis of the transcriptomes of specific cell types. However, they often require species-specific genetic &#34;toolkits,&#34; such as promoters driving tissue-specific expression of fluorescent proteins. Further, protocols that disrupt tissues to isolate individual cells remove cells from their native environment (e.g., signaling from neighbors) and may result in stress responses or other differences from native gene expression states. In the present protocol, laser microdissection (LMD) is optimized to isolate individual nematode tail tips for the study of gene expression during male tail tip morphogenesis.
LMD allows the isolation of a portion of the animal without the need for cellular disruption or species-specific toolkits and is thus applicable to any species. Subsequently, single-cell RNA-seq library preparation protocols such as CEL-Seq2 can be applied to LMD-isolated single tissues and analyzed using standard pipelines, given that a well-annotated genome or transcriptome is available for the species. Such data can be used to establish how conserved or different the transcriptomes are that underlie the development of that tissue in different species.
Limitations include the ability to cut out the tissue of interest and the sample size. A power analysis shows that as few as 70 tail tips per condition are required for 80% power. Tight synchronization of development is needed to obtain this number of animals at the same developmental stage. Thus, a method to synchronize animals at 1 h intervals is also described.

Following laser capture microdissection, individual tail tips of males and hermaphrodites at 4 time points (L3 22 h after hatch; L4 24, 26, and 28 h after hatch) were prepared for RNA sequencing using the CEL-Seq2 protocol. CEL-Seq2 primers contain unique barcodes that enable sequencing reads from a particular sample (in this case an individual tail tip) to be identified bioinformatically. Sequencing data were generated with this method for a total of 557 tail tips (266 hermaphrodites and 291 males across 4 developmental...

Watch this Scientific Journal Video about Laser Microdissection for Species-Agnostic Single-Tissue Applications at JoVE.com

Laser Microdissection for Species-Agnostic Single-Tissue Applications

A protocol is described that uses laser microdissection to isolate individual nematode tissues for RNA-sequencing. The protocol does not require species-specific genetic toolkits, allowing gene expression profiles to be compared between different species at the level of single-tissue samples.

Single-cell methodologies have revolutionized the analysis of the transcriptomes of specific cell types. However, they often require species-specific ...

laser-microdissection-for-species-agnostic-single-tissue-applications

Universidad de Cartagena UDEC

Research

JoVE Journal

Biology

2.1K Views.  New York University. A protocol is described that uses laser microdissection to isolate individual nematode tissues for RNA-sequencing. The protocol does not require species-specific genetic toolkits, allowing gene expression profiles to be compared between different species at the level of single-tissue samples.

Video: Laser Microdissection for Species-Agnostic Single-Tissue Applications

Laser Capture Microdissection of Mammalian Tissue

Laser capture microscopy, also known as laser microdissection (LMD), enables the user to isolate small numbers of cells or tissues from frozen or formalin-fixed, paraffin-embedded tissue sections. LMD techniques rely on a thermo labile membrane placed either on top of, or underneath, the tissue section. In one method, focused laser energy is used to melt the membrane onto the underlying cells, which can then be lifted out of the tissue section. In the other, the laser energy vaporizes the foil along a path "drawn" on the tissue, allowing the selected cells to fall into a collection device. Each technique allows the selection of cells with a minimum resolution of several microns. DNA, RNA, protein, and lipid samples may be isolated and analyzed from micro-dissected samples. In this video, we demonstrate the use of the Leica AS-LMD laser microdissection instrument in seven segments, including an introduction to the principles of LMD, initializing the instrument for use, general considerations for sample preparation, mounting the specimen and setting up capture tubes, aligning the microscope, adjusting the capture controls, and capturing tissue specimens. Laser-capture micro-dissection enables the investigator to isolate samples of pure cell populations as small as a few cell-equivalents. This allows the analysis of cells of interest that are free of neighboring contaminants, which may confound experimental results.

Laser capture microscopy, also known as laser microdissection (LMD), enables the user to isolate small numbers of cells or tissues from frozen or ...

A Novel Microdissection Approach to Recovering Mycobacterium tuberculosis Specific Transcripts from Formalin Fixed Paraffin Embedded Lung Granulomas

Microdissection has been used for the examination of tissues at DNA, RNA, and protein levels for over a decade. Laser capture microscopy (LCM) is the most common microdissection technique used today. In this technique, a laser is used to focally melt a thermoplastic membrane that overlies a dehydrated tissue section1. The tissue section composite is then lifted and separated from the membrane. Although this technique can be used successfully for tissue examination, it is time consuming and expensive. Furthermore, the successful completion of procedures using this technique requires the use of a laser, thus limiting its use. A new more affordable and practical microdissection approach called mesodissection is a possible solution to the pitfalls of LCM. This technique employs the MESO-1/MeSectr system to mill the desired tissue from a slide mounted tissue sample while concurrently dispensing and aspirating fluid to recover the desired tissue sample into a consumable mill bit. Before the dissection process begins, the user aligns the formalin fixed paraffin embedded (FFPE) slide with a hematoxylin and eosin stained (H&#38;E) reference slide. Thereafter, the operator annotates the desired dissection area and proceeds to dissect the appropriate segment. The program generates an archived image of the dissection. The main advantage of mesodissection is the short duration needed to dissect a slide, taking an average of ten minutes from set up to sample generation in this experiment. Additionally, the system is significantly more cost effective and user friendly. A slight disadvantage is that it is not as precise as laser capture microscopy. In this article we demonstrate how mesodissection can be used to extract RNA from slides from FFPE granulomas caused by Mycobacterium tuberculosis (Mtb).

A Novel Microdissection Approach to Recovering Mycobacterium tuberculosis Specific Transcripts from Formalin Fixed Paraffin Embedded Lung Granulomas

Microdissection has been extensively employed for the examination of DNA, RNA, and protein within tissue. Laser capture microscopy (LCM) is the most commonly used method, but a new milling technique, mesodissection, is recently available. We demonstrate RNA extraction from mesodissected formalin fixed paraffin embedded tissue slides of Mycobacterium tuberculosis granulomas.

Microdissection has been used for the examination of tissues at DNA, RNA, and protein levels for over a decade. Laser capture microscopy (LCM) is the most ...

Immunology and Infection

Industrialized, Artificial Intelligence-guided Laser Microdissection for Microscaled Proteomic Analysis of the Tumor Microenvironment

The tumor microenvironment (TME) represents a complex ecosystem comprised of dozens of distinct cell types, including tumor, stroma, and immune cell populations. To characterize proteome-level variation and tumor heterogeneity at scale, high-throughput methods are needed to selectively isolate discrete cellular populations in solid tumor malignancies. This protocol describes a high-throughput workflow, enabled by artificial intelligence (AI), that segments images of hematoxylin and eosin (H&#38;E)-stained, thin tissue sections into pathology-confirmed regions of interest for selective harvest of histology-resolved cell populations using laser microdissection (LMD). This strategy includes a novel algorithm enabling the transfer of regions denoting cell populations of interest, annotated using digital image software, directly to laser microscopes, thus enabling more facile collections. Successful implementation of this workflow was performed, demonstrating the utility of this harmonized method to selectively harvest tumor cell populations from the TME for quantitative, multiplexed proteomic analysis by high-resolution mass spectrometry. This strategy fully integrates with routine histopathology review, leveraging digital image analysis to support enrichment of cellular populations of interest and is fully generalizable, enabling harmonized harvests of cell populations from the TME for multiomic analyses.

This protocol describes a high-throughput workflow for artificial intelligence-driven segmentation of pathology-confirmed regions of interest from stained, thin tissue section images for enrichment of histology-resolved cell populations using laser microdissection. This strategy includes a novel algorithm enabling the transfer of demarcations denoting cell populations of interest directly to laser microscopes.

The tumor microenvironment (TME) represents a complex ecosystem comprised of dozens of distinct cell types, including tumor, stroma, and immune cell ...

Cancer Research

Laser Capture Microdissection - A Demonstration of the Isolation of Individual Dopamine Neurons and the Entire Ventral Tegmental Area

Laser capture microdissection (LCM) is used to isolate a concentrated population of individual cells or precise anatomical regions of tissue from tissue sections on a microscope slide. When combined with immunohistochemistry, LCM can be used to isolate individual cells types based on a specific protein marker. Here, the LCM technique is described for collecting a specific population of dopamine neurons directly labeled with&#160;tyrosine hydroxylase immunohistochemistry and for isolation of the dopamine neuron containing region of the ventral tegmental area using indirect tyrosine hydroxylase immunohistochemistry on a section adjacent to those used for LCM. An infrared (IR) capture laser is used to both dissect individual neurons as well as the ventral tegmental area off glass slides and onto an LCM cap for analysis. Complete dehydration of the tissue with 100% ethanol and xylene is critical. The combination of the IR capture laser and the ultraviolet (UV) cutting laser is used to isolate individual dopamine neurons or the ventral tegmental area when using PEN membrane slides. A PEN membrane slide has significant advantages over a glass slide as it offers better consistency in capturing and collecting cells, is faster collecting large pieces of tissue, is less reliant on dehydration and results in complete removal of the tissue from the slide. Although removal of large areas of tissue from a glass slide is feasible, it is considerably more time consuming and frequently leaves some residual tissue behind. Data shown here demonstrate that RNA of sufficient quantity and quality can be obtained using these procedures for quantitative PCR measurements. Although RNA and DNA are the most commonly isolated molecules from tissue and cells collected with LCM, isolation and measurement of microRNA, protein and epigenetic changes in DNA can also benefit from the enhanced anatomical and cellular resolution obtained using LCM.

The isolation of individual dopamine neurons or the ventral tegmental area with direct or indirect immunohistochemistry is demonstrated using laser capture microdissection. Parameters for isolation of tissue from a glass slide using an infrared laser and from membrane slides using the combination of an infrared and ultraviolet laser are discussed.

Laser capture microdissection (LCM) is used to isolate a concentrated population of individual cells or precise anatomical regions of tissue from tissue ...

Neuroscience

Laser Capture Microdissection of Glioma Subregions for Spatial and Molecular Characterization of Intratumoral Heterogeneity, Oncostreams, and Invasion

Gliomas are primary brain tumors characterized by their invasiveness and heterogeneity. Specific histological patterns such as pseudopalisades, microvascular proliferation, mesenchymal transformation and necrosis characterize the histological heterogeneity of high-grade gliomas. Our laboratory has demonstrated that the presence of high densities of mesenchymal cells, named oncostreams, correlate with tumor malignancy. We have developed a unique approach to understand the mechanisms that underlie glioma&#39;s growth and invasion. Here, we describe a comprehensive protocol that utilizes laser capture microdissection (LMD) and RNA sequencing to analyze differential mRNA expression of intra-tumoral heterogeneous multicellular structures (i.e., mesenchymal areas or areas of tumor invasion). This method maintains good tissue histology and RNA integrity. Perfusion, freezing, embedding, sectioning, and staining were optimized to preserve morphology and obtain high-quality laser microdissection samples. The results indicate that perfusion of glioma bearing mice using 30% sucrose provides good morphology and RNA quality. In addition, staining tumor sections with 4% Cresyl violet and 0.5% eosin results in good nuclear and cellular staining, while preserving RNA integrity. The method described is sensitive and highly reproducible and it can be utilized to study tumor morphology in various tumor models. In summary, we describe a complete method to perform LMD that preserves morphology and RNA quality for sequencing to study the molecular features of heterogeneous multicellular structures within solid tumors.

Laser microdissection (LMD) is a sensitive and highly reproducible technique that can be used to uncover pathways that mediate glioma heterogeneity and invasion. Here, we describe an optimized protocol to isolate discrete areas from glioma tissue using laser LMD followed by transcriptomic analysis.

Gliomas are primary brain tumors characterized by their invasiveness and heterogeneity. Specific histological patterns such as pseudopalisades, ...

SIVQ-LCM Protocol for the ArcturusXT Instrument

SIVQ-LCM is a new methodology that automates and streamlines the more traditional, user-dependent laser dissection process.&#160;It aims to create an advanced, rapidly customizable laser dissection platform technology. In this report, we describe the integration of the image analysis software Spatially Invariant Vector Quantization (SIVQ) onto the ArcturusXT instrument. The ArcturusXT system contains both an infrared (IR) and ultraviolet (UV) laser, allowing for specific cell or large area dissections. The principal goal is to improve the speed, accuracy, and reproducibility of the laser dissection to increase sample throughput. This novel approach facilitates microdissection of both animal and human tissues in research and clinical workflows.

SIVQ-LCM is an innovative approach that harnesses a computer algorithm, Spatially Invariant Vector Quantization (SIVQ), to drive the laser capture microdissection (LCM) process. The SIVQ-LCM workflow greatly improves the speed and accuracy of microdissection, with applications in both the research and clinical settings.

SIVQ-LCM is a new methodology that automates and streamlines the more traditional, user-dependent laser dissection process.&#160;It aims to create an ...

Laser-assisted Microdissection (LAM) as a Tool for Transcriptional Profiling of Individual Cell Types

The understanding of developmental processes at the molecular level requires insights into transcriptional regulation, and thus the transcriptome, at the level of individual cell types. While the methods described here are generally applicable to a wide range of species and cell types, our research focuses on plant reproduction. Plant cultivation and seed production is of crucial importance for human and animal nutrition. A detailed understanding of the regulatory networks that govern the formation of the reproductive lineage (germline) and ultimately of seeds is a precondition for the targeted manipulation of plant reproduction. In particular, the engineering of apomixis (asexual reproduction through seeds) into crop plants promises great improvements, as it leads to the formation of clonal seeds that are genetically identical to the mother plant. Consequently, the cell types of the female germline are of major importance for the understanding and engineering of apomixis. However, as the corresponding cells are deeply embedded within the floral tissues, they are very difficult to access for experimental analyses, including cell-type specific transcriptomics. To overcome this limitation, sections of individual cells can be isolated by laser-assisted microdissection (LAM). While LAM in combination with transcriptional profiling allows the identification of genes and pathways active in any cell type with high specificity, establishing a suitable protocol can be challenging. Specifically, the quality of RNA obtained after LAM can be compromised, especially when small, single cells are targeted. To circumvent this problem, we have established a workflow for LAM that reproducibly results in high RNA quality that is well suitable for transcriptomics, as exemplified here by the isolation of cells of the female germline in apomictic Boechera. In this protocol, procedures are described for tissue preparation and LAM, also with regard to RNA extraction and quality control.

Laser-assisted Microdissection LAM as a Tool for Transcriptional Profiling of Individual Cell Types

Here we present a protocol for laser-assisted microdissection of specific plant cell types for transcriptional profiling. While the protocol is suitable for different species and cell types, the focus is on highly inaccessible cells of the female germline important for sexual and apomictic reproduction in the crucifer genus Boechera.

The understanding of developmental processes at the molecular level requires insights into transcriptional regulation, and thus the transcriptome, at the ...

Capturing Oral Submucous Fibrosis Tissue Samples for Spatial-Omics Analysis

Isolation of Cells with Morphological and Spatial Information from Oral Submucous Fibrosis Samples by Laser Capture Microdissection

Oral submucous fibrosis (OSF) is a common type of potentially malignant disorder in the oral cavity. The atrophy of epithelium and fibrosis of the lamina propria and the submucosa are often found on histopathological slides. Epithelial dysplasia, epithelial atrophy, and senescent fibroblasts have been proposed to be associated with the malignant transformation of OSF. However, because of the heterogeneity of potentially malignant oral disorders and oral squamous cell carcinoma, it is difficult to identify the specific molecular mechanisms of malignant transformation in OSF. Here, we present a method to obtain a small number of epithelial or mesenchymal cells carrying morphological data and spatial information by laser capture microdissection on formalin-fixed paraffin-embedded tissue slides. Using a microscope, we can precisely capture microscale (~500 cells) dysplastic or atrophic epithelial tissue and fibrotic subepithelial tissue. The extracted cells can be evaluated by genome or transcriptome sequencing to acquire genomic and transcriptomic data with morphological and spatial information. This approach removes the heterogeneity of bulk OSF tissue sequencing and the interference caused by cells in non-lesioned areas, allowing for precise spatial-omics analysis of OSF tissue.

Author Spotlight: Unlocking the Mysteries of Oral Potential Malignancies 

Laser capture microdissection of oral submucous fibrosis tissues allows for precise extraction of cells from histological regions of interest for the analysis of multi-omics data with morphological and spatial information.

Oral submucous fibrosis (OSF) is a common type of potentially malignant disorder in the oral cavity. The atrophy of epithelium and fibrosis of the lamina ...

Medicine

Laser Capture Microdissection on Surgical Tissues to Identify Aberrant Gene Expression in Impaired Wound Healing in Type 2 Diabetes

The global prevalence Type 2 diabetes mellitus (T2DM) is escalating at a rapid rate. Patients with T2DM suffer from a multitude of complications and one of these is impaired wound healing. This can lead to the development of non-healing sores or foot ulcers and ultimately to amputation. In healthy individuals, wound healing follows a controlled and overlapping sequence of events encompassing inflammation, proliferation, and remodelling. In T2DM, one or more of these steps becomes dysfunctional. Current models to study impaired wound healing in T2DM include in vitro scratch wound assays, skin equivalents, or animal models to examine molecular mechanisms underpinning wound healing and/or potential therapeutic options. However, these do not fully recapitulate the complex wound healing process in T2DM patients, and ex vivo human skin tests are problematic due to the ethics of taking punch biopsies from patients where it is known they will heal poorly. Here, a technique is described whereby expression profiles of the specific cells involved in the (dys)functional wound healing response in T2DM patients can be examined using surplus tissue discarded following amputation or elective cosmetic surgery. In this protocol samples of donated skin are collected, wounded, cultured ex vivo in the air liquid interface, fixed at different time points and sectioned. Specific cell types involved in wound healing (e.g., epidermal keratinocytes, dermal fibroblasts (papillary and reticular), the vasculature) are isolated using laser capture microdissection and differences in gene expression analyzed by sequencing or microarray, with genes of interest further validated by qPCR. This protocol can be used to identify inherent differences in gene expression between both poorly healing and intact skin, in patients with or without diabetes, using tissue ordinarily discarded following surgery. It will yield greater understanding of the molecular mechanisms contributing to T2DM chronic wounds and lower limb loss.

This technique provides a guide to inflicting ex vivo wounds, performing laser capture microdissection and quantifying changes in gene expression related to poor wound healing processes in diabetes using clinically relevant human tissue.

The global prevalence Type 2 diabetes mellitus (T2DM) is escalating at a rapid rate. Patients with T2DM suffer from a multitude of complications and one ...

Laser Microdissection: A Technique to Isolate Invading Colorectal Cancer cells from a 3D Organotypic Culture Model

Source: Bullock M. et al., <a href="https://jove.unicartagenaproxy.elogim.com/v/51475"> Molecular Profiling of the Invasive Tumor Microenvironment in a 3-Dimensional Model of Colorectal Cancer Cells and&#160;Ex vivo&#160;Fibroblasts.</a> J. Vis. Exp. (2014).
The video describes the laser dissection of the 3D organotypic co-culture model with micron-level precision. In 3D organotypic models, stromal constituents such as fibroblasts are 3-dimensionally co-cultured with cancer epithelial cells. The 3D model serves as an experimental tool that enables invasion and cancer-stroma interactions to be studied in near-physiological conditions.

Source: Bullock M. et al.,  Molecular Profiling of the Invasive Tumor Microenvironment in a 3-Dimensional Model of Colorectal Cancer Cells and&#160;Ex ...

Laser Microdissection for Species-Agnostic Single-Tissue Applications

Summary

Explore More Videos

Chapters in this video

Laser Capture Microdissection of Mammalian Tissue

A Novel Microdissection Approach to Recovering Mycobacterium tuberculosis Specific Transcripts from Formalin Fixed Paraffin Embedded Lung Granulomas

Industrialized, Artificial Intelligence-guided Laser Microdissection for Microscaled Proteomic Analysis of the Tumor Microenvironment

Laser Capture Microdissection - A Demonstration of the Isolation of Individual Dopamine Neurons and the Entire Ventral Tegmental Area

Laser Capture Microdissection of Glioma Subregions for Spatial and Molecular Characterization of Intratumoral Heterogeneity, Oncostreams, and Invasion

SIVQ-LCM Protocol for the ArcturusXT Instrument

Laser-assisted Microdissection (LAM) as a Tool for Transcriptional Profiling of Individual Cell Types

Isolation of Cells with Morphological and Spatial Information from Oral Submucous Fibrosis Samples by Laser Capture Microdissection

Laser Capture Microdissection on Surgical Tissues to Identify Aberrant Gene Expression in Impaired Wound Healing in Type 2 Diabetes

Laser Microdissection: A Technique to Isolate Invading Colorectal Cancer cells from a 3D Organotypic Culture Model