Die Forschungsarbeit, die in dieser Publikation berichtet wurde durch das National Institute of General Medical Sciences von den National Institutes of Health Award Anzahl R35GM124913, Purdue University PI4D Incentive-Programm und PVM internen Wettbewerb unterstützt. Grundlagenforschung-Fonds-Programm. Der Inhalt ist ausschließlich in der Verantwortung der Autoren und nicht unbedingt die offizielle Meinung der finanziellen Mittel. Wir danken für das Konstrukt Tol2, Michael Lin für das Konstrukt ASAP1 Koichi Kawakami und Leonard Zon für die Ubi -Promoter zu konstruieren, durch Addgene.

Der Zebrabärbling in eine AAALAC genehmigt Tierstation untergebracht sind, und alle Versuche erfolgten nach den Protokollen von Purdue Animal Care und Nutzung Committee (PACUC) genehmigt.
1. Tol2 Transposon Plasmid Konstrukt Vorbereitung
Hinweis: Tol2, ein Transposon, das Medaka Fisch entdeckt wurde hat in der Zebrafisch Forschung Gemeinschaft8,9verbreitet wurde. Es wurde erfolgreich an das Gateway ortsspezifische Rekombination basierende Klonen System angenommen und als Tol2 Kit10bekannt. Das Tol2-Kit ermöglicht eine sehr komfortable Möglichkeit individuelle Ausdruck Konstrukte, während auch die Effizienz der Transgenese zu schaffen. So war es eine leichte Entscheidung, nutzen die Vorteile dieses Systems, und eine allgegenwärtige ASAP1 Ausdruck Zebrafisch Linie mit einem validierten Ubiquitin Promotor ASAP111fahren.
<ol><li>Erstellen einer mittleren Eintrag ASAP1 Konstrukt: pDONR221-ASAP1<ol>
<li>Das genetisch codierte Spannung Sensor ASAP1 Konstrukt, pcDNA3.1/Puro-CAG-ASAP1 (Plasmid #52519), von Addgene zu erwerben. Um die ASAP1 kodierenden Region zu verstärken, richten Sie eine PCR unter Verwendung der benutzerdefinierten Zündkapseln (attB1-ASAP1F und attB2-ASAP1R) flankiert mit AttB Sequenzen am 5'-Ende der Primer (Abbildung 1). Phusion-DNA-Polymerase wählte für seine hohe Effizienz und PCR-Zustände wurden basierend auf den zuvor veröffentlichten Protokoll12optimiert.</li>
		<li>Laden Sie die 50 µL-PCR-Produkte in eine 1 % TAE gel mit einer regelmäßigen Pipette mit 200 µL Spitzen und führen Sie Elektrophorese bei 160 V in einem horizontalen Gel Tank für ca. 30 min.</li>
		<li>Überprüfen Sie das Gel unter einem UV-Transilluminator (353 nm), Verbrauchsteuern, das gewünschte Band mit einem Messer/Skalpell unter einem UV-Transilluminator als bisher erschienen13,14, und setzen die DNA mit Gel-Probe in eine saubere 1,5 mL Microcentrifuge Rohr.</li>
		<li>Durchführen Sie Gel-Reinigung für die ASAP1 PCR-Produkte. Erholen Sie die DNA in den ausgeschnittenen Gel mit einem kommerziellen DNA-Gel Reinigung Kit nach Anweisungen des Herstellers zu, und eluieren Sie die DNA in 20 µL Wasser. 1 µL als Beispiel zu nehmen, und die DNA-Konzentration mit einem Spektralphotometer messen. Fließen Sie die Anweisungen der Software, die mit Wasser als ein leeres Steuerelement15.</li>
		<li>Nehmen Sie 100 ng des PCR-Produktes gereinigt und mischen Sie es mit 150 ng pDONR221 Plasmid in 10 µL TE-Puffer (10 mM Tris, 1 mM EDTA pH 8.0)16. Fügen Sie 2 µL BP Clonase II in die Reaktion und inkubieren Sie die Reaktion bei Raumtemperatur über Nacht.</li>
		<li>Am zweiten Tag fügen Sie 1 µL Proteinase K in die Reaktion und inkubieren Sie die Reaktion bei 37 ° C für 30 min.</li>
		<li>Führen Sie die Transformation. Übertragen Sie die Reaktion und mischen Sie es mit 50 µL der Top10 kompetente E. Coli Zellen und inkubieren Sie die Zellen für 30 min auf Eis. Dann Transfer das Reaktionsgefäß in ein Wasserbad 42 ° C für 1 min. sofort entfernen Sie den Schlauch und inkubieren Sie für 2 min auf Eis. Als nächstes legen Sie den Schlauch in einen Shaker 37 ° C und 1 h inkubieren.</li>
		<li>Das Rohr herausnehmen und die Zellen auf eine Kanamycin LB-Platte-Platte. Als nächstes inkubieren Sie die Platte über Nacht (16-18 h) bei 37 ° c</li>
		<li>Wählen Sie einzelne und gut getrennte Kolonien und in 14 mL Zelle Kultur Röhren mit 3 mL LB-Medium zu impfen. Kultur sie über Nacht bei 37 ° C in einem Shaker mit einer Drehzahl von 250 u/min (Umdrehung pro Minute).</li>
		<li>Führen Sie Miniprep mit einem kommerziellen Miniprep Kit nach seiner Anweisung manuelle17.</li>
		<li>Sequenz 3-4-Plasmide mit Sanger-Sequenzierung positiven pDONR221-ASAP1 identifizieren Klone mit M13F und M13R-Sequenzierung-Primern.</li>
	</ol>
</li>
	<li>Erstellen der Tol2 Konstrukt für die Mikroinjektion: pDestTol2 -Ubi-ASAP1<ol>
<li>Wählen Sie die Sequenzierung pDONR221 ASAP1 Klon und Maßnahme überprüft seine DNA-Konzentration mit einem Spektrophotometer folgenden der Software Anweisung mit Wasser, wie eine leere Steuern15.</li>
		<li>Nehmen Sie 100 µg pDONR221-ASAP1 und mischen Sie es mit 100 µg Tol2 Kit 5-End Plasmids (pENTR5'_ubi, Addgene #27320), 100 µg p3E-PolyA (Tol2 Kit #302) und 150 µg des pDestTol2pA2 (Tol2 Kit #394). Insgesamt Lautstärke zu 8 µL TE-Puffer (10 mM Tris, 1 mM EDTA, pH 8,0) in einer 1,5 mL Microcentrifuge Rohr und mischen Sie gut durch einen 2-5 s kurze Wirbel. Dann fügen Sie 2 µL des LR Clonase II plus und inkubieren Sie die Reaktion bei Raumtemperatur über Nacht.</li>
		<li>Am zweiten Tag 1 µL Proteinase K in die Reaktion mit einer 10 µL Pipette einfügen und die Reaktion bei 37 ° C für 30 min inkubieren.</li>
		<li>Führen Sie Transformation und identifizieren Sie positive Klone zu, wie oben (Schritte 1.1.7-11) beschrieben.</li>
		<li>Maßnahme die DNA-Konzentration der Sequenzierung überprüft pDestTol2 Ubi ASAP1 Klon (Abbildung 1 b) mit einem Spektrophotometer15. In der Regel ist die Konzentration um 200ng/µL.</li>
	</ol>
</li>
</ol>2. bereiten Sie Tol2 Transposase mRNA und Injektionslösung
<ol><li>Streak E. Coli Glycerin Bestand an pCS2FA-Transposase Plasmid (Tol2 Kit #396) auf eine LB-Platte (mit 100 µg/mL Ampicillin) mit einer sterilisierten Impfschlinge. Über Nacht inkubieren Sie die Platte bei 37 ° C in einem Inkubator. Am nächsten Tag, wählen Sie eine einzelne Kolonie und impfen Sie es in 3 mL LB (100 µg/mL Ampicillin) mit einer sterilisierten 10 µL PIPETTENSPITZE zu. Kultur es über Nacht bei 37 ° C in einem Shaker mit einer Drehzahl von 250 u/min.</li>
	<li>Führen Sie Miniprep auf die E. Coli -Kultur mit einem kommerziellen Miniprep Kit die Beachtung der Bedienungsanleitung. Eluieren Sie Plasmid-DNA in 30-50 µL TE-Puffer von 1 Minute Zentrifuge bei 14.000 u/min und Messen Sie seine DNA-Konzentration mit einem Spektralphotometer.</li>
	<li>Linearisieren 1-2 µg Plasmids mit nicht ich Endonuklease und Reinigen der DNA mit einer Reinigungs-Kit nicht ich die Bedienungsanleitung nach DNA Verdauung. Eluieren Sie die DNA in 5 µL Wasser durch Zentrifugieren bei 14.000 u/min für 1 Minute. Die erwartete Konzentration beträgt über 200-300 ng/µL.</li>
	<li>Führen Sie in Vitro Transkription mit nicht linearisiert ich pCS2FA-Transposase als DNA-Vorlage mit einem kommerziellen SP6 Transcription Kit.</li>
	<li>Wenn die Reaktion beendet ist, reinigen Sie Tol2 Transposase mRNA mit Hilfe einer Gebäudereinigung RNA kit nach den Anweisungen des Herstellers. Zu guter Letzt eluieren Sie mRNA in 20 µL RNAase-freies Wasser und Messen Sie die RNA-Konzentration in einem Spektralphotometer. Die erwartete Konzentration geht es um 1-3 µg / µL. Proben können in einem-80 ° C Gefrierschrank gelagert werden, wenn nötig.</li>
	<li>Bereiten Sie die Mikroinjektion Lösung durch Mischen von 20 ng/µL pDestTol2 -Ubi-ASAP1 und Tol2 Transposase mRNA (100 ng/µL) in einem Microcentrifuge Schlauch durch pipettieren. Zur Verhinderung von Nukleinsäure-Beeinträchtigung durch wiederholtes Auftauen und Auftauens, aliquoten 6 µL pro Röhre und in einem-80 ° C Gefrierschrank für eine spätere Verwendung zu speichern.</li>
</ol>3. die Mikroinjektion
<ol><li>Richten Sie 4-6 Zucht Becken mit mindestens 2 Rüden und 2 Hündinnen am Nachmittag vor der Injektion. Diese Fische müssen nicht am Nachmittag gefüttert werden. Dieser Schritt wird reduzieren die Menge der Fischabfälle und sparen Sie Zeit, um sie am nächsten Morgen, während gleichzeitig eine Zucht Reaktion veranlassen zu reinigen.</li>
	<li>Am nächsten Morgen, entfernen Sie die vorbereiteten Injektionslösung (pDestTol2 -Ubi-ASAP1 Konstrukt und Tol2 mRNA) aus der Tiefkühltruhe-80 ° C und auf Eis legen.</li>
	<li>Ziehen Sie den Teiler in der Fischzucht Panzer und lassen Sie den Fisch zu Paaren. Im Allgemeinen legen Fische Eiern innerhalb von 20-30 Minuten nach dem Herausziehen des Teilers. Wenn nicht, warten Sie 1-2 Stunden länger. Einige Fische können überhaupt keine Eiablage. In diesem Fall wiederholen Sie dieses Experiment für Embryo Fischsammlung.</li>
	<li>Während der Wartezeit stellen Sie sicher, dass Nadeln mit der Spitze in einem Winkel eine abgeschrägte Kante zu schaffen, mit der Pinzette oder durch brechen auf eine heikle Aufgabe Scheibenwischer gebrochen vorbereitet.<ol>
<li>Ziehen Sie Nadeln aus Kapillaren Glas auf einer Mikropipette Abzieher mit den folgenden Parametern: Erhitzen 545; 60 zu ziehen; Geschwindigkeit 80; Zeit 250; Druck 500. Die Nadel mit der Pinzette unter einer Dissektion Umfang (mit Okular Lineal für Durchmesser Schätzung) zu brechen, hält die Zange in einem Winkel von ca. 45 °. Gewünschte Nadel Durchmesser können variabel je nach den Microinjector-Einstellungen sein, aber kleinere Durchmesser wird bevorzugt für die Verringerung des Embryos Sterblichkeit.</li>
	</ol>
</li>
	<li>Sobald der Fisch Eiablage haben, sammeln sie in einem Durchmesser von 10 cm Petrischale und bringen sie auf den Bereich der Dissektion. Entfernen Sie alle abnorme Embryonen und Fischen Sie Abfall zu.</li>
	<li>Pipettieren Schimmel die befruchteten Embryonen in die vorbereitete 3 % Agarose-Injektion. Entfernen Sie überschüssiges Wasser um die Embryonen im Ort zu halten.</li>
	<li>Sobald alle Zeilen mit Embryonen gefüllt sind, ordnen Sie sie so, dass die einzelnen Zellen, die alle die gleiche Richtung der Nadel Gesicht die etwa einen Winkel von 45° horizontal. Dies wird Injektion später viel leichter machen.</li>
	<li>Mit Handschuhen, verwenden Sie eine 20 µL laden pipettieren kippen und 5 µL des vorbereiteten Konstrukts aus der Tube auf dem Eis zu entfernen.</li>
	<li>Legen Sie die Spitze in das hintere Ende des gebrochenen kapillarröhrchens bis hin zu, Tapper beginnt, das Reagenz möglichst nahe an die Spitze zu erhalten. Wenn es noch Luftblasen immer, schütteln Sie die Nadel, und achten Sie auf die Spitze nicht zu brechen.</li>
	<li>Stechen Sie die Nadel direkt in die Mikroinjektion Nadelhalter und ziehen Sie sorgfältig an, bis die Nadel an seinem Platz bleibt. Stellen Sie den Winkel auf ca. 45°.</li>
	<li>Sobald die Nadel vorbereitet und angeschlossen ist, schalten Sie das Mikroskop und Gas-Druck-Tank. Kommerzielle CO2 Tanks sind im Allgemeinen gut für diesen Zweck. Die Einspritzmenge wird durch die Holding und Auswurf Druck eingestellt: ca. 0,5 Psi gewartet und 30 Psi für Auswurf. Achten Sie darauf, zu prüfen, ob die Lösung kommt heraus, wenn das Pedal zu drücken.</li>
	<li>Passen Sie mithilfe einer Bühne Mikrometer mit einem Tropfen Mineralöl, das Volumen und die Lösung für ~ 150 µm im Durchmesser (ca. 2 nL). Stellen Sie sicher, dass der Gegendruck wird eine kleine Menge der Nadel heraus Tropfen lassen. Wenn nicht genug Gegendruck vorhanden ist, bewirkt Kapillarwirkung Flüssigkeit, geben die Nadel und die mRNA zerstören.</li>
	<li>Sobald die Nadel kalibriert wird, beginnen Sie Injektion das Konstrukt in die einzelne Zelle der befruchteten Embryonen. Hinweis: Dies dauert viel Übung, Geduld und Finesse durch die Zellmembran, die schwer zu durchdringen. Es ist wichtig, die Lösung in der Zelle, nicht das Eigelb zur Erzeugung transgener Zebrafisch zu injizieren. Dies unterscheidet sich von Morpholino-Injektion. Es spielt keine Rolle, welche Seite die Nadel betritt die Zelle so lange, wie das Konstrukt in der Zelle geht. Die Transgenese haben eine sehr niedrige Rate des Erfolges, wenn das Eigelb statt der Zelle injiziert. Einzel-Zell-Stadium Injektion ist auch wichtig, oder somatischen Chimäre Fisch erstellt werden. Dies verringert die Chance des Transgens werde in den Keimzellen.</li>
	<li>Benutzen Sie den Rand der Gel-Kerbe, einen Rückhalt bieten, der hält den Embryo vorhanden und ermöglicht die Nadel, Druck auszuüben, ohne sich zu bewegen den Embryo. Sobald die Spitze der Nadel in die einzelne Zelle ist, drücken Sie das Pedal, um die gewünschte Menge an Lösung zu veröffentlichen. Wiederholen Sie diesen Vorgang für alle der Embryonen.</li>
	<li>Wenn abgeschlossen, übertragen Sie die injizierten Embryonen in eine beschriftete Schale durch Spülen sie aus Agarose Kerbe mit System Fischwasser und ein Einweg-3,4 mL transferpipette. Speichern Sie die Embryonen in einem 28,5 ° C Inkubator zu entwickeln lassen. Überprüfen Sie zurück im Laufe des Tages entfernen Tote Fischembryonen und ersetzen Sie Wasser mit 0,1 % Methylenblau in Fischwasser zu.</li>
	<li>Ca. 6-8 Stunden nach der Injektion nehmen 10 einzelnen injiziert Embryonen zu Fischen und bereiten genomischen DNA daraus mit Hilfe der Hotshot Methode18.</li>
	<li>Verwenden Sie am nächsten Morgen Dissektion Mikroskop mit einer Fluoreszenz-Lichtquelle um zu sortieren, die Embryonen mit GFP in den Geweben nicht Eigelb. Diese Fischembryonen sollte das eingespritzte Konstrukt enthalten.</li>
	<li>Führen Sie Tol2 Verbrauchsteuern Assay Transposon-Aktivität wie bisher19beschrieben überprüfen. Wenn ausgeschnittenen Plasmid erkannt werden kann, halten die injizierten Embryonen zu Fischen und heben Sie sie. Wenn keine ausgeschnittenen Plasmid erkannt werden kann, wiederholen Sie den Tol2 mRNA-Synthese und Mikroinjektion bis die positiven Resultate des Tol2 Verbrauchsteuern Assays.</li>
</ol>4. Stellen Sie transgene ASAP1 Fisch, Tg (Ubi: ASAP1)
<ol><li>Heben Sie die injizierten Fische (F-0 -Generation) bis zum Erwachsenenalter, bereits in der Zebrafisch-Buch-20beschrieben. Dies dauert in der Regel ca. 4 Monate.</li>
	<li>Nehmen Sie eine einzelne Erwachsene F0 Fisch und überqueren sie mit einem einzigen gegenüber Geschlecht Wildtyp Fisch. Sammle Fischembryonen nach Zucht im Laufe des Tages. Halten Sie die gesammelten Fischembryonen im 28,5 ° C Inkubator in Fisch mit 0,1 % Methylenblau Wasser.</li>
	<li>Am dritten Tag überprüfen Sie Fischembryonen unter einem Mikroskop fluoreszierende Dissektion mit einem GLP-Filter. Grüne Fischembryonen zu klären, wenn es welche gibt, und heben Sie sie bis zum Erwachsenenalter als F1 Generation transgene Fische, Tg (Ubi: ASAP1). Hinweis: Mendelian Verhältnis wird nicht erwartet, da die meisten der elterlichen F0 Fische Keimbahn genetischer Chimären sind.</li>
	<li>Überqueren Sie einzelne F1 geschlechtsreifer Fische mit Wildtyp-Fisch und sammle Fischembryonen. Sortieren Sie grüne Fischembryonen und heben Sie sie zum Erwachsensein als F2 Generation Fisch. Hinweis: Grün und nicht-grüne Fischembryonen sollte in der Nähe von 1:1, wenn gibt es einen einzigen Transgen.</li>
	<li>Um elektrische mögliche Veränderungen im Tumor wie malignen peripheren Nerven Scheide Tumoren (MPNST) anzuzeigen, überqueren Sie die F-2 -Generation Tg (Ubi: ASAP1) Fisch mit rpl35hi258/wt Fisch. Es ist bekannt, dass die sichtbare Tumoren beginnen in 6-8 Monate alte Erwachsene21,22zu finden.</li>
</ol>(5) Bildgebung
<ol><li>Bild von Zebrafisch-Embryonen, nehmen mehrere F2 Generation Gründer Fisch und mit Wildtyp-Fisch in einzelnen Paaren zu überqueren. Sammle Fischembryonen in unterschiedlichen gewünschte Entwicklungsstadien nach dem Zebrafisch Inszenierung Reiseführer23.</li>
	<li>Für die frühen Stadien von Fischembryonen schälen und Chorions der Embryonen mit einer Zange vorsichtig eine Dissektion Rahmen in einem Durchmesser von 10 cm Petrischale mit Fischwasser System zu entfernen.</li>
	<li>Ein paar Fischembryonen in eine konkave Glas-Folie mit 3 % Methylcellulose mit einer Pipette 3,4 mL Einweg-Transfer zu übertragen. Passen Sie die Embryonen an die gewünschten Positionen, die Zellaktivität der GFP mit einer Nadel unter einem fluoreszierenden Dissektion Bereich anzuzeigen.</li>
	<li>Verwenden Sie für den beweglichen Phasen Fischembryonen (älter als 12 Somiten Bühne) 0,05 % Tricaine Mesylate, um den Fischembryonen zu betäuben, bevor Sie sie auf Folien übertragen. Kurz, waren Fischembryonen in 0,05 % Tricaine Mesylate in Fischwasser entstanden, bis sie schwimmen und Verlust Körperbalance gestoppt. Auch, Tropfen Sie einen 0,05 % Tricaine-Mesylat mit der Methylcellulose auf der Folie.</li>
	<li>Verwenden Sie für weniger als 12 Somiten Bühne Fischembryonen ein Epi-Fluoreszenzmikroskop in Verbindung mit einem kompatiblen Kamera und Software für die Bildgebung. Verwenden Sie für älter als 12 Somiten Bühne Fischembryonen ein Fluoreszenzmikroskop Dissektion.</li>
	<li>Zu Bild Tumor Zellspannung, zuerst die Fische mit MPNST Tumoren zu identifizieren. Dann den Fisch mit 0,05 % Tricaine Mesylate zu betäuben. Für ganze Mount legen Bildgebung, Sie den Fisch in einem Durchmesser von 10 cm Petrischale. Um den Tumor Zelle elektrische Aktivität anzuzeigen, können Fische Tumoren, nach dem ganzen Berg Imaging seziert.</li>
</ol>

<ol>
	<li>Levin, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+bioelectricity:+how+endogenous+voltage+potentials+control+cell+behavior+and+instruct+pattern+regulation+in+vivo.">Molecular bioelectricity: how endogenous voltage potentials control cell behavior and instruct pattern regulation in vivo.</a> Molecular Biology of the Cell. 25 (24), 3835-3850 (2014).</li><li>Storace, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Toward+Better+Genetically+Encoded+Sensors+of+Membrane+Potential.">Toward Better Genetically Encoded Sensors of Membrane Potential.</a> Trends in Neuroscience. 39 (5), 277-289 (2016).</li><li>Inagaki, S., Nagai, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+progress+in+genetically+encoded+voltage+indicators+for+neural+activity+recording.">Current progress in genetically encoded voltage indicators for neural activity recording.</a> Current Opinion in Chemical Biology. 33, 95-100 (2016).</li><li>St-Pierre, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-fidelity+optical+reporting+of+neuronal+electrical+activity+with+an+ultrafast+fluorescent+voltage+sensor.">High-fidelity optical reporting of neuronal electrical activity with an ultrafast fluorescent voltage sensor.</a> Nature Neuroscience. 17 (6), 884-889 (2014).</li><li>Lieschke, G. J., Currie, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Animal+models+of+human+disease:+zebrafish+swim+into+view.">Animal models of human disease: zebrafish swim into view.</a> Nature Reviews Genetics. 8 (5), 353-367 (2007).</li><li>Santoriello, C., Zon, L. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hooked!+Modeling+human+disease+in+zebrafish.">Hooked! Modeling human disease in zebrafish.</a> Journal of Clinical Investigation. 122 (7), 2337-2343 (2012).</li><li>Howe, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+zebrafish+reference+genome+sequence+and+its+relationship+to+the+human+genome.">The zebrafish reference genome sequence and its relationship to the human genome.</a> Nature. , (2013).</li><li>Kawakami, K., Shima, A., Kawakami, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+functional+transposase+of+the+Tol2+element,+an+Ac-like+element+from+the+Japanese+medaka+fish,+and+its+transposition+in+the+zebrafish+germ+lineage.">Identification of a functional transposase of the Tol2 element, an Ac-like element from the Japanese medaka fish, and its transposition in the zebrafish germ lineage.</a> Proceedings of the National Academy of Science USA. 97 (21), 11403-11408 (2000).</li><li>Urasaki, A., Asakawa, K., Kawakami, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+transposition+of+the+Tol2+transposable+element+from+a+single-copy+donor+in+zebrafish.">Efficient transposition of the Tol2 transposable element from a single-copy donor in zebrafish.</a> Proceedings of the National Academy of Science USA. 105 (50), 19827-19832 (2008).</li><li>Kwan, K. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Tol2kit:+a+multisite+gateway-based+construction+kit+for+Tol2+transposon+transgenesis+constructs.">The Tol2kit: a multisite gateway-based construction kit for Tol2 transposon transgenesis constructs.</a> Developmental Dynamics. 236 (11), 3088-3099 (2007).</li><li>Mosimann, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ubiquitous+transgene+expression+and+Cre-based+recombination+driven+by+the+ubiquitin+promoter+in+zebrafish.">Ubiquitous transgene expression and Cre-based recombination driven by the ubiquitin promoter in zebrafish.</a> Development. 138 (1), 169-177 (2011).</li><li>Lorenz, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polymerase+chain+reaction:+basic+protocol+plus+troubleshooting+and+optimization+strategies.">Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies.</a> Journal of Visualized Experiments. (63), e3998 (2012).</li><li>Ordovas, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Separation+of+small-size+DNA+fragments+using+agarose+gel+electrophoresis.">Separation of small-size DNA fragments using agarose gel electrophoresis.</a> Methods in Molecular Biology. 110, 35-42 (1998).</li><li>Downey, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extraction+of+DNA+from+agarose+gels.">Extraction of DNA from agarose gels.</a> Methods Mol Biol. 235, 137-139 (2003).</li><li>Desjardins, P., Conklin, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NanoDrop+microvolume+quantitation+of+nucleic+acids.">NanoDrop microvolume quantitation of nucleic acids.</a> Journal of Visualized Experiments. 45 (45), (2010).</li><li>Green, M. R., Sambrook, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular cloning : a laboratory manual. , (2012).</li><li>Zhang, S., Cahalan, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purifying+plasmid+DNA+from+bacterial+colonies+using+the+QIAGEN+Miniprep+Kit.">Purifying plasmid DNA from bacterial colonies using the QIAGEN Miniprep Kit.</a> Journal of Visualized Experiments. (6), 247 (2007).</li><li>Meeker, N. D., Hutchinson, S. A., Ho, L., Trede, N. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Method+for+isolation+of+PCR-ready+genomic+DNA+from+zebrafish+tissues.">Method for isolation of PCR-ready genomic DNA from zebrafish tissues.</a> Biotechniques. 43 (5), (2007).</li><li>Kawakami, K., Koga, A., Hori, H., Shima, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Excision+of+the+tol2+transposable+element+of+the+medaka+fish,+Oryzias+latipes,+in+zebrafish,+Danio+rerio.">Excision of the tol2 transposable element of the medaka fish, Oryzias latipes, in zebrafish, Danio rerio.</a> Gene. 225 (1-2), 17-22 (1998).</li><li>Westerfield, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The zebrafish book. A guide for the laboratory use of zebrafish (Danio rerio). , (2000).</li><li>Amsterdam, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Many+ribosomal+protein+genes+are+cancer+genes+in+zebrafish.">Many ribosomal protein genes are cancer genes in zebrafish.</a> PLoS Biology. 2 (5), E139 (2004).</li><li>Lai, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Many+ribosomal+protein+mutations+are+associated+with+growth+impairment+and+tumor+predisposition+in+zebrafish.">Many ribosomal protein mutations are associated with growth impairment and tumor predisposition in zebrafish.</a> Developmental Dynamics. 238 (1), 76-85 (2009).</li><li>Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B., Schilling, T. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stages+of+embryonic+development+of+the+zebrafish.">Stages of embryonic development of the zebrafish.</a> Developmental Dynamics. 203 (3), 253-310 (1995).</li><li>Zhang, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+oncogenomic+analysis+of+copy+number+alterations+in+human+and+zebrafish+tumors+enables+cancer+driver+discovery.">Comparative oncogenomic analysis of copy number alterations in human and zebrafish tumors enables cancer driver discovery.</a> PLoS Genetics. 9 (8), e1003734 (2013).</li><li>Zhang, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+aneuploid+zebrafish+malignant+peripheral+nerve+sheath+tumors+have+genetic+alterations+similar+to+human+cancers.">Highly aneuploid zebrafish malignant peripheral nerve sheath tumors have genetic alterations similar to human cancers.</a> Proceedings of the National Academy of Science USA. 107 (39), 16940-16945 (2010).</li><li>Urrego, D., Tomczak, A. P., Zahed, F., Stuhmer, W., Pardo, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potassium+channels+in+cell+cycle+and+cell+proliferation.">Potassium channels in cell cycle and cell proliferation.</a> Philosophical Transactions of the Royal Society of London Series B. 369 (1638), 20130094 (2014).</li><li>Yang, H. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Subcellular+Imaging+of+Voltage+and+Calcium+Signals+Reveals+Neural+Processing+In+Vivo.">Subcellular Imaging of Voltage and Calcium Signals Reveals Neural Processing In Vivo.</a> Cell. 166 (1), 245-257 (2016).</li><li>Chamberland, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+two-photon+imaging+of+subcellular+voltage+dynamics+in+neuronal+tissue+with+genetically+encoded+indicators.">Fast two-photon imaging of subcellular voltage dynamics in neuronal tissue with genetically encoded indicators.</a> Elife. 6, (2017).</li><li>Hochbaum, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=All-optical+electrophysiology+in+mammalian+neurons+using+engineered+microbial+rhodopsins.">All-optical electrophysiology in mammalian neurons using engineered microbial rhodopsins.</a> Nature Methods. 11 (8), 825-833 (2014).</li><li>Sugiyama, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Illuminating+cell-cycle+progression+in+the+developing+zebrafish+embryo.">Illuminating cell-cycle progression in the developing zebrafish embryo.</a> Proceedings of the National Academy of Science USA. 106 (49), 20812-20817 (2009).</li></ol>

Die Autoren haben nichts preisgeben.

Obwohl die Mobilfunk- und Gewebe elektrische Aktivitäten während der embryonalen Entwicklung und Krankheit beim Menschen vor langer Zeit entdeckt wurden, bleiben die in Vivo dynamische elektrische Veränderungen und deren biologische Rollen noch weitgehend unbekannt. Eine der großen Herausforderungen ist zu visualisieren und zu quantifizieren, die elektrischen Veränderungen. Patch-Clamp-Technologie ist ein Durchbruch für die Verfolgung von Einzelzellen, aber seine Anwendung auf vertebrate Embryonen ist begr...

Bioelektrizität bezieht sich auf endogene elektrische Signalisierung durch Ionenkanäle und Pumpen befindet sich auf der Zellmembran1vermittelt. Ionischen Austausch über die Zellmembran und die gekoppelten elektrischen potenziellen und aktuellen Änderungen sind unerlässlich für die Signalisierung Prozesse des erregbare muskulären und neuronalen Zellen. Bioelektrizität und Ion Steigungen haben darüber hinaus eine Vielzahl von anderen wichtigen biologischen Funktionen wie Energiespeicher, Biosynthese und Metabolit Transport. Bioelektrische Signale wurde auch als Regulator des embryonalen Musterbildung wie körperachsen, Zellzyklus und Zelle Differenzierung1entdeckt. Daher ist es wichtig für das Verständnis der vielen menschlichen Erbkrankheiten, die sich aus der MIS Verordnung dieser Art der Signalisierung. Obwohl Patch-Clamp ist weit verbreitet für die Aufnahme einzelner Zellen, ist es immer noch bei weitem nicht Ideal für die gleichzeitige Überwachung mehrerer Zellen während der Embryonalentwicklung in Vivo. Darüber hinaus sind sensible kleine Moleküle Spannung auch nicht ideal für in-Vivo Anwendungen aufgrund ihrer Besonderheiten, Empfindlichkeiten und Toxizitäten.
Die Schaffung einer Vielzahl von genetisch codiert fluoreszierende Spannung Indikatoren (GEVIs) bietet einen neuen Mechanismus, um dieses Problem zu umgehen, und ermöglicht die einfache Anwendung, Embryonalentwicklung, zu studieren, obwohl sie ursprünglich, für die Überwachung der neuronalen bestimmt waren 2,3Zellen. Eines der derzeit verfügbaren GEVIs ist die beschleunigte Sensor Aktionspotentiale 1 (ASAP1)4. Es besteht aus einer extrazellulären Schleife einer Spannung-sensing Domäne Spannung empfindlich Phosphatase und ein Zirkular permutierte grün fluoreszierendes Protein. Daher erlaubt ASAP1 Visualisierung der elektrische mögliche Zellveränderungen (Polarisation: hellgrün; Depolarisation: dunkelgrün). ASAP1 hat 2 ms ein- und Kinetik und Eingangssignale mögliche Änderung4verfolgen können. So ermöglicht dieses genetische Tool für ein neues Maß an Effizienz in bioelektrische Echtzeitüberwachung in lebenden Zellen. Weitere Verständnis der Rollen der Bioelektrizität in der embryonalen Entwicklung und vielen menschlichen Krankheiten wie Krebs, wird werfen ein neues Licht auf die zugrunde liegenden Mechanismen, die für Behandlung und Prävention von entscheidender Bedeutung ist.
Zebrafisch nachweislich eine leistungsstarke Tiermodell, Entwicklungsbiologie und menschliche Krankheiten einschließlich Krebs5,6zu studieren. Sie 70 % ortholog Gene mit Menschen teilen, und sie haben ähnliche vertebrate Biologie7. Zebrafisch bieten relativ pflegeleicht, eine große Kupplung Größe von Eiern, gefügig Genetik, leicht Transgenese und transparente externe embryonale Entwicklung, wodurch sie ein überlegenes System für in-Vivo imaging5,6. Eine bedeutende Quelle von mutant Fisch Linien bereits vorhanden und ein vollständig sequenzierte Genom wird Zebrafisch relativ unbegrenzt vielfältige wissenschaftliche Entdeckungen bieten.
Um die in Vivo in Echtzeit elektrische Aktivität von Zellen zu untersuchen, nutzen wir die Zebrafisch Modellsystem und ASAP1. In diesem Papier wir beschreiben, wie das Zebrafish Genom Tol2 Transposon Transgenese mit fluoreszierenden Spannung Biosensor ASAP1 einzubauen, und elektrische Zellaktivität zu visualisieren, während der Embryonalentwicklung, Fische Larven Bewegung, und im live tumor .

<table><tbody><tr><td>14mL cell culture tubes</td><td>VWR</td><td>60818-725</td><td>E.Coli culture</td></tr><tr><td>Agarose electrophoresis tank</td><td>Thermo Scientific</td><td>Owl B2</td><td>DNA eletrophoresis</td></tr><tr><td>Agarose RA</td><td>Amresco</td><td>N605-500G</td><td>For making the injection gels</td></tr><tr><td>Attb1-ASAP1-F primer</td><td>IDT DNA</td><td>GGGGACAAGTTTGTACAAAAAA&lt;br /&gt;GCAGGCTTCACCATGGAGACGA&lt;br /&gt;CTGTGAGGTATGAACA</td><td>ASAP1 coding region amplification for subcloning</td></tr><tr><td>Attb2-ASAP1-R primer</td><td>IDT DNA</td><td>GGGGACCACTTTGTACAAGAAA&lt;br /&gt;GCTGGGTCTTAGGTTACCACTTC&lt;br /&gt;AAGTTGTTTCTTCTGTGAAGCCA</td><td>ASAP1 coding region amplification for subcloning</td></tr><tr><td>Bright field dissection scope</td><td>Nikon</td><td>SMZ 745</td><td>Dechorionation, microinjection, mounting</td></tr><tr><td>Color camera</td><td>Zeiss</td><td>AxioCam MRc</td><td>Fish embryo image recording</td></tr><tr><td>Concave slide</td><td>VWR</td><td>48336-001</td><td>For holding fish embryos during imaging process</td></tr><tr><td>Disposable transfer pipette 3.4 ml</td><td>Thermo Scientific</td><td>13-711-9AM</td><td>Fish embryos and water transfer</td></tr><tr><td>Endonuclease enzyme, Not I</td><td>NEB</td><td>R0189L</td><td>For linearizing plasmid DNA</td></tr><tr><td>Epifuorescent compound scope</td><td>Zeiss</td><td>Axio Imager.A2</td><td>Fish embryo imaging</td></tr><tr><td>Epifuorescent stereo dissection scope</td><td>Zeiss</td><td>Stereo Discovery.V12</td><td>Fish embryo imaging</td></tr><tr><td>Fluorescent light source</td><td>Lumen dynamics</td><td>X-cite seris 120</td><td>Light source for fluorescence microscopes</td></tr><tr><td>Forceps #5</td><td>WPI</td><td>500342</td><td>Dechorionation and needle breaking</td></tr><tr><td>Gateway BP Clonase II Enzyme mix</td><td>Thermo Scientific</td><td>11789020</td><td>Gateway BP recombination cloning</td></tr><tr><td>Gateway LR Clonase II Plus enzyme</td><td>Thermo Scientific</td><td>12538120</td><td>Gateway LR recombination cloning</td></tr><tr><td>Gel DNA Recovery Kit</td><td>Zymo Research</td><td>D4002</td><td>DNA gel purification</td></tr><tr><td>Loading tip</td><td>Eppendorf</td><td>930001007</td><td>For loading injection solution into capilary needles</td></tr><tr><td>Methylcellulose (1600cPs)</td><td>Alfa Aesar</td><td>43146</td><td>Fish embryo mounting</td></tr><tr><td>Methylene blue</td><td>Sigma-Aldrich</td><td>M9140</td><td>Suppresses fungal outbreaks in Petri dishes</td></tr><tr><td>Microinjection mold</td><td>Adaptive Science Tools</td><td>TU-1</td><td>To prepare agaorse mold tray for holding fish embryos during injection</td></tr><tr><td>Microinjector</td><td>WPI</td><td>Pneumatic Picopump PV820</td><td>Microinjection injector</td></tr><tr><td>Micro-manipulator</td><td>WPI</td><td>Microinjector MM3301R</td><td>Microinjection operation</td></tr><tr><td>Micropipette puller</td><td>Sutter instrument</td><td>P-1000</td><td>For preparing capillary needle</td></tr><tr><td>Mineral oil</td><td>Amresco</td><td>J217-500ml</td><td>For calibrating injection volume</td></tr><tr><td>mMESSAGE mMACHINE SP6 Transcription Kit</td><td>Thermo Scientific</td><td>AM1340</td><td>mRNA in vitro transcription</td></tr><tr><td>Monocolor camera</td><td>Zeiss</td><td>AxioCam MRm</td><td>Fish embryo image recording</td></tr><tr><td>Plasmid Miniprep Kit</td><td>Zymo Research</td><td>D4020</td><td>Prepare small amount of plasmid DNA</td></tr><tr><td>Plastic Petri dishes</td><td>VWR</td><td>25384-088</td><td>For holding fish or fish embryos during imaging process</td></tr><tr><td>RNA Clean &amp;amp; Concentrator-5</td><td>Zymo Research</td><td>R1015</td><td>mRNA cleaning after in vitro transcription</td></tr><tr><td>Spectrophotometer</td><td>Thermo Scientific</td><td>NanoDrop 2000</td><td>For measuring DNA and RNA concentrations</td></tr><tr><td>Stage Micrometer</td><td>Am Scope</td><td>MR100</td><td>Microinjection volume calibration</td></tr><tr><td>Thermocycler</td><td>Bio-Rad</td><td>T100</td><td>DNA amplification for gene cloning</td></tr><tr><td>Thin wall glass capillaries</td><td>WPI</td><td>TW100F-4</td><td>Raw glass for making cappilary needle</td></tr><tr><td>Tol2-exL1 primer</td><td>IDT DNA</td><td>GCACAACACCAGAAATGCCCTC</td><td>Tol2 excise assay</td></tr><tr><td>Tol2-exR primer</td><td>IDT DNA</td><td>ACCCTCACTAAAGGGAACAAAAG</td><td>Tol2 excise assay</td></tr><tr><td>TOP10 Chemically Competent E. coli</td><td>Thermo Scientific</td><td>C404006</td><td>Used for transformation during gene cloning</td></tr><tr><td>Tricaine mesylate</td><td>Sigma-Aldrich</td><td>A5040</td><td>For anesthetizing fish or fish embryos</td></tr><tr><td>UV trans-illuminator 302nm</td><td>UVP</td><td>M-20V</td><td>DNA visualization</td></tr><tr><td>Water bath</td><td>Thermo Scientific</td><td>2853</td><td>For transformation process of gene cloning</td></tr></tbody></table>

visualization of cellular electrical activity in zebrafish early embryos and tumors

Bioelektrizität, endogene elektrische Signalisierung von Ionenkanälen vermittelt und Pumpen befindet sich auf der Zellmembran, spielt eine wichtige Rolle bei der Signalisierung Prozesse des erregbare muskulären und neuronalen Zellen und viele andere biologische Prozesse, wie z. B. embryonale Developmental Musterung. Allerdings gibt es eine Notwendigkeit für die in Vivo Überwachung elektrische Aktivität in vertebrate Embryogenese. Die Fortschritte der genetisch codierten fluoreszierende Spannung Indikatoren (GEVIs) machten es möglich, eine Lösung für diese Herausforderung zu bieten. Wir beschreiben hier, wie erstelle ich eine transgene Spannung Indikator Zebrafisch mit den etablierten Spannungsanzeige ASAP1 (beschleunigte Sensor von Aktionspotentialen 1), als Beispiel. Das Tol2-Kit und einem allgegenwärtigen Zebrafisch-Promotor, Ubi, wurden in dieser Studie ausgewählt. Wir erklären auch die Prozesse der Gateway ortsspezifische Klonen, Tol2 Transposon-basierte Zebrafisch Transgenese und den imaging-Prozess für Frühphasen-Fisch Embryonen und Fisch Tumoren mit regelmäßigen Epifluorescent Mikroskope. Mit diesem Fisch-Linie, fanden wir, dass während der Embryogenese Zebrafisch und Fische Larven Bewegung gibt es zelluläre elektrische Spannungsänderungen. Darüber hinaus wurde festgestellt, dass in ein paar Zebrafisch malignen peripheren Nerven Scheide Tumoren, Tumor, die Zellen in der Regel polarisiert waren im Vergleich zu das umliegende normale Gewebe.

In einer erfolgreichen Injektion, mehr als 50 % injiziert Fischembryonen zeigt ein gewisses Maß an grünen Fluoreszenz in den somatischen Zellen, und die meisten von ihnen werden positiv von Tol2 Transposon Verbrauchsteuern Assay (Abbildung 2). Nach 2-4 Generationen von Out-Kreuz mit Wildtyp-Fisch (bis der fluoreszierenden Fisch 50 %, die erwarteten Mendelian Verhältnis erreichen), wurden die transgene Fische für das imaging Experiment zur Zellmembran Pote...

Watch this Scientific Journal Video about Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors at JoVE.com

Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors

Visualisierung von zellulären elektrische Aktivität im frühen Zebrafish Embryos und Tumoren

Hier zeigen wir den Prozess der Erstellung einer zellulären elektrische Spannung Reporter Zebrafisch Linie um embryonale Entwicklung, Bewegung, zu visualisieren und Fisch Tumorzellen in Vivo.

Bioelectricity, endogenous electrical signaling mediated by ion channels and pumps located on the cell membrane, plays important roles in signaling ...

visualization-cellular-electrical-activity-zebrafish-early-embryos

Universidad de Cartagena UDEC

Research

JoVE Journal

Developmental Biology

8.7K Aufrufe.  Purdue University. Hier zeigen wir den Prozess der Erstellung einer zellulären elektrische Spannung Reporter Zebrafisch Linie um embryonale Entwicklung, Bewegung, zu visualisieren und Fisch Tumorzellen in Vivo.

Serie: Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors

Time-lapse Live Imaging of Clonally Related Neural Progenitor Cells in the Developing Zebrafish Forebrain

Precise patterns of division, migration and differentiation of neural progenitor cells are crucial for proper brain development and function1,2. To understand the behavior of neural progenitor cells in the complex in vivo environment, time-lapse live imaging of neural progenitor cells in an intact brain is critically required. In this video, we exploit the unique features of zebrafish embryos to visualize the development of forebrain neural progenitor cells in vivo. We use electroporation to genetically and sparsely label individual neural progenitor cells. Briefly, DNA constructs coding for fluorescent markers were injected into the forebrain ventricle of 22 hours post fertilization (hpf) zebrafish embryos and electric pulses were delivered immediately. Six hours later, the electroporated zebrafish embryos were mounted with low melting point agarose in glass bottom culture dishes. Fluorescently labeled neural progenitor cells were then imaged for 36hours with fixed intervals under a confocal microscope using water dipping objective lens. The present method provides a way to gain insights into the in vivo development of forebrain neural progenitor cells and can be applied to other parts of the central nervous system of the zebrafish embryo.

The present video demonstrates a method which takes advantage of the combination of electroporation and confocal microscopy to perform live imaging on individual neural progenitor cells in the developing zebrafish forebrain. In vivo analysis of the development of forebrain neural progenitor cells at a clonal level can be achieved in this way.

Zeitraffer-Live-Imaging von klonal verbundenen neuronalen Vorläuferzellen in der Entwicklung von Zebrafisch Vorderhirnneuronen

Precise patterns of division, migration and differentiation of neural progenitor cells are crucial for proper brain development and function1,2. To ...

Forschung

Neurowissenschaften

Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos

The protocols described here are designed to allow researchers to study cell communication without altering the integrity of the environment in which the cells are located. Specifically, they have been developed to analyze the electrical activity of excitable cells, such as spinal neurons. In such a scenario, it is crucial to preserve the integrity of the spinal cell, but it is also important to preserve the anatomy and physiological shape of the systems involved. Indeed, the comprehension of the manner in which the nervous system-and other complex systems-works must be based on a systemic approach. For this reason, the live zebrafish embryo was chosen as a model system, and the spinal neuron membrane voltage changes were evaluated without interfering with the physiological conditions of the embryos. 
Here, an approach combining the employment of zebrafish embryos with a FRET-based biosensor is described. Zebrafish embryos are characterized by a very simplified nervous system and are particularly suited for imaging applications thanks to their transparency, allowing for the employment of fluorescence-based voltage indicators at the plasma membrane during zebrafish development. The synergy between these two components makes it possible to analyze the electrical activity of the cells in intact living organisms, without perturbing the physiological state. Finally, this non-invasive approach can co-exist with other analyses (e.g., spontaneous movement recordings, as shown here).

Protocols described here allow for the study of the electrical properties of excitable cells in the most non-invasive physiological conditions by employing zebrafish embryos in an in vivo system together with a fluorescence resonance energy transfer (FRET)-based genetically encoded voltage indicator (GEVI) selectively expressed in the cell type of interest.

Biosensing Motor Neuron Membran Potenzial in Live Zebrafisch Embryos

The protocols described here are designed to allow researchers to study cell communication without altering the integrity of the environment in which the ...

Entwicklungsbiologie

Live Imaging of the Zebrafish Embryonic Brain by Confocal Microscopy

In this video, we demonstrate the method our lab has developed to analyze the cell shape changes and rearrangements required to bend and fold the developing zebrafish brain (Gutzman et al, 2008). Such analysis affords a new understanding of the underlying cell biology required for development of the 3D structure of the vertebrate brain, and significantly increases our ability to study neural tube morphogenesis. The embryonic zebrafish brain is shaped beginning at 18 hours post fertilization (hpf) as the ventricles within the neuroepithelium inflate. By 24 hpf, the initial steps of neural tube morphogenesis are complete. Using the method described here, embryos at the one cell stage are injected with mRNA encoding membrane-targeted green fluorescent protein (memGFP). After injection and incubation, the embryo, now between 18 and 24 hpf, is mounted, inverted, in agarose and imaged by confocal microscopy. Notably, the zebrafish embryo is transparent making it an ideal system for fluorescent imaging. While our analyses have focused on the midbrain-hindbrain boundary and the hindbrain, this method could be extended for analysis of any region in the zebrafish to a depth of 
80-100 &mu;m.

In this video, we demonstrate a method by which to analyze the developing vertebrate brain in live zebrafish embryos at single cell resolution by confocal microscopy. This includes the method by which we inject the single-cell zebrafish embryo and subsequently mount and image the developing brain.

Live-Imaging der Zebrafisch embryonalen Gehirn durch konfokale Mikroskopie

In this video, we demonstrate the method our lab has developed to analyze the cell shape changes and rearrangements required to bend and fold the ...

Biologie

Forebrain Electrophysiological Recording in Larval Zebrafish

Epilepsy affects nearly 3 million people in the United States and up to 50 million people worldwide. Defined as the occurrence of spontaneous unprovoked seizures, epilepsy can be acquired as a result of an insult to the brain or a genetic mutation. Efforts to model seizures in animals have primarily utilized acquired insults (convulsant drugs, stimulation or brain injury) and genetic manipulations (antisense knockdown, homologous recombination or transgenesis) in rodents. Zebrafish are a vertebrate model system1-3 that could provide a valuable alternative to rodent-based epilepsy research. Zebrafish are used extensively in the study of vertebrate genetics or development, exhibit a high degree of genetic similarity to mammals and express homologs for ~85% of known human single-gene epilepsy mutations. Because of their small size (4-6 mm in length), zebrafish larvae can be maintained in fluid volumes as low as 100 &mu;l during early development and arrayed in multi-well plates. Reagents can be added directly to the solution in which embryos develop, simplifying drug administration and enabling rapid in vivo screening of test compounds4. Synthetic oligonucleotides (morpholinos), mutagenesis, zinc finger nuclease and transgenic approaches can be used to rapidly generate gene knockdown or mutation in zebrafish5-7. These properties afford zebrafish studies an unprecedented statistical power analysis advantage over rodents in the study of neurological disorders such as epilepsy. Because the "gold standard" for epilepsy research is to monitor and analyze the abnormal electrical discharges that originate in a central brain structure (i.e., seizures), a method to efficiently record brain activity in larval zebrafish is described here. This method is an adaptation of conventional extracellular recording techniques and allows for stable long-term monitoring of brain activity in intact zebrafish larvae. Sample recordings are shown for acute seizures induced by bath application of convulsant drugs and spontaneous seizures recorded in a genetically modified fish.

A simple method to record extracellular field potentials in the larval zebrafish forebrain is described. The method provides a robust in vivo read-out of seizure-like activity. This technique can be used with genetically modified zebrafish larvae carrying epilepsy-related genes or seizures evoked by administration of convulsant drugs.

Vorderhirn Elektrophysiologische Aufzeichnung im Larven Zebrafisch

Epilepsy affects nearly 3 million people in the United States and up to 50 million people worldwide. Defined as the occurrence of spontaneous unprovoked ...

Live Imaging of Cell Motility and Actin Cytoskeleton of Individual Neurons and Neural Crest Cells in Zebrafish Embryos

The zebrafish is an ideal model for imaging cell behaviors during development in vivo. Zebrafish embryos are externally fertilized and thus easily accessible at all stages of development. Moreover, their optical clarity allows high resolution imaging of cell and molecular dynamics in the natural environment of the intact embryo. We are using a live imaging approach to analyze cell behaviors during neural crest cell migration and the outgrowth and guidance of neuronal axons.
Live imaging is particularly useful for understanding mechanisms that regulate cell motility processes. To visualize details of cell motility, such as protrusive activity and molecular dynamics, it is advantageous to label individual cells. In zebrafish, plasmid DNA injection yields a transient mosaic expression pattern and offers distinct benefits over other cell labeling methods. For example, transgenic lines often label entire cell populations and thus may obscure visualization of the fine protrusions (or changes in molecular distribution) in a single cell. In addition, injection of DNA at the one-cell stage is less invasive and more precise than dye injections at later stages.
Here we describe a method for labeling individual developing neurons or neural crest cells and imaging their behavior in vivo. We inject plasmid DNA into 1-cell stage embryos, which results in mosaic transgene expression. The vectors contain cell-specific promoters that drive expression of a gene of interest in a subset of sensory neurons or neural crest cells. We provide examples of cells labeled with membrane targeted GFP or with a biosensor probe that allows visualization of F-actin in living cells1.
Erica Andersen, Namrata Asuri, and Matthew Clay contributed equally to this work.

This protocol describes imaging of individual neurons or neural crest cells in living zebrafish embryos. This method is used to examine cellular behaviors and actin localization using fluorescence confocal time-lapse microscopy.

Live-Imaging von Zellbewegung und Aktin-Zytoskelett von einzelnen Neuronen und Zellen der Neuralleiste in Zebrafisch-Embryos

The zebrafish is an ideal model for imaging cell behaviors during development in vivo. Zebrafish embryos are externally fertilized and thus easily ...

Visualizing the Developing Brain in Living Zebrafish using Brainbow and Time-lapse Confocal Imaging

Development of the vertebrate nervous system requires a precise coordination of complex cellular behaviors and interactions. The use of high resolution in vivo imaging techniques can provide a clear window into these processes in the living organism. For example, dividing cells and their progeny can be followed in real time as the nervous system forms. In recent years, technical advances in multicolor techniques have expanded the types of questions that can be investigated. The multicolor Brainbow approach can be used to not only distinguish among like cells, but also to color-code multiple different clones of related cells that each derive from one progenitor cell. This allows for a multiplex lineage analysis of many different clones and their behaviors simultaneously during development. Here we describe a technique for using time-lapse confocal microscopy to visualize large numbers of multicolor Brainbow-labeled cells over real time within the developing zebrafish nervous system. This is particularly useful for following cellular interactions among like cells, which are difficult to label differentially using traditional promoter-driven colors. Our approach can be used for tracking lineage relationships among multiple different clones simultaneously. The large datasets generated using this technique provide rich information that can be compared quantitatively across genetic or pharmacological manipulations. Ultimately the results generated can help to answer systematic questions about how the nervous system develops.

In vivo imaging is a powerful tool that can be used to investigate the cellular mechanisms underlying nervous system development. Here we describe a technique for using time-lapse confocal microscopy to visualize large numbers of multicolor Brainbow-labeled cells in real time within the developing zebrafish nervous system.

Visualisierung des sich entwickelnden Gehirns bei lebenden Zebrafischen mit Brainbow und Zeitraffer-Konfokalbildnis

Development of the vertebrate nervous system requires a precise coordination of complex cellular behaviors and interactions. The use of high resolution in ...

Multicolor Time-lapse Imaging of Transgenic Zebrafish: Visualizing Retinal Stem Cells Activated by Targeted Neuronal Cell Ablation

High-resolution time-lapse imaging of living zebrafish larvae can be utilized to visualize how biological processes unfold (for review see 1). Compound transgenic fish which express different fluorescent reporters in neighboring cell types provide a means of following cellular interactions 2 and/or tissue-level responses to experimental manipulations over time. In this video, we demonstrate methods that can be used for imaging multiple transgenically labeled cell types serially in individual fish over time courses that can span from minutes to several days. The techniques described are applicable to any study seeking to correlate the "behavior" of neighboring cells types over time, including: 1) serial 'catch and release' methods for imaging a large number of fish over successive days, 2) simplified approaches for separating fluorophores with overlapping excitation/emission profiles (e.g., GFP and YFP), 3) use of hypopigmented mutant lines to extend the time window available for high-resolution imaging into late larval stages of development, 4) use of membrane targeted fluorescent reporters to reveal fine morphological detail of individual cells as well as cellular details in larger populations of cells, and 5) a previously described method for chemically-induced ablation of transgenically targeted cell types; i.e., nitroreductase (NTR) mediated conversion of prodrug substrates, such as metronidazole (MTZ), to cytotoxic derivatives 3,5.
As an example of these approaches, we will visualize the ablation and regeneration of a subtype of retinal bipolar neuron within individual fish over several days. Simultaneously we will monitor several other retinal cell types, including neighboring non-targeted bipolar cells and potential degeneration-stimulated retinal stem cells (i.e., M&#971;ller glia). This strategy is being applied in our lab to characterize cell- and tissue-level (e.g., stem cell niche) responses to the selective loss and regeneration of targeted neuronal cell types.

In this video, techniques for multicolor confocal time-lapse imaging and targeted cell ablation are provided. Time-lapse imaging is used to monitor the behavior of multiple cell types of interest in vivo. Targeted cell ablation facilitates the study neural circuit function and cell-specific neuronal regeneration paradigms.

Multicolor Zeitraffer-Imaging transgener Zebrafische: Visualisierung von Retinal Stammzellen durch gezielte Nervenzellen Ablation Activated

High-resolution time-lapse imaging of living zebrafish larvae can be utilized to visualize how biological processes unfold (for review see 1). Compound ...

Imaging and 3D Reconstruction of Cerebrovascular Structures in Embryonic Zebrafish

Zebrafish are a powerful tool to study developmental biology and pathology in vivo. The small size and relative transparency of zebrafish embryos make them particularly useful for the visual examination of processes such as heart and vascular development. In several recent studies transgenic zebrafish that express EGFP in vascular endothelial cells were used to image and analyze complex vascular networks in the brain and retina, using confocal microscopy. Descriptions are provided to prepare, treat and image zebrafish embryos that express enhanced green fluorescent protein (EGFP), and then generate comprehensive 3D renderings of the cerebrovascular system. Protocols include the treatment of embryos, confocal imaging, and fixation protocols that preserve EGFP fluorescence. Further, useful tips on obtaining high-quality images of cerebrovascular structures, such as removal the eye without damaging nearby neural tissue are provided. Potential pitfalls with confocal imaging are discussed, along with the steps necessary to generate 3D reconstructions from confocal image stacks using freely available open source software.

Imaging of cerebrovascular development in larval zebrafish is described. Techniques to facilitate 3D imaging and modify cerebrovascular development using chemical treatments are also provided.

Imaging und 3D-Rekonstruktion der zerebrovaskuläre Strukturen in embryonalen Zebrafisch

Zebrafish are a powerful tool to study developmental biology and pathology in vivo.  The small size and relative transparency of zebrafish embryos make ...

Semi-automated Imaging of Tissue-specific Fluorescence in Zebrafish Embryos

Zebrafish embryos are a powerful tool for large-scale screening of small molecules. Transgenic zebrafish that express fluorescent reporter proteins are frequently used to identify chemicals that modulate gene expression. Chemical screens that assay fluorescence in live zebrafish often rely on expensive, specialized equipment for high content screening. We describe a procedure using a standard epifluorescence microscope with a motorized stage to automatically image zebrafish embryos and detect tissue-specific fluorescence. Using transgenic zebrafish that report estrogen receptor activity via expression of GFP, we developed a semi-automated procedure to screen for estrogen receptor ligands that activate the reporter in a tissue-specific manner. In this video we describe procedures for arraying zebrafish embryos at 24-48 hours post fertilization (hpf) in a 96-well plate and adding small molecules that bind estrogen receptors. At 72-96 hpf, images of each well from the entire plate are automatically collected and manually inspected for tissue-specific fluorescence. This protocol demonstrates the ability to detect estrogens that activate receptors in heart valves but not in liver.

Described here is a protocol for semi-automated imaging of tissue-specific fluorescence in zebrafish embryos.

Semi-Automated Imaging von Gewebespezifische Fluoreszenz-in Zebrafischembryonen

Zebrafish embryos are a powerful tool for large-scale screening of small molecules. Transgenic zebrafish that express fluorescent reporter proteins are ...

In vivo Imaging of Fully Active Brain Tissue in Awake Zebrafish Larvae and Juveniles by Skull and Skin Removal

Understanding the ephemeral changes that occur during brain development and maturation requires detailed high-resolution imaging in space and time at cellular and subcellular resolution. Advances in molecular and imaging technologies have allowed us to gain numerous detailed insights into cellular and molecular mechanisms of brain development in the transparent zebrafish embryo. Recently, processes of refinement of neuronal connectivity that occur at later larval stages several weeks after fertilization, which are for example control of social behavior, decision making or motivation-driven behavior, have moved into focus of research. At these stages, pigmentation of the zebrafish skin interferes with light penetration into brain tissue, and solutions for embryonic stages, e.g., pharmacological inhibition of pigmentation, are not feasible anymore.
Therefore, a minimally invasive surgical solution for microscopy access to the brain of awake zebrafish is provided that is derived from electrophysiological&#160;approaches. In teleosts, skin and soft skull cartilage can be carefully removed by micro-peeling these layers, exposing underlying neurons and axonal tracts without damage. This allows for recording neuronal morphology, including synaptic structures and their molecular contents, and the observation of physiological changes such as Ca2+ transients or intracellular transport events. In addition, interrogation of these processes by means of pharmacological inhibition or optogenetic manipulation is feasible. This brain exposure approach provides information about structural and physiological changes in neurons as well as the correlation and interdependence of these events in live brain tissue in the range of minutes or hours. The technique is suitable for in vivo brain imaging of zebrafish larvae up to 30 days post fertilization, the latest developmental stage tested so far. It, thus, provides access to such important questions as synaptic refinement and scaling, axonal and dendritic transport, synaptic targeting of cytoskeletal cargo or local activity-dependent expression. Therefore, a broad use for this mounting and imaging approach can be anticipated.

Here we present a method to image the zebrafish embryonic brain in vivo upto larval and juvenile stages. This microinvasive procedure, adapted from electrophysiological approaches, provides access to cellular and subcellular details of mature neuron and can be combined with optogenetics and neuropharmacological studies for characterizing brain function and drug intervention.

In vivo Bildgebung von vollaktivem Hirngewebe bei wachen Zebrafischlarven und Jungtieren durch Schädel- und Hautentfernung

Understanding the ephemeral changes that occur during brain development and maturation requires detailed high-resolution imaging in space and time at ...