Bu yayında bildirilen araştırma çalışmaları tarafından Ulusal Genel tıbbi Bilimler Enstitüsü Ulusal Sağlık Enstitüleri Ödülü numarası R35GM124913, Purdue Üniversitesi PI4D teşvik programı ve PVM iç rekabet altında desteklenen Temel araştırma fonları programı. İçeriği yalnızca yazarlar sorumludur ve mutlaka finansman ajanları resmi görüşlerini temsil etmiyor. Biz Koichi Kawakami Tol2 yapı, Michael Lin ASAP1 inşa etmek için teşekkür ederiz ve Leonard Zon ubi organizatörü için inşa Addgene.

Zebra balığı AAALAC onaylı bir hayvan tesiste yer alan ve tüm deneylerin Purdue hayvan bakım ve kullanım Komitesi (PACUC) tarafından onaylanmış protokolleri göre yapılmıştır.
1. Tol2 Transposon plazmid yapı hazırlık
Not: Tol2, medaka balıkta keşfedilmiştir bir transposon içinde Zebra balığı araştırma topluluk8,9yaygın olarak kullanılmıştır. Başarılı bir şekilde ağ geçidi siteye özgü rekombinasyon tabanlı klonlama sisteme kabul ve Tol2 seti10olarak da bilinir. Tol2 seti oluşturma özelleştirilmiş ifade yapıları da transgenesis verimliliğini artırırken, daha uygun bir yol sağlar. Böylece, bu sistem yararlanmak ve doğrulanmış Ubikuitin organizatörü ASAP111sürücü kullanarak her yerde ASAP1 ifade Zebra balığı çizgi oluşturmak için kolay bir karar oldu.
<ol><li>Orta giriş ASAP1 yapı oluştururken: pDONR221-ASAP1<ol>
<li>Genetik olarak kodlanmış voltaj sensör ASAP1 yapı, pcDNA3.1/Puro-CAG-ASAP1 (plazmid #52519), Addgene elde etmek. ASAP1 kodlayıcı bölge yükseltmek için sonunda 5' astar (şekil 1) attB serileri ile çevrili (attB1-ASAP1F ve attB2-ASAP1R) özelleştirilmiş primerler kullanılarak bir PCR ayarlayın. Phusion DNA polimeraz yüksek verimlilik için seçildi ve PCR koşulları daha önce yayımlanmış protokolü12tarihinde göre optimize.</li>
		<li>TAE jel düzenli bir pipet ile 200 µL ipuçlarını kullanarak bir %1 50 µL PCR ürünleri yüklemek ve Elektroforez 160 V adlı bir yatay jel tankı yaklaşık 30 dk için gerçekleştirin.</li>
		<li>Jel UV transilluminator altında kontrol (353 nm), tüketim bıçak/neşter UV transilluminator altında daha önce yayımlanmış13,14olarak kullanarak istenen bant dışarı ve DNA içeren jel örneği temiz 1.5 mL microcentrifuge koymak tüp.</li>
		<li>Jel arıtma ASAP1 PCR ürünleri için gerçekleştirin. Ticari DNA jel arıtma seti üreticisinin öğretim takip uygulayarak çıkarılan jel DNA'da yeniden elde etmek ve su 20 µL DNA elute. Bir örnek olarak 1 µL al ve bir Spektrofotometre kullanarak DNA toplama ölçmek. Boş denetim15su kullanarak yazılım yönergeleri akışı.</li>
		<li>Almak 100 ng, saf PCR ürünü ve 150 ile karıştırmak pDONR221 plazmid TE 10 µL içinde ng tampon (10 mM Tris, 1 mM EDTA pH 8.0)16. BP Clonase II 2 µL tepki içine ekleyin ve reaksiyon oda sıcaklığında gecede kuluçkaya.</li>
		<li>İkinci gününde, İndinavir K 1 µL tepki ekleyin ve tepki için 30 dk 37 ° C'de kuluçkaya.</li>
		<li>Dönüştürme gerçekleştirmek. Reaksiyon aktarmak ve yetkili E. coli hücreleri ve hücreleri 30 dk için buz üzerinde kuluçkaya Top10 50 µL ile karıştırın. O zaman, 1 dk. 42 ° C su banyosu tepki tüpüne hemen tüpü çıkarması ve 2 min için buz üzerinde kuluçkaya transfer. Daha sonra tüp 37 ° C shaker koyun ve 1 h için kuluçkaya.</li>
		<li>Tüp çıkar ve hücreleri sefaloridin LB plaka üzerine plaka. Daha sonra plaka gecede (16-18 h) 37 ° C'de kuluçkaya</li>
		<li>Tek ve iyi ayrı kolonileri alın ve onları 14 mL hücre kültür tüpleri ile 3 mL LB orta içine aşılamak. Onları gecede bir shaker (dönüş / dakika) 250 rpm'lik dönüş hızı ile 37 ° C'de kültür.</li>
		<li>Onun öğretim el ile17takip bir ticari miniprep kit kullanarak miniprep gerçekleştirin.</li>
		<li>3-4 Plazmid dizi Sanger ile M13F ve M13R sıralama primerler kullanılarak olumlu pDONR221-ASAP1 tanımlamak için sıralama klonlar.</li>
	</ol>
</li>
	<li>Mikroenjeksiyon Tol2 yapı oluştururken: pDestTol2 -ubi-ASAP1<ol>
<li>Nasıl yapılacağını pDONR221-ASAP1 klon ve ölçü onun DNA toplama bir Spektrofotometre aşağıdaki boş bir kontrol gibi15su kullanarak yazılım yönergesi kullanarak doğrulanmadı seçin.</li>
		<li>PDONR221-ASAP1 100 µg alıp Tol2 kit 5 uçlu plazmid 100 µg ile karıştırın (pENTR5'_ubi, Addgene #27320), 100 µg p3E-polyA (Tol2 kit #302) ve pDestTol2pA2 150 µg (Tol2 kit #394). 8 µL için toplam ses seviyesini ayarlamak bir 1.5 mL microcentrifuge TE tampon (10 mM Tris, 1 mM EDTA, pH 8.0) kullanarak tüp ve mix de bir 2-5 s kısa girdap tarafından. O zaman, LR Clonase II plus 2 µL ekleyin ve reaksiyon oda sıcaklığında gecede kuluçkaya.</li>
		<li>İkinci gün, İndinavir K 1 µL 10 µL pipet kullanarak tepki ekleyin ve tepki için 30 dk 37 ° C'de kuluçkaya.</li>
		<li>Dönüştürme gerçekleştirmek ve olumlu klonlar (adımları 1.1.7-11) açıklandığı gibi tanımlar.</li>
		<li>Ölçü sıralama DNA konsantrasyon pDestTol2-ubi-ASAP1 klon (şekil 1B) Spektrofotometre15kullanarak doğrulanmadı. Genellikle 200ng/µL bölgedir.</li>
	</ol>
</li>
</ol>2. Tol2 Transposase mRNA ve enjeksiyon çözüm hazırlamak
<ol><li>Steril aşılama döngü kullanarak çizgi E. coli gliserol stokunun pCS2FA-transposase plazmid (Tol2 kit #396) (ile 100 µg/mL Ampisilin) LB plaka üzerine. Plaka bir kuluçka 37 ° C'de gecede kuluçkaya. Ertesi gün, bir koloni almak ve bunu LB (100 µg/mL Ampisilin) 3 mL steril 10 µL pipet ucu kullanarak aşılamak. Bir shaker 250 rpm'lik dönüş hızı ile 37 ° C'de gecede kültür.</li>
	<li>Miniprep onun kullanım kılavuzu takip bir ticari miniprep kit kullanarak E. coli kültür gerçekleştirin. Plazmid DNA TE arabellek 30-50 µL 1 dakika santrifüj 14.000 RPM tarafından elute ve onun DNA toplama bir Spektrofotometre ile ölçmek.</li>
	<li>Plazmid ile değil ben 1-2 µg endonükleaz linearize ve temizleme seti değil ben sonra onun kullanım kılavuzu aşağıdaki DNA ile DNA sindirim arındırmak. DNA su 5 µL 1 dakikadır 14.000 rpm centrifuging tarafından elute. Beklenen konsantrasyon ilgili 200-300 ng/µL.</li>
	<li>Vitro transkripsiyon gerçekleştirmek ile değil ben pCS2FA-transposase bir ticari SP6 transkripsiyon kit kullanarak DNA şablon olarak doğrusallaştırılmış.</li>
	<li>Reaksiyon tamamlandıktan sonra üreticinin yönergelerini izleyerek bir ticari RNA temizlik kullanarak mRNA kit Tol2 transposase arındırmak. Son olarak, mRNA RNAase ücretsiz 20 µL suya elute ve bir Spektrofotometre RNA konsantrasyon ölçmek. Beklenen konsantrasyon ilgili 1-3 µg / µL. örnekleri gerekirse-80 ° C dondurucuda saklanabilir.</li>
	<li>20 ng/µL pDestTol2 -ubikarıştırılarak mikroenjeksiyon çözüm hazırlamak-ASAP1 ve Tol2 transposase mRNA (100 ng/µL) pipetting tarafından microcentrifuge tüp içinde. Nükleik asit önlemek için bozulması tekrarlanan çözdürme ve tüp başına refreezing, aliquot 6 µL neden olduğu ve-80 ° C dondurucu ileride kullanmak üzere saklayın.</li>
</ol>3. mikroenjeksiyon
<ol><li>4-6 üreme tankları en az 2 kadın ve 2 erkek ile öğleden sonra enjeksiyon önce ayarlayın. Bu balık öğleden sonra beslenmelidir değil. Bu adımı balık atık miktarını azaltmak ve ertesi sabah da ikna etmek üreme yanıt için yardımcı olurken, onları temizlemek için zaman kazandırır.</li>
	<li>Ertesi sabah, hazırlanan enjeksiyon çözümü kaldırmak (pDestTol2 -ubi-ASAP1 yapı ve Tol2 mRNA)-80 ° C dondurucu gelen ve buz üzerinde yerleştirin.</li>
	<li>Bölücüler tankları ıslah balık çekin ve çiftleşmek balık sağlar. Genel olarak, Balık bölücü çekerek sonra 20-30 dakika içinde yumurta yatıyordu. Aksi takdirde, 1-2 saat daha bekle. Biraz balık hiç yumurtalarını değil. Bu durumda, bu deney balık embriyo koleksiyonu için yineleyin.</li>
	<li>Beklerken, iğneler Forseps ile veya bir hassas görev silecek kırarak eğimli kenarı oluşturmak bir açıyla kırık ucu hazırlanmış olduğundan emin olun.<ol>
<li>Aşağıdaki parametreleri kullanarak bir micropipette çektirmenin kapiller camdan Needles çekin: 545; ısı Çekme 60; hızı 80; zaman 250; basınç 500. Forseps tutarak bir açı yaklaşık 45 ° bir diseksiyon kapsamla (çapı tahmini için göz-adet cetvel) altında Forseps ile iğne kır. İstenen iğne çapları microinjector ayarlarına bağlı olarak değişken olabilir, ama daha küçük çaplı embriyo ölümleri azaltmak için tercih edilir.</li>
	</ol>
</li>
	<li>Bir kez balık yumurta atılmıştır var, onları bir 10-cm çapında Petri kabına toplamak ve diseksiyon kapsama getir. Tüm anormal embriyo kaldırmak ve atık balık.</li>
	<li>Damlalıklı döllenmiş embriyo içine hazırlanan % 3 özel enjeksiyon kalıp. Embriyo tutmak yardımcı olmak için fazla suyu kaldırın.</li>
	<li>Bir kez tüm satırları uygun embriyo ile dolu, aynı yöne doğru yatay olarak yaklaşık 45 ° açı bu iğne tek hücreleri tüm yüz onları yeniden düzenleyin. Bu enjeksiyon daha sonra çok daha kolay yapacaktır.</li>
	<li>Eldiven giyerken, 20 µL yükleme damlalıklı kullanın İpucu ve buz üzerinde tüp hazır yapı 5 µL kaldırın.</li>
	<li>Dikkatle ta uzantılar gibi ipucu yakın reaktif elde olarak için başladığı için kırık kılcal tüp arka uç ucunu takın. Hala hava kabarcıkları Eğer ucunu kırmak emin iğne sallamak.</li>
	<li>İğne mikroenjeksiyon iğne bağı düz yerleştirin ve iğne yerinde kalır kadar dikkatlice sıkın. Yaklaşık 45 ° açıyla ayarlayın.</li>
	<li>Bir kez iğne hazırlanan ve bağlı, mikroskop ve gaz basınç tankı açın. Ticari CO2 Tanklar bu amaç için genel olarak iyi. Enjeksiyon hacmi holding ve ejeksiyon basınç ayarlanır: yaklaşık 0,5 psi tutmak için ve fırlatma için 30 psi. Çözüm, zaman pedal basarak çıkar ki kontrol ettiğinizden emin olun.</li>
	<li>Mineral yağ, bir damla ile bir sahne mikrometre kullanarak ayarlayın birim ve çözüm için ~ 150 µm çapında akışını (yaklaşık 2 nL). Arka basınç iğne damla küçük bir miktar izin verir emin olun. Yeterince geri dönüş basıncı varsa, kılcal eylem iğne girin ve mRNA yok etmek için sıvı neden olur.</li>
	<li>İğne kalibre edilmiş bir kez inşa döllenmiş embriyolar tek hücre enjekte başlar. Not: Bu uygulama, sabır ve incelik, hücre zarının delmek sabit varlık nedeniyle büyük bir miktar alır. Bu çözüm değil sarısı transgenik Zebra balığı üretmek için hücre içine enjekte etmek önemlidir. Bu morpholino enjeksiyon farklıdır. Hangi tarafta iğne hücrenin yapı hücreye gider sürece girer önemli değil. Transgenesis hücre yerine sarısı içine enjekte başarı oranı çok düşük olacaktır. Tek hücreli sahne enjeksiyon da önemlidir veya somatik chimera balık-ecek var olmak mahluk. Bu germ hücreleri girmeden transgene olasılığını azaltacaktır.</li>
	<li>Jel çentik kenarına embriyo yerine tutar ve iğne embriyo hareket ettirmeden basınç uygulamak izin veren bir destek sağlamak için kullanın. İğne ucu tek hücrede olduğunda, çözüm istenilen miktarda serbest bırakmak için pedal basın. Tüm embriyoların için bu adımları tekrarlayın.</li>
	<li>Rapor tamamlandığında, enjekte embriyo onları balık sistem su ve bir tek kullanımlık 3.4 mL transfer pipet ile özel çentik dışarı durulama etiketli bir tabak içine aktarın. Embriyo geliştirmek izin bir 28.5 ° C kuluçka makinesi içinde saklayın. Kontrol sırt ölü balık embriyo kaldırma gün ve % 0.1 Metilen mavisi balık suda su yerine.</li>
	<li>Yaklaşık 6-8 saat sonra enjeksiyon, enjekte almak 10 tek embriyo balık ve sert çocuk yöntemi18kullanarak onlardan genomik DNA hazırlamak.</li>
	<li>Ertesi sabah, diseksiyon mikroskop GFP ve sigara sarısı dokularda gösterilen embriyo dışarı sıralamak için bir Floresan ışık kaynağı ile kullanın. Bu balık embriyoların enjekte yapı içermelidir.</li>
	<li>Tol2 tüketim tahlil19daha önce açıklandığı gibi transposon etkinliği denetlemek için gerçekleştirin. Eksize plazmid tespit edilebilir, enjekte tutmak balık embriyo ve onları yetiştirmek. Eğer hiçbir eksize plazmid bulmak, Tol2 mRNA sentezi ve mikroenjeksiyon işlemi Tol2 tüketim testin pozitif sonuçlar elde kadar yineleyin.</li>
</ol>4. transgenik ASAP1 balık, Tg kurun (UBI: ASAP1)
<ol><li>Yetişkinliğe enjekte balık (F0 üretimi) Zebra balığı kitap20daha önce açıklandığı gibi kaldırın. Bu genellikle yaklaşık 4 ay sürer.</li>
	<li>Bir tek yetişkin F0 balık almak ve cinsiyet wildtype balık karşısında tek bir çapraz. Islah daha sonra gün sonra balık embriyo toplamak. Toplanan balık embriyo 28.5 ° C kuluçka balık su % 0,1 Metilen mavisi ile tutun.</li>
	<li>Üçüncü günde, floresan diseksiyon mikroskop altında balık embriyo GFP filtre ile kontrol edin. Eğer var birisi yeşil balık embriyo sıralamak ve onları yetişkinliğe F1 nesil transgenik balık, Tg olarak yetiştirmek (UBI: ASAP1). Not: mikrop-line genetik chimeras ebeveyn F0 balık çoğu bu yana Mendel oranı beklenmez.</li>
	<li>Tek F1 yetişkin balık wildtype balık ile çapraz ve balık embriyo toplamak. Yeşil balık embriyo sıralamak ve onları yetişkinliğe F2 nesil balık olarak yetiştirmek. Not: Yeşil ve yeşil balık embriyo 1:1 yakın olup olmadığını tek bir transgene olmalıdır.</li>
	<li>Tümör kötü huylu periferik sinir kılıfı Tümörü (MPNST) gibi elektrik potansiyel değişiklikleri görüntülemek için F2 nesil Tg çapraz (UBI: ASAP1) rpl35hi258/wt balık ile balık. Bu görünür tümör içinde 6-8 ay yaşlı yetişkin21,22bulunmak başlatmak bilinmektedir.</li>
</ol>5. görüntüleme
<ol><li>Zebra balığı embriyo resim, birden çok F2 nesil kurucusu balık almak ve onları wildtype balık bireysel çiftleri ile çapraz için. Kılavuzu23evreleme Zebra balığı göre farklı istenen gelişim aşamalarında balık embriyo toplamak.</li>
	<li>Balık embriyo erken dönemlerinde için soyma ve chorions dikkatlice 10 cm çapında Petri kabına balık sistem su ile bir diseksiyon kapsamı altında bir çift forseps kullanarak embriyoların kaldırma.</li>
	<li>Concaved cam slayt üzerine birkaç balık embriyo 3.4 mL tek kullanımlık transfer pipet kullanarak % 3 methylcellulose ile aktarın. Bir floresan diseksiyon kapsamı altında bir iğne kullanarak hücresel GFP etkinliğini görüntülemek için istenen konumlara embriyo ayarlayın.</li>
	<li>Balık embriyo (12 somite sahne büyük) hareketli aşamaları için % 0.05 tricaine mesylate balık embriyo slaytlara aktarmadan önce anestezi için kullanın. Kısaca, yüzme ve beden denge kaybı durdurulana kadar balık embriyo %0,05 tricaine mesylate balık su içine ortaya. Ayrıca, slayt üzerinde %0,05 tricaine mesylate methylcellulose ile bir damla ekleyin.</li>
	<li>Az 12 somite sahne balık için embriyo, epi-floresan mikroskop bileşik bir uyumlu kamera ve yazılım ile görüntüleme için kullanın. 12 somite sahne balık embriyolar daha eski için Floresans diseksiyon mikroskop kullanın.</li>
	<li>Tümör hücre voltajı resim, ilk balık MPNST tümörler ile tanımlamak için. O zaman, %0.05 tricaine mesylate balıkla anestezi. Bütün Dağı görüntüleme için balık 10 cm çapında Petri kabına koymak. Tümör hücre elektrik etkinliğini görüntülemek için balık tümörler dışarı bütün Dağı görüntüleme sonra disseke.</li>
</ol>

<ol>
	<li>Levin, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+bioelectricity:+how+endogenous+voltage+potentials+control+cell+behavior+and+instruct+pattern+regulation+in+vivo.">Molecular bioelectricity: how endogenous voltage potentials control cell behavior and instruct pattern regulation in vivo.</a> Molecular Biology of the Cell. 25 (24), 3835-3850 (2014).</li><li>Storace, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Toward+Better+Genetically+Encoded+Sensors+of+Membrane+Potential.">Toward Better Genetically Encoded Sensors of Membrane Potential.</a> Trends in Neuroscience. 39 (5), 277-289 (2016).</li><li>Inagaki, S., Nagai, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+progress+in+genetically+encoded+voltage+indicators+for+neural+activity+recording.">Current progress in genetically encoded voltage indicators for neural activity recording.</a> Current Opinion in Chemical Biology. 33, 95-100 (2016).</li><li>St-Pierre, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-fidelity+optical+reporting+of+neuronal+electrical+activity+with+an+ultrafast+fluorescent+voltage+sensor.">High-fidelity optical reporting of neuronal electrical activity with an ultrafast fluorescent voltage sensor.</a> Nature Neuroscience. 17 (6), 884-889 (2014).</li><li>Lieschke, G. J., Currie, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Animal+models+of+human+disease:+zebrafish+swim+into+view.">Animal models of human disease: zebrafish swim into view.</a> Nature Reviews Genetics. 8 (5), 353-367 (2007).</li><li>Santoriello, C., Zon, L. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hooked!+Modeling+human+disease+in+zebrafish.">Hooked! Modeling human disease in zebrafish.</a> Journal of Clinical Investigation. 122 (7), 2337-2343 (2012).</li><li>Howe, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+zebrafish+reference+genome+sequence+and+its+relationship+to+the+human+genome.">The zebrafish reference genome sequence and its relationship to the human genome.</a> Nature. , (2013).</li><li>Kawakami, K., Shima, A., Kawakami, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+functional+transposase+of+the+Tol2+element,+an+Ac-like+element+from+the+Japanese+medaka+fish,+and+its+transposition+in+the+zebrafish+germ+lineage.">Identification of a functional transposase of the Tol2 element, an Ac-like element from the Japanese medaka fish, and its transposition in the zebrafish germ lineage.</a> Proceedings of the National Academy of Science USA. 97 (21), 11403-11408 (2000).</li><li>Urasaki, A., Asakawa, K., Kawakami, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+transposition+of+the+Tol2+transposable+element+from+a+single-copy+donor+in+zebrafish.">Efficient transposition of the Tol2 transposable element from a single-copy donor in zebrafish.</a> Proceedings of the National Academy of Science USA. 105 (50), 19827-19832 (2008).</li><li>Kwan, K. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Tol2kit:+a+multisite+gateway-based+construction+kit+for+Tol2+transposon+transgenesis+constructs.">The Tol2kit: a multisite gateway-based construction kit for Tol2 transposon transgenesis constructs.</a> Developmental Dynamics. 236 (11), 3088-3099 (2007).</li><li>Mosimann, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ubiquitous+transgene+expression+and+Cre-based+recombination+driven+by+the+ubiquitin+promoter+in+zebrafish.">Ubiquitous transgene expression and Cre-based recombination driven by the ubiquitin promoter in zebrafish.</a> Development. 138 (1), 169-177 (2011).</li><li>Lorenz, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polymerase+chain+reaction:+basic+protocol+plus+troubleshooting+and+optimization+strategies.">Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies.</a> Journal of Visualized Experiments. (63), e3998 (2012).</li><li>Ordovas, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Separation+of+small-size+DNA+fragments+using+agarose+gel+electrophoresis.">Separation of small-size DNA fragments using agarose gel electrophoresis.</a> Methods in Molecular Biology. 110, 35-42 (1998).</li><li>Downey, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extraction+of+DNA+from+agarose+gels.">Extraction of DNA from agarose gels.</a> Methods Mol Biol. 235, 137-139 (2003).</li><li>Desjardins, P., Conklin, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NanoDrop+microvolume+quantitation+of+nucleic+acids.">NanoDrop microvolume quantitation of nucleic acids.</a> Journal of Visualized Experiments. 45 (45), (2010).</li><li>Green, M. R., Sambrook, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular cloning : a laboratory manual. , (2012).</li><li>Zhang, S., Cahalan, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purifying+plasmid+DNA+from+bacterial+colonies+using+the+QIAGEN+Miniprep+Kit.">Purifying plasmid DNA from bacterial colonies using the QIAGEN Miniprep Kit.</a> Journal of Visualized Experiments. (6), 247 (2007).</li><li>Meeker, N. D., Hutchinson, S. A., Ho, L., Trede, N. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Method+for+isolation+of+PCR-ready+genomic+DNA+from+zebrafish+tissues.">Method for isolation of PCR-ready genomic DNA from zebrafish tissues.</a> Biotechniques. 43 (5), (2007).</li><li>Kawakami, K., Koga, A., Hori, H., Shima, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Excision+of+the+tol2+transposable+element+of+the+medaka+fish,+Oryzias+latipes,+in+zebrafish,+Danio+rerio.">Excision of the tol2 transposable element of the medaka fish, Oryzias latipes, in zebrafish, Danio rerio.</a> Gene. 225 (1-2), 17-22 (1998).</li><li>Westerfield, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The zebrafish book. A guide for the laboratory use of zebrafish (Danio rerio). , (2000).</li><li>Amsterdam, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Many+ribosomal+protein+genes+are+cancer+genes+in+zebrafish.">Many ribosomal protein genes are cancer genes in zebrafish.</a> PLoS Biology. 2 (5), E139 (2004).</li><li>Lai, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Many+ribosomal+protein+mutations+are+associated+with+growth+impairment+and+tumor+predisposition+in+zebrafish.">Many ribosomal protein mutations are associated with growth impairment and tumor predisposition in zebrafish.</a> Developmental Dynamics. 238 (1), 76-85 (2009).</li><li>Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B., Schilling, T. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stages+of+embryonic+development+of+the+zebrafish.">Stages of embryonic development of the zebrafish.</a> Developmental Dynamics. 203 (3), 253-310 (1995).</li><li>Zhang, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+oncogenomic+analysis+of+copy+number+alterations+in+human+and+zebrafish+tumors+enables+cancer+driver+discovery.">Comparative oncogenomic analysis of copy number alterations in human and zebrafish tumors enables cancer driver discovery.</a> PLoS Genetics. 9 (8), e1003734 (2013).</li><li>Zhang, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+aneuploid+zebrafish+malignant+peripheral+nerve+sheath+tumors+have+genetic+alterations+similar+to+human+cancers.">Highly aneuploid zebrafish malignant peripheral nerve sheath tumors have genetic alterations similar to human cancers.</a> Proceedings of the National Academy of Science USA. 107 (39), 16940-16945 (2010).</li><li>Urrego, D., Tomczak, A. P., Zahed, F., Stuhmer, W., Pardo, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potassium+channels+in+cell+cycle+and+cell+proliferation.">Potassium channels in cell cycle and cell proliferation.</a> Philosophical Transactions of the Royal Society of London Series B. 369 (1638), 20130094 (2014).</li><li>Yang, H. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Subcellular+Imaging+of+Voltage+and+Calcium+Signals+Reveals+Neural+Processing+In+Vivo.">Subcellular Imaging of Voltage and Calcium Signals Reveals Neural Processing In Vivo.</a> Cell. 166 (1), 245-257 (2016).</li><li>Chamberland, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+two-photon+imaging+of+subcellular+voltage+dynamics+in+neuronal+tissue+with+genetically+encoded+indicators.">Fast two-photon imaging of subcellular voltage dynamics in neuronal tissue with genetically encoded indicators.</a> Elife. 6, (2017).</li><li>Hochbaum, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=All-optical+electrophysiology+in+mammalian+neurons+using+engineered+microbial+rhodopsins.">All-optical electrophysiology in mammalian neurons using engineered microbial rhodopsins.</a> Nature Methods. 11 (8), 825-833 (2014).</li><li>Sugiyama, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Illuminating+cell-cycle+progression+in+the+developing+zebrafish+embryo.">Illuminating cell-cycle progression in the developing zebrafish embryo.</a> Proceedings of the National Academy of Science USA. 106 (49), 20812-20817 (2009).</li></ol>

Yazarlar ifşa gerek yok.

Her ne kadar cep ve doku düzeyinde elektrik faaliyetleri sırasında embriyonik geliştirme ve insan hastalık uzun zaman önce keşfedildi, vivo içinde dinamik elektrik değişiklikleri ve biyolojik rolleri hala büyük ölçüde bilinmeyen kalır. Büyük zorluklardan biri görselleştirmek ve elektrik değişiklikleri ölçmek etmektir. Yama kelepçe teknoloji bir mola-tek hücre izlemek için geçer ancak birçok hücrelerinin oluşan oldukları için uygulama omurgalı embriyolar için sınırlıdır. Ge?...

Bioelectricity endojen elektrik iyon kanalları ve hücre zarının1üzerinde bulunan pompalar aracılı sinyalleşme için ifade eder. Hücresel membran ve eşleşmiş Elektrik potansiyeli ve geçerli değişiklikleri, iyonik değişim süreçleri telaşlı nöronal ve kas hücrelerinin sinyal için gereklidir. Buna ek olarak, bioelectricity ve iyon degradeler çeşitli enerji depolama, biyosentezi ve metaboliti ulaşım da dahil olmak üzere diğer önemli Biyolojik işlevleri var. Biyoelektrik sinyal Ayrıca embriyonik Desen oluşumu, vücut eksenleri, hücre döngüsü ve hücre farklılaşması1gibi bir düzenleyici olarak keşfedilmiştir. Böylece, bu tür sinyal yanlış düzenlenmesi neden pek çok insan Konjenital hastalıklar anlamak için önemlidir. Yama kelepçe yaygın tek hücreleri kaydetmek için kullanılmıştır, aynı anda birden fazla hücreleri embriyonik gelişim içinde vivosırasında izleme için ideal hala uzak olsa da. Ayrıca, voltaj duyarlı küçük moleküller de vivo içinde uygulamalar nedeniyle onların özelliklerine, hassasiyetleri ve toksisite için ideal değildir.
Çeşitli oluşturulması genetik olarak bu sorunu aşmak için yeni bir mekanizma floresan voltaj göstergelerinin (GEVIs) Teklifler kodlanmış ve düz-se bile onlar aslında sinir izlemek için istenmeyen embriyonik gelişim, eğitim kolay uygulama sağlar 2,3hücreleri. Şu anda mevcut GEVIs biri hız sensörü aksiyon potansiyelleri 1'in (ASAP1)4. Voltaj duyarlı fosfataz ve dairesel yayın derlenemiyor yeşil flüoresan protein bir gerilim algılamalı etki alanının hücre dışı bir döngü oluşur. Bu nedenle, ASAP1 hücresel elektrik potansiyel değişiklikleri görselleştirme sağlar (Polarizasyon: parlak yeşil; depolarizasyon: koyu yeşil). ASAP1 2 ms açık ve kapalı Kinetik vardır ve subthreshold olası değişiklik4izleyebilirsiniz. Böylece, bu genetik aracı gerçek zamanlı biyo-elektrik canlı hücrelerde izleme etkinliğinin yeni düzeyi sağlar. Daha fazla bioelectricity embriyonik geliştirme ve birçok insan hastalıkları, kanser gibi rollerini anlamak hastalık tedavi ve korunma için kritik olan temel mekanizmaları, yeni ışık tutacak.
Zebra balığı gelişim biyolojisi ve insan hastalıkları kanser5,6dahil olmak üzere çalışmaya güçlü bir hayvan modeli kanıtlanmıştır. Onlar % 70 orthologous genler insanlarla paylaşmak ve onlar-si olmak benzer omurgalı Biyoloji7. Zebra balığı nispeten kolay bakım, yumurta, uysal genetik, kolay transgenesis ve saydam dış embriyonik geliştirme, hangi yapmak onları vivo içinde görüntüleme5,6için üstün bir sistemi büyük debriyaj boyutunu sağlar. Bir büyük satırların kaynağı olan mutant balık zaten mevcut ve tam sıralı genom, Zebra balığı bilimsel keşif nispeten sınırsız bir dizi sağlayacaktır.
Hücreleri vivo içinde gerçek zamanlı elektriksel aktivitesinin araştırmak için Zebra balığı modeli sistemi ve ASAP1 avantajlarından yararlanın. Bu yazıda nasıl flüoresan gerilim Biyoalgılayıcı ASAP1 Tol2 transposon transgenesis kullanarak Zebra balığı genom dahil tarif ve hücresel elektriksel aktivite sırasında embriyonik gelişim, Balık larva hareketi ve canlı tümör görselleştirmek .

<table><tbody><tr><td>14mL cell culture tubes</td><td>VWR</td><td>60818-725</td><td>E.Coli culture</td></tr><tr><td>Agarose electrophoresis tank</td><td>Thermo Scientific</td><td>Owl B2</td><td>DNA eletrophoresis</td></tr><tr><td>Agarose RA</td><td>Amresco</td><td>N605-500G</td><td>For making the injection gels</td></tr><tr><td>Attb1-ASAP1-F primer</td><td>IDT DNA</td><td>GGGGACAAGTTTGTACAAAAAA&lt;br /&gt;GCAGGCTTCACCATGGAGACGA&lt;br /&gt;CTGTGAGGTATGAACA</td><td>ASAP1 coding region amplification for subcloning</td></tr><tr><td>Attb2-ASAP1-R primer</td><td>IDT DNA</td><td>GGGGACCACTTTGTACAAGAAA&lt;br /&gt;GCTGGGTCTTAGGTTACCACTTC&lt;br /&gt;AAGTTGTTTCTTCTGTGAAGCCA</td><td>ASAP1 coding region amplification for subcloning</td></tr><tr><td>Bright field dissection scope</td><td>Nikon</td><td>SMZ 745</td><td>Dechorionation, microinjection, mounting</td></tr><tr><td>Color camera</td><td>Zeiss</td><td>AxioCam MRc</td><td>Fish embryo image recording</td></tr><tr><td>Concave slide</td><td>VWR</td><td>48336-001</td><td>For holding fish embryos during imaging process</td></tr><tr><td>Disposable transfer pipette 3.4 ml</td><td>Thermo Scientific</td><td>13-711-9AM</td><td>Fish embryos and water transfer</td></tr><tr><td>Endonuclease enzyme, Not I</td><td>NEB</td><td>R0189L</td><td>For linearizing plasmid DNA</td></tr><tr><td>Epifuorescent compound scope</td><td>Zeiss</td><td>Axio Imager.A2</td><td>Fish embryo imaging</td></tr><tr><td>Epifuorescent stereo dissection scope</td><td>Zeiss</td><td>Stereo Discovery.V12</td><td>Fish embryo imaging</td></tr><tr><td>Fluorescent light source</td><td>Lumen dynamics</td><td>X-cite seris 120</td><td>Light source for fluorescence microscopes</td></tr><tr><td>Forceps #5</td><td>WPI</td><td>500342</td><td>Dechorionation and needle breaking</td></tr><tr><td>Gateway BP Clonase II Enzyme mix</td><td>Thermo Scientific</td><td>11789020</td><td>Gateway BP recombination cloning</td></tr><tr><td>Gateway LR Clonase II Plus enzyme</td><td>Thermo Scientific</td><td>12538120</td><td>Gateway LR recombination cloning</td></tr><tr><td>Gel DNA Recovery Kit</td><td>Zymo Research</td><td>D4002</td><td>DNA gel purification</td></tr><tr><td>Loading tip</td><td>Eppendorf</td><td>930001007</td><td>For loading injection solution into capilary needles</td></tr><tr><td>Methylcellulose (1600cPs)</td><td>Alfa Aesar</td><td>43146</td><td>Fish embryo mounting</td></tr><tr><td>Methylene blue</td><td>Sigma-Aldrich</td><td>M9140</td><td>Suppresses fungal outbreaks in Petri dishes</td></tr><tr><td>Microinjection mold</td><td>Adaptive Science Tools</td><td>TU-1</td><td>To prepare agaorse mold tray for holding fish embryos during injection</td></tr><tr><td>Microinjector</td><td>WPI</td><td>Pneumatic Picopump PV820</td><td>Microinjection injector</td></tr><tr><td>Micro-manipulator</td><td>WPI</td><td>Microinjector MM3301R</td><td>Microinjection operation</td></tr><tr><td>Micropipette puller</td><td>Sutter instrument</td><td>P-1000</td><td>For preparing capillary needle</td></tr><tr><td>Mineral oil</td><td>Amresco</td><td>J217-500ml</td><td>For calibrating injection volume</td></tr><tr><td>mMESSAGE mMACHINE SP6 Transcription Kit</td><td>Thermo Scientific</td><td>AM1340</td><td>mRNA in vitro transcription</td></tr><tr><td>Monocolor camera</td><td>Zeiss</td><td>AxioCam MRm</td><td>Fish embryo image recording</td></tr><tr><td>Plasmid Miniprep Kit</td><td>Zymo Research</td><td>D4020</td><td>Prepare small amount of plasmid DNA</td></tr><tr><td>Plastic Petri dishes</td><td>VWR</td><td>25384-088</td><td>For holding fish or fish embryos during imaging process</td></tr><tr><td>RNA Clean &amp;amp; Concentrator-5</td><td>Zymo Research</td><td>R1015</td><td>mRNA cleaning after in vitro transcription</td></tr><tr><td>Spectrophotometer</td><td>Thermo Scientific</td><td>NanoDrop 2000</td><td>For measuring DNA and RNA concentrations</td></tr><tr><td>Stage Micrometer</td><td>Am Scope</td><td>MR100</td><td>Microinjection volume calibration</td></tr><tr><td>Thermocycler</td><td>Bio-Rad</td><td>T100</td><td>DNA amplification for gene cloning</td></tr><tr><td>Thin wall glass capillaries</td><td>WPI</td><td>TW100F-4</td><td>Raw glass for making cappilary needle</td></tr><tr><td>Tol2-exL1 primer</td><td>IDT DNA</td><td>GCACAACACCAGAAATGCCCTC</td><td>Tol2 excise assay</td></tr><tr><td>Tol2-exR primer</td><td>IDT DNA</td><td>ACCCTCACTAAAGGGAACAAAAG</td><td>Tol2 excise assay</td></tr><tr><td>TOP10 Chemically Competent E. coli</td><td>Thermo Scientific</td><td>C404006</td><td>Used for transformation during gene cloning</td></tr><tr><td>Tricaine mesylate</td><td>Sigma-Aldrich</td><td>A5040</td><td>For anesthetizing fish or fish embryos</td></tr><tr><td>UV trans-illuminator 302nm</td><td>UVP</td><td>M-20V</td><td>DNA visualization</td></tr><tr><td>Water bath</td><td>Thermo Scientific</td><td>2853</td><td>For transformation process of gene cloning</td></tr></tbody></table>

visualization of cellular electrical activity in zebrafish early embryos and tumors

Bioelectricity, endojen elektrik iyon kanalları tarafından aracılı sinyalleşme ve hücre zarı üzerinde bulunan pompalar oynar gibi telaşlı nöronal ve kas hücrelerinin süreçleri ve birçok diğer biyolojik süreçler, sinyal önemli roller embriyonik gelişimsel desenlendirme. Ancak, in vivo omurgalı embriyogenez elektrik etkinliğini izleme için bir ihtiyaç vardır. Genetik olarak kodlanmış floresan voltaj göstergelerinin (GEVIs) gelişmeler bu sorun için bir çözüm sağlamak mümkün kılmıştır. Burada, nasıl bir transgenik voltaj göstergesi Zebra balığı kurulan voltaj göstergesi, ASAP1 kullanarak oluşturulacağını açıklar (hız sensörü, Aksiyon potansiyelleri 1), örnek olarak. Tol2 kit ve her yerde birden bulunan Zebra balığı organizatörü, ubi, bu çalışmada seçildi. Biz aynı zamanda ağ geçidi siteye özgü klonlama, Tol2 transposon tabanlı Zebra balığı transgenesis ve normal epifluorescent mikroskoplar kullanarak aşamasındaki balık embriyo ve balık tümörleri için görüntüleme işlemi işlemleri açıklar. Bu balık satırını kullanarak, Zebra balığı embriyo ve balık larva hareketi sırasında hücresel elektrik voltaj değişiklikleri vardır bulundu. Ayrıca, birkaç Zebra balığı Malign periferik sinir kılıf tümörleri içinde çevresindeki normal dokuların hücreleri genellikle polarize tümör karşılaştırıldığında gözlendi.

Bir başarılı yerleştirmeye, fazla enjekte % 50 balık embriyo yeşil floresan bir dereceye somatik hücreler görüntüler ve bunların çoğu Tol2 transposon tüketim tahlil (Şekil 2) tarafından olumlu olacaktır. 2-4 nesil (floresan balık % 50, beklenen Mendel oranı gelinceye) wildtype balıkla dışı geçtikten sonra transgenik balık hücre membran potansiyeli embriyonik gelişim sırasında izlemek için görüntüleme deneme için kullanılmı?...

Watch this Scientific Journal Video about Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors at JoVE.com

Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors

Zebra balığı erken embriyo ve tümör hücresel elektrik aktivitesinin görselleştirme

Burada, bir hücresel elektrik voltaj muhabir Zebra balığı çizgi embriyonik gelişim, hareket, görselleştirmek için oluşturma sürecini göstermek ve in vivobalık tümör hücreleri.

Bioelectricity, endogenous electrical signaling mediated by ion channels and pumps located on the cell membrane, plays important roles in signaling ...

visualization-cellular-electrical-activity-zebrafish-early-embryos

Universidad de Cartagena UDEC

Research

JoVE Journal

Developmental Biology

8.7K Görüntüleme.  Purdue University. Burada, bir hücresel elektrik voltaj muhabir Zebra balığı çizgi embriyonik gelişim, hareket, görselleştirmek için oluşturma sürecini göstermek ve in vivobalık tümör hücreleri.

Video: Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors

Time-lapse Live Imaging of Clonally Related Neural Progenitor Cells in the Developing Zebrafish Forebrain

Precise patterns of division, migration and differentiation of neural progenitor cells are crucial for proper brain development and function1,2. To understand the behavior of neural progenitor cells in the complex in vivo environment, time-lapse live imaging of neural progenitor cells in an intact brain is critically required. In this video, we exploit the unique features of zebrafish embryos to visualize the development of forebrain neural progenitor cells in vivo. We use electroporation to genetically and sparsely label individual neural progenitor cells. Briefly, DNA constructs coding for fluorescent markers were injected into the forebrain ventricle of 22 hours post fertilization (hpf) zebrafish embryos and electric pulses were delivered immediately. Six hours later, the electroporated zebrafish embryos were mounted with low melting point agarose in glass bottom culture dishes. Fluorescently labeled neural progenitor cells were then imaged for 36hours with fixed intervals under a confocal microscope using water dipping objective lens. The present method provides a way to gain insights into the in vivo development of forebrain neural progenitor cells and can be applied to other parts of the central nervous system of the zebrafish embryo.

The present video demonstrates a method which takes advantage of the combination of electroporation and confocal microscopy to perform live imaging on individual neural progenitor cells in the developing zebrafish forebrain. In vivo analysis of the development of forebrain neural progenitor cells at a clonal level can be achieved in this way.

Gelişmekte olan Zebra balığı önbeyin klonal olarak ilişkilidir Sinir Progenitör Hücreler Zaman atlamalı Canlı Görüntüleme

Precise patterns of division, migration and differentiation of neural progenitor cells are crucial for proper brain development and function1,2. To ...

Nörobilim

Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos

The protocols described here are designed to allow researchers to study cell communication without altering the integrity of the environment in which the cells are located. Specifically, they have been developed to analyze the electrical activity of excitable cells, such as spinal neurons. In such a scenario, it is crucial to preserve the integrity of the spinal cell, but it is also important to preserve the anatomy and physiological shape of the systems involved. Indeed, the comprehension of the manner in which the nervous system-and other complex systems-works must be based on a systemic approach. For this reason, the live zebrafish embryo was chosen as a model system, and the spinal neuron membrane voltage changes were evaluated without interfering with the physiological conditions of the embryos. 
Here, an approach combining the employment of zebrafish embryos with a FRET-based biosensor is described. Zebrafish embryos are characterized by a very simplified nervous system and are particularly suited for imaging applications thanks to their transparency, allowing for the employment of fluorescence-based voltage indicators at the plasma membrane during zebrafish development. The synergy between these two components makes it possible to analyze the electrical activity of the cells in intact living organisms, without perturbing the physiological state. Finally, this non-invasive approach can co-exist with other analyses (e.g., spontaneous movement recordings, as shown here).

Protocols described here allow for the study of the electrical properties of excitable cells in the most non-invasive physiological conditions by employing zebrafish embryos in an in vivo system together with a fluorescence resonance energy transfer (FRET)-based genetically encoded voltage indicator (GEVI) selectively expressed in the cell type of interest.

Canlı Zebra balığı Embriyolarında Biosense Motor Nöron Membranı Potansiyeli

The protocols described here are designed to allow researchers to study cell communication without altering the integrity of the environment in which the ...

Gelişim Biyolojisi

Live Imaging of the Zebrafish Embryonic Brain by Confocal Microscopy

In this video, we demonstrate the method our lab has developed to analyze the cell shape changes and rearrangements required to bend and fold the developing zebrafish brain (Gutzman et al, 2008). Such analysis affords a new understanding of the underlying cell biology required for development of the 3D structure of the vertebrate brain, and significantly increases our ability to study neural tube morphogenesis. The embryonic zebrafish brain is shaped beginning at 18 hours post fertilization (hpf) as the ventricles within the neuroepithelium inflate. By 24 hpf, the initial steps of neural tube morphogenesis are complete. Using the method described here, embryos at the one cell stage are injected with mRNA encoding membrane-targeted green fluorescent protein (memGFP). After injection and incubation, the embryo, now between 18 and 24 hpf, is mounted, inverted, in agarose and imaged by confocal microscopy. Notably, the zebrafish embryo is transparent making it an ideal system for fluorescent imaging. While our analyses have focused on the midbrain-hindbrain boundary and the hindbrain, this method could be extended for analysis of any region in the zebrafish to a depth of 
80-100 &mu;m.

In this video, we demonstrate a method by which to analyze the developing vertebrate brain in live zebrafish embryos at single cell resolution by confocal microscopy. This includes the method by which we inject the single-cell zebrafish embryo and subsequently mount and image the developing brain.

Konfokal Mikroskop Zebra balığı Embriyonik Beyin Görüntüleme Canlı

In this video, we demonstrate the method our lab has developed to analyze the cell shape changes and rearrangements required to bend and fold the ...

Biyoloji

Forebrain Electrophysiological Recording in Larval Zebrafish

Epilepsy affects nearly 3 million people in the United States and up to 50 million people worldwide. Defined as the occurrence of spontaneous unprovoked seizures, epilepsy can be acquired as a result of an insult to the brain or a genetic mutation. Efforts to model seizures in animals have primarily utilized acquired insults (convulsant drugs, stimulation or brain injury) and genetic manipulations (antisense knockdown, homologous recombination or transgenesis) in rodents. Zebrafish are a vertebrate model system1-3 that could provide a valuable alternative to rodent-based epilepsy research. Zebrafish are used extensively in the study of vertebrate genetics or development, exhibit a high degree of genetic similarity to mammals and express homologs for ~85% of known human single-gene epilepsy mutations. Because of their small size (4-6 mm in length), zebrafish larvae can be maintained in fluid volumes as low as 100 &mu;l during early development and arrayed in multi-well plates. Reagents can be added directly to the solution in which embryos develop, simplifying drug administration and enabling rapid in vivo screening of test compounds4. Synthetic oligonucleotides (morpholinos), mutagenesis, zinc finger nuclease and transgenic approaches can be used to rapidly generate gene knockdown or mutation in zebrafish5-7. These properties afford zebrafish studies an unprecedented statistical power analysis advantage over rodents in the study of neurological disorders such as epilepsy. Because the "gold standard" for epilepsy research is to monitor and analyze the abnormal electrical discharges that originate in a central brain structure (i.e., seizures), a method to efficiently record brain activity in larval zebrafish is described here. This method is an adaptation of conventional extracellular recording techniques and allows for stable long-term monitoring of brain activity in intact zebrafish larvae. Sample recordings are shown for acute seizures induced by bath application of convulsant drugs and spontaneous seizures recorded in a genetically modified fish.

A simple method to record extracellular field potentials in the larval zebrafish forebrain is described. The method provides a robust in vivo read-out of seizure-like activity. This technique can be used with genetically modified zebrafish larvae carrying epilepsy-related genes or seizures evoked by administration of convulsant drugs.

Larva Zebra balığı olarak önbeyin Elektrofizyolojik Kaydı

Epilepsy affects nearly 3 million people in the United States and up to 50 million people worldwide. Defined as the occurrence of spontaneous unprovoked ...

Live Imaging of Cell Motility and Actin Cytoskeleton of Individual Neurons and Neural Crest Cells in Zebrafish Embryos

The zebrafish is an ideal model for imaging cell behaviors during development in vivo. Zebrafish embryos are externally fertilized and thus easily accessible at all stages of development. Moreover, their optical clarity allows high resolution imaging of cell and molecular dynamics in the natural environment of the intact embryo. We are using a live imaging approach to analyze cell behaviors during neural crest cell migration and the outgrowth and guidance of neuronal axons.
Live imaging is particularly useful for understanding mechanisms that regulate cell motility processes. To visualize details of cell motility, such as protrusive activity and molecular dynamics, it is advantageous to label individual cells. In zebrafish, plasmid DNA injection yields a transient mosaic expression pattern and offers distinct benefits over other cell labeling methods. For example, transgenic lines often label entire cell populations and thus may obscure visualization of the fine protrusions (or changes in molecular distribution) in a single cell. In addition, injection of DNA at the one-cell stage is less invasive and more precise than dye injections at later stages.
Here we describe a method for labeling individual developing neurons or neural crest cells and imaging their behavior in vivo. We inject plasmid DNA into 1-cell stage embryos, which results in mosaic transgene expression. The vectors contain cell-specific promoters that drive expression of a gene of interest in a subset of sensory neurons or neural crest cells. We provide examples of cells labeled with membrane targeted GFP or with a biosensor probe that allows visualization of F-actin in living cells1.
Erica Andersen, Namrata Asuri, and Matthew Clay contributed equally to this work.

This protocol describes imaging of individual neurons or neural crest cells in living zebrafish embryos. This method is used to examine cellular behaviors and actin localization using fluorescence confocal time-lapse microscopy.

Zebra balığı Embriyolar Bireysel Nöronlar ve Sinir Crest Hücreler Aktin Sitoiskelet Hücre Motilite ve Canlı Görüntüleme

The zebrafish is an ideal model for imaging cell behaviors during development in vivo. Zebrafish embryos are externally fertilized and thus easily ...

Visualizing the Developing Brain in Living Zebrafish using Brainbow and Time-lapse Confocal Imaging

Development of the vertebrate nervous system requires a precise coordination of complex cellular behaviors and interactions. The use of high resolution in vivo imaging techniques can provide a clear window into these processes in the living organism. For example, dividing cells and their progeny can be followed in real time as the nervous system forms. In recent years, technical advances in multicolor techniques have expanded the types of questions that can be investigated. The multicolor Brainbow approach can be used to not only distinguish among like cells, but also to color-code multiple different clones of related cells that each derive from one progenitor cell. This allows for a multiplex lineage analysis of many different clones and their behaviors simultaneously during development. Here we describe a technique for using time-lapse confocal microscopy to visualize large numbers of multicolor Brainbow-labeled cells over real time within the developing zebrafish nervous system. This is particularly useful for following cellular interactions among like cells, which are difficult to label differentially using traditional promoter-driven colors. Our approach can be used for tracking lineage relationships among multiple different clones simultaneously. The large datasets generated using this technique provide rich information that can be compared quantitatively across genetic or pharmacological manipulations. Ultimately the results generated can help to answer systematic questions about how the nervous system develops.

In vivo imaging is a powerful tool that can be used to investigate the cellular mechanisms underlying nervous system development. Here we describe a technique for using time-lapse confocal microscopy to visualize large numbers of multicolor Brainbow-labeled cells in real time within the developing zebrafish nervous system.

Brainbow ve Time-lapse Konfokal Görüntüleme kullanarak Yaşayan Zebrabalıklarında Gelişen Beyni Görselleştirme

Development of the vertebrate nervous system requires a precise coordination of complex cellular behaviors and interactions. The use of high resolution in ...

Multicolor Time-lapse Imaging of Transgenic Zebrafish: Visualizing Retinal Stem Cells Activated by Targeted Neuronal Cell Ablation

High-resolution time-lapse imaging of living zebrafish larvae can be utilized to visualize how biological processes unfold (for review see 1). Compound transgenic fish which express different fluorescent reporters in neighboring cell types provide a means of following cellular interactions 2 and/or tissue-level responses to experimental manipulations over time. In this video, we demonstrate methods that can be used for imaging multiple transgenically labeled cell types serially in individual fish over time courses that can span from minutes to several days. The techniques described are applicable to any study seeking to correlate the "behavior" of neighboring cells types over time, including: 1) serial 'catch and release' methods for imaging a large number of fish over successive days, 2) simplified approaches for separating fluorophores with overlapping excitation/emission profiles (e.g., GFP and YFP), 3) use of hypopigmented mutant lines to extend the time window available for high-resolution imaging into late larval stages of development, 4) use of membrane targeted fluorescent reporters to reveal fine morphological detail of individual cells as well as cellular details in larger populations of cells, and 5) a previously described method for chemically-induced ablation of transgenically targeted cell types; i.e., nitroreductase (NTR) mediated conversion of prodrug substrates, such as metronidazole (MTZ), to cytotoxic derivatives 3,5.
As an example of these approaches, we will visualize the ablation and regeneration of a subtype of retinal bipolar neuron within individual fish over several days. Simultaneously we will monitor several other retinal cell types, including neighboring non-targeted bipolar cells and potential degeneration-stimulated retinal stem cells (i.e., M&#971;ller glia). This strategy is being applied in our lab to characterize cell- and tissue-level (e.g., stem cell niche) responses to the selective loss and regeneration of targeted neuronal cell types.

In this video, techniques for multicolor confocal time-lapse imaging and targeted cell ablation are provided. Time-lapse imaging is used to monitor the behavior of multiple cell types of interest in vivo. Targeted cell ablation facilitates the study neural circuit function and cell-specific neuronal regeneration paradigms.

Transgenik Zebra balığı Multicolor Time-lapse Görüntüleme: Hedefli Nöronal Hücre Ablasyon aktifleşir görselleştirme Retina Kök Hücreler

High-resolution time-lapse imaging of living zebrafish larvae can be utilized to visualize how biological processes unfold (for review see 1). Compound ...

Imaging and 3D Reconstruction of Cerebrovascular Structures in Embryonic Zebrafish

Zebrafish are a powerful tool to study developmental biology and pathology in vivo. The small size and relative transparency of zebrafish embryos make them particularly useful for the visual examination of processes such as heart and vascular development. In several recent studies transgenic zebrafish that express EGFP in vascular endothelial cells were used to image and analyze complex vascular networks in the brain and retina, using confocal microscopy. Descriptions are provided to prepare, treat and image zebrafish embryos that express enhanced green fluorescent protein (EGFP), and then generate comprehensive 3D renderings of the cerebrovascular system. Protocols include the treatment of embryos, confocal imaging, and fixation protocols that preserve EGFP fluorescence. Further, useful tips on obtaining high-quality images of cerebrovascular structures, such as removal the eye without damaging nearby neural tissue are provided. Potential pitfalls with confocal imaging are discussed, along with the steps necessary to generate 3D reconstructions from confocal image stacks using freely available open source software.

Imaging of cerebrovascular development in larval zebrafish is described. Techniques to facilitate 3D imaging and modify cerebrovascular development using chemical treatments are also provided.

Görüntüleme ve Embriyonik Zebra balığı Serebrovasküler Yapıların 3D İmar

Zebrafish are a powerful tool to study developmental biology and pathology in vivo.  The small size and relative transparency of zebrafish embryos make ...

Semi-automated Imaging of Tissue-specific Fluorescence in Zebrafish Embryos

Zebrafish embryos are a powerful tool for large-scale screening of small molecules. Transgenic zebrafish that express fluorescent reporter proteins are frequently used to identify chemicals that modulate gene expression. Chemical screens that assay fluorescence in live zebrafish often rely on expensive, specialized equipment for high content screening. We describe a procedure using a standard epifluorescence microscope with a motorized stage to automatically image zebrafish embryos and detect tissue-specific fluorescence. Using transgenic zebrafish that report estrogen receptor activity via expression of GFP, we developed a semi-automated procedure to screen for estrogen receptor ligands that activate the reporter in a tissue-specific manner. In this video we describe procedures for arraying zebrafish embryos at 24-48 hours post fertilization (hpf) in a 96-well plate and adding small molecules that bind estrogen receptors. At 72-96 hpf, images of each well from the entire plate are automatically collected and manually inspected for tissue-specific fluorescence. This protocol demonstrates the ability to detect estrogens that activate receptors in heart valves but not in liver.

Described here is a protocol for semi-automated imaging of tissue-specific fluorescence in zebrafish embryos.

Zebra balığı Embriyolar Doku spesifik Floresans yarı otomatik Görüntüleme

Zebrafish embryos are a powerful tool for large-scale screening of small molecules. Transgenic zebrafish that express fluorescent reporter proteins are ...

In vivo Imaging of Fully Active Brain Tissue in Awake Zebrafish Larvae and Juveniles by Skull and Skin Removal

Understanding the ephemeral changes that occur during brain development and maturation requires detailed high-resolution imaging in space and time at cellular and subcellular resolution. Advances in molecular and imaging technologies have allowed us to gain numerous detailed insights into cellular and molecular mechanisms of brain development in the transparent zebrafish embryo. Recently, processes of refinement of neuronal connectivity that occur at later larval stages several weeks after fertilization, which are for example control of social behavior, decision making or motivation-driven behavior, have moved into focus of research. At these stages, pigmentation of the zebrafish skin interferes with light penetration into brain tissue, and solutions for embryonic stages, e.g., pharmacological inhibition of pigmentation, are not feasible anymore.
Therefore, a minimally invasive surgical solution for microscopy access to the brain of awake zebrafish is provided that is derived from electrophysiological&#160;approaches. In teleosts, skin and soft skull cartilage can be carefully removed by micro-peeling these layers, exposing underlying neurons and axonal tracts without damage. This allows for recording neuronal morphology, including synaptic structures and their molecular contents, and the observation of physiological changes such as Ca2+ transients or intracellular transport events. In addition, interrogation of these processes by means of pharmacological inhibition or optogenetic manipulation is feasible. This brain exposure approach provides information about structural and physiological changes in neurons as well as the correlation and interdependence of these events in live brain tissue in the range of minutes or hours. The technique is suitable for in vivo brain imaging of zebrafish larvae up to 30 days post fertilization, the latest developmental stage tested so far. It, thus, provides access to such important questions as synaptic refinement and scaling, axonal and dendritic transport, synaptic targeting of cytoskeletal cargo or local activity-dependent expression. Therefore, a broad use for this mounting and imaging approach can be anticipated.

Here we present a method to image the zebrafish embryonic brain in vivo upto larval and juvenile stages. This microinvasive procedure, adapted from electrophysiological approaches, provides access to cellular and subcellular details of mature neuron and can be combined with optogenetics and neuropharmacological studies for characterizing brain function and drug intervention.

Kafatası ve Deri Temizleme ile Uyanık Zebra Balığı Larvaları ve Yavrularında Tam Aktif Beyin Dokusunun In vivo Görüntülemesi

Understanding the ephemeral changes that occur during brain development and maturation requires detailed high-resolution imaging in space and time at ...