NIH tarafından desteklenen bu çalışma Ağız Hastalıkları Açık Fonlama SKLOD2015OF01 (RB) ve R01-DK100584 ve Çin Devlet Anahtar Laboratuvarı verir. Biz yardım için Wenping Zhao, Tadatoshi Sato ve Kelly Lauter teşekkür ederiz.

Bu çalışma Massachusetts General Hastanesi Kurumsal Hayvan Bakım ve Kullanım Komitesi (IACUC) tarafından onaylanmıştır. başlamadan önce bu hayvan çalışması için uygun kurumsal onayını. Bazı teknikler yerel IACUC gereklerine göre ayarlanması gerekebilir. 1. GFP-PTX Fareler <ol><li> Daha fazla çiftleşme için eski 10 hafta - 8 at PTHcre + fare ve Rosa-mTmG fareler edinin. </li><li> C57BL / 6 geçmişi olan fareler elde 6 kuşaktır, C57BL / 6 fareleri (FVB arka 129 karışık) PTHcre + fareler geri-melez. </li><li> Kendilenmiş PTHcre + fareler PTHcre + / + fareler 17 elde edildi. NOT: genotipleme gerçekleştirmek kuyruk ucundan DNA ayıklamak ve PCR için kullanın. aşağıdaki gibi PCR primerleri olan heterozigot ve PTHcre Transgen homozigotluğu kontrol etmek için: ileri primer A, CCTGTCAAGGATGTGGAAGA, astar A ters &#39;, TCAGATCACACCACACAGCA, forward astar B, CAGTTGTCTTTAGTTTACTCAGCATCAG, astar B &#39;, GATAATCGCGAACATCTTCAGGTT 17 ters. </li><li> Rosa-mTmG fareler 18 Çapraz PTHcre + / + fareler 16. zaman 4 haftalık mTmG yavrular; PTHcre vazgeçirmek. </li><li> 0.6 mg / g vücut ağırlığı tribromoethanol ip enjeksiyonu (Avertin) ile mTmG fareler, ya da, ketamin / ksilazin gibi başka maddeler; 10 haftalık PTHcre - 8 anestezisi. onaylanmış bir protokole göre ameliyat sonrası 48 saat boyunca bir analjezik olarak buprenorfin, 0.1 mg / kg sc, 12 saatte kullanın. ayak tutam çekilme refleksi ya da başka yollarla anestezi uygun derinliğini sağlamak. yatar pozisyonda hayvan yerleştirin. </li><li> Uzatın ve tek kenar bıçakları kullanarak cilt tıraş ventral boyun bölgesini hazırlamak. Bir povidon iyot antiseptik ped ile traş cildi dezenfekte edin. </li><li> cerrahi bölgenin kirlenmesini azaltmak ve otoklava mikrofon kullanmak için steril cerrahi örtüler ile hayvan Kapakcerrahi işlem için rosurgical aletleri. </li><li> cerrahi bisturi ile cilt 2 cm insizyonu kesin. fasya teşrih ve kavisli tırtıklı forseps ile künt diseksiyon ile yan tükürük bezleri itin. </li><li> halojen ışık ve 4 kullanarak diseksiyon mikroskobu altında - 5X büyütme, kesme ve keskin forseps ipuçlarını kullanarak paratrakeal kasları ayrı ve trakea maruz kalmaktadır. </li><li> Bir sonraki trakea bulunan sağ ve sol lob ile tiroid bezi tanımlayın. </li><li> Floresan ışık ışık kaynağı açın ve iki yeşil-floresan paratiroidleri görselleştirmek. NOT: Genellikle, iki paratiroid bezleri veya tiroit bezi yüzeyine yakın bulunan, fakat bazen, onlar daha uzakta yer almaktadır. </li><li> Dikkatle cerrahi forseps ve makas kullanılarak yeşil paratiroidleri kaldırın. hemostaz için steril gazlı bez kullanın ve dikkatli bir şekilde tüm yeşil doku çıkarıldığından emin olmak için trakea boyunca kontrol edin. </li&gt; <li> 6-0 polyglactin 910 sütür kullanılarak kesintiye dikişle paratrakeal kasları kapatın. 6-0 polyglactin 910 sütür kullanılarak Halsted sütür ile cilt kesisi kapatın. </li><li> İsteğe bağlı: Sıvı değiştirilmesi için farelere 10 uL / ​​g vücut ağırlığı steril normal% 0,9 sodyum klorid çözeltisi enjekte edilir. </li><li> vücut ısısı geri kazanımı için sıcak bir inkübatör (37 ° C) ayrı bir kafes cerrahi sonrası hayvanların yerleştirin. Fareler uyanık ve yatar pozisyonda bir kez kafes kattaki bazı jelatin gıda pelet yemi ve su koyun. </li><li> 2 saatlik bir ameliyat sonrası gözlem döneminden sonra, hayvan tesis için fareyi dönmek ve cerrahi sonrası bakım için yerel gereksinimleri takip. </li><li> 3 gün Paratiroidektomi sonra, 10 uL kuyruk kan elde etmek ve bu tür kan gazı sistemi Ca ++ / pH analizörü gibi bir analizör kullanarak ++ Ca iyonize kan ölçün. Kandaki başarılı paratiroidektomi sonuçları Ca ++ eşit veya sahte çalışan con -2SD daha düşük iyonizekumanda fareleri (n = 30 Deneylerimizde 1.20 mmol / L). </li></ol> 2. PTH CRE-iDTR Fareler <ol><li> Çiftleşme eski 10 hafta - 8 de PTHcre + ve DTR fl / fl fareler edinin. </li><li> C57BL / 6 geçmişi olan fareler elde 6 kuşaktır, C57BL / 6 fareleri (FVB arka 129 karışık) PTHcre fareler geri-melez. </li><li> PTHcre + (C57BL / 6 background) fareler PTHcre + / + fareler 17 elde etmek için aynı soydan çiftleştirmek. NOT: fareler kuyruk uçları DNA ayıklanır ve PCR için kullanılan, genotipleme gerçekleştirmek için. Genotiplendirme Astarlar: ileri primer A, CCTGTCAAGGATGTGGAAGA, &#39;ileri primer B, CAGTTGTCTTTAGTTTACTCAGCATCAG, primer B ters TCAGATCACACCACACAGCA&#39; GATAATCGCGAACATCTTCAGGTT 17 primer A ters. </li><li> DTR ile PTHcre + / + fareler 16 Mate fl / fl PTHcre-iDTR fareler elde etmek için fareler 19. </li><li> diphtheri seyreltilmesi ile DT çözüm hazırlayın0.5 ug / mL bir konsantrasyona steril tuzlu su ile bir toksin toz. -80 ° C&#39;de steril filtre ve depolamak alikot. </li><li> Enjeksiyon deney için 10 haftalık PTHcre-iDTR fareler - 8 seçin. oda sıcaklığına kadar eritilir DT kısım, intraperitonal 5 ug / kg (10 uL / ​​g), bir hayvanın vücut ağırlığı DT uygulayın. Maksimal etkinlik ve en toksisite için, DT Yönetimi 3 günlük aralıklarla 17 2 enjeksiyon toplam tekrarlanır. </li><li> 3 gün ikinci enjeksiyondan sonra, her PTHcre-iDTR / PTHcre-iDTR-mTmG fareden 10 uL kuyruk kan alıp kan Ca ++ Kan Gazı Sistemi Ca ++ / pH analizörü kullanarak ölçün. NOT: kan fareler Ca araç-enjekte edilmiş kontrol farelerinin (n = 22) ortalamasının altında 2SS eşit hipoparatiroid fare gibi ++ daha düşük 1.18 mg / L, iyonize tanımlar. </li></ol>

<ol>
	<li>Brandi, M. L., Brown, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Hypoparathyroidism. , (2015).</li><li>van Abel, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coordinated+control+of+renal+Ca(2+)+transport+proteins+by+parathyroid+hormone.">Coordinated control of renal Ca(2+) transport proteins by parathyroid hormone.</a> Kidney Int. 68, 1708-1721 (2005).</li><li>Sebastian, E. M., Suva, L. J., Friedman, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+effects+of+intermittent+PTH(1-34)+and+PTH(7-34)+on+bone+microarchitecture+and+aortic+calcification+in+experimental+renal+failure.">Differential effects of intermittent PTH(1-34) and PTH(7-34) on bone microarchitecture and aortic calcification in experimental renal failure.</a> Bone. 43, 1022-1030 (2008).</li><li>Rodriguez-Ortiz, M. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calcium+deficiency+reduces+circulating+levels+of+FGF23.">Calcium deficiency reduces circulating levels of FGF23.</a> J Am Soc Nephrol. 23, 1190-1197 (2012).</li><li>Liao, H. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Relationship+between+Fibroblast+Growth+Factor+23+and+Biochemical+and+Bone+Histomorphometric+Alterations+in+a+Chronic+Kidney+Disease+Rat+Model+Undergoing+Parathyroidectomy.">Relationship between Fibroblast Growth Factor 23 and Biochemical and Bone Histomorphometric Alterations in a Chronic Kidney Disease Rat Model Undergoing Parathyroidectomy.</a> PloS one. 10, e0133278 (2015).</li><li>Fox, J., Care, A. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+low+calcium+and+low+phosphorus+diets+on+the+intestinal+absorption+of+water+in+intact+and+parathyroidectomized+pigs.">Effect of low calcium and low phosphorus diets on the intestinal absorption of water in intact and parathyroidectomized pigs.</a> Calcif Tissue Int. 31, 253-255 (1980).</li><li>Finco, D. R., Brown, S. A., Ferguson, D. C., Crowell, W. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+parathyroidectomy+of+the+dog.">Selective parathyroidectomy of the dog.</a> Can J Vet Res. 57, 288-292 (1993).</li><li>Can, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Parathyroid+allotransplantation+in+rabbits+without+cultivation.">Parathyroid allotransplantation in rabbits without cultivation.</a> Int J Clin Exp Med. 7, 280-284 (2014).</li><li>Dunn, T. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Melanoblasts+in+the+stroma+of+the+parathyroid+glands+of+strain+C58+mice.">Melanoblasts in the stroma of the parathyroid glands of strain C58 mice.</a> j Natl Cancer Inst. 10, 725-733 (1949).</li><li>Sakai, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Osteoclast+development+in+immobilized+bone+is+suppressed+by+parathyroidectomy+in+mice.">Osteoclast development in immobilized bone is suppressed by parathyroidectomy in mice.</a> J Bone Miner Metab. 23, 8-14 (2005).</li><li>Miao, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Skeletal+abnormalities+in+Pth-null+mice+are+influenced+by+dietary+calcium.">Skeletal abnormalities in Pth-null mice are influenced by dietary calcium.</a> Endocrinology. 145, 2046-2053 (2004).</li><li>Gunther, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+ablation+of+parathyroid+glands+reveals+another+source+of+parathyroid+hormone.">Genetic ablation of parathyroid glands reveals another source of parathyroid hormone.</a> Nature. 406, 199-203 (2000).</li><li>Hough, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activating+calcium-sensing+receptor+mutation+in+the+mouse+is+associated+with+cataracts+and+ectopic+calcification.">Activating calcium-sensing receptor mutation in the mouse is associated with cataracts and ectopic calcification.</a> Proc Natl Acad Sci U S A. 101, 13566-13571 (2004).</li><li>Hannan, F. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Calcilytic+Agent+NPS+2143+Rectifies+Hypocalcemia+in+a+Mouse+Model+With+an+Activating+Calcium-Sensing+Receptor+(CaSR)+Mutation:+Relevance+to+Autosomal+Dominant+Hypocalcemia+Type+1+(ADH1).">The Calcilytic Agent NPS 2143 Rectifies Hypocalcemia in a Mouse Model With an Activating Calcium-Sensing Receptor (CaSR) Mutation: Relevance to Autosomal Dominant Hypocalcemia Type 1 (ADH1).</a> Endocrinology. 156, 3114-3121 (2015).</li><li>Libutti, S. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Parathyroid+gland-specific+deletion+of+the+mouse+Men1+gene+results+in+parathyroid+neoplasia+and+hypercalcemic+hyperparathyroidism.">Parathyroid gland-specific deletion of the mouse Men1 gene results in parathyroid neoplasia and hypercalcemic hyperparathyroidism.</a> Cancer Res. 63, 8022-8028 (2003).</li><li>Bi, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diphtheria+Toxin-+and+GFP-Based+Mouse+Models+of+Acquired+Hypoparathyroidism+and+Treatment+with+a+Long-Acting+Parathyroid+Hormone+Analog.">Diphtheria Toxin- and GFP-Based Mouse Models of Acquired Hypoparathyroidism and Treatment with a Long-Acting Parathyroid Hormone Analog.</a> J Bone Miner Res. , (2015).</li><li>Muzumdar, M. D., Tasic, B., Miyamichi, K., Li, L., Luo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+global+double-fluorescent+Cre+reporter+mouse.">A global double-fluorescent Cre reporter mouse.</a> Genesis. 45, 593-605 (2007).</li><li>Buch, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Cre-inducible+diphtheria+toxin+receptor+mediates+cell+lineage+ablation+after+toxin+administration.">A Cre-inducible diphtheria toxin receptor mediates cell lineage ablation after toxin administration.</a> Nat Methods. 2, 419-426 (2005).</li><li>Dunn, T. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Melanoblasts+in+the+stroma+of+the+parathyroid+glands+of+strain+C58+mice.">Melanoblasts in the stroma of the parathyroid glands of strain C58 mice.</a> J Natl Cancer Inst. 10, 725-733 (1949).</li></ol>

The authors declare that they have no competing financial interests.

Biz paratiroid bezleri seçici GFP ifade ile transgenik fareler kullanılarak GFP güdümlü Paratiroidektomi tekniğini göstermektedir. PTHcre ise; mTmG fareler, çift floresan (Cre-ifade hücreleri ve non-Cre kırmızı domates yeşil GFP hücreleri ifade edilmiştir) açıkça belirlemek ve tam olarak tiroid çıkarmadan tüm paratiroid bezleri kaldırmak sağladı. floresan kırmızı olmayan paratiroid dokusunun belirlenmesi yeteneği için çift floresan mTmG farelerin kullanımını tercih ederken, bizim prosedür aynı zamanda domates kırmızısı (B6.Cg-Ct (ROSA) 26Sortm14 (as tek floresan hayvanları kullanarak iyi çalışması gerekir CAG-tdTomato) Hze / J) fare. prosedür gerçekleştirmek için nispeten kolaydır fare başına yaklaşık 20 dakika gerektirir ve şiddetli ve uzun süreli hipoparatiroid fenotipe yol açar. Buna ek olarak, GFP pozitif paratiroid bezlerinin bir başka avantajı, anormal paratiroid bezlerinin saptanması kolaylığıdır. Çalışmalarımız göstermektedirhali hazırda, yeşil floresan eden fare modelinde tespit edilir B6 sıçanlarında (Şekil 1), yaklaşık dörtte paratiroid mislocalization. Thyro-Paratiroidektomi aksine, bizim teknik tiroid hormon replasmanı ve kalsitonin üreten tiroid C-hücre çıkarılması bilinmeyen etkisi müteakip ihtiyacı olan tiroid kaldırılmasını önler. Floresan etiketli paratiroid bezleri paratiroid bezlerinin izolasyonunu gerektiren diğer araştırmalar için kullanılabilir. Bu modele göre sınırlama cerrahi gereksinimler arasında. Temel mikrocerrahi beceri ve floresan ışık kaynağı olan bir diseksiyon mikroskobu gereklidir. Ameliyat ihtiyacını ortadan kaldırır hipoparatiroid fareler üretmek için ikinci bir teknik gösterilmiştir. Difteri PTHcre-iDTR fareler daha hafif bir hipoparatiroidizm fenotip sergileyen, ama sadece fare içine intraperitoneal DT enjekte gerektiren toksin-tedavi. kritik bir parçası for doz optimizasyon bu model oldu üreten ve doz rejiminde. DT yüksek dozlarda toksisite yol açtı, ancak düşük dozlarda yaklaşımın etkinliğini azaltmıştır. Bu tatbik 5 ug / kg, 2 enjeksiyon doz rejiminin 3 gün arayla, NO / minimum mortalite ile, güvenilir ve kararlı bir hipokalsemi neden olduğu tespit edilmiştir. Sonuçta, bu iki yaklaşım edinilen hipoparatiroidi için yararlı fare modelleri sağladığını umuyoruz. Yeni bir uzun etkili PTH kullanarak, hipoparatiroidi 17 için yeni ilaçların etkinliğini belirlemede bu modellerin her ikisi de ilk kez kullanıldığını bildirdi.

Insan fizyolojisi ve hastalık için bu küçük endokrin organ önemini anlamak 1880 1 insan ve Sandström tarafından diğer bazı türlerde paratiroid bezlerinin ilk sistematik açıklama beri sürekli artmıştır. Paratiroid bezleri paratiroid hormonu (PTH), kalsiyum metabolizması başlıca regülatörü salgılar. PTH aynı zamanda fosfat homeostasis ve kemik döngüsü 1, 2 için önemli bir hormondur. Boyun cerrahisi sırasında paratiroid Kaza çıkarılması veya hasar hipoparatiroidizm en sık nedeni, düşük kan kalsiyum, düşük PTH ve yüksek fosfor 1 ile karakterize bir hastalıktır. Daha iyi çalışmaya, güvenilir ve kolay erişilebilir fare modelleri gereklidir hipoparatiroidizm ve test yeni tedaviler, satın aldı. genetik araçları bir çok çeşit, çünkü Fare yaygın araştırmalarında kullanılanin vivo gelişmiş mekanik çalışmalar izin bu türlerde ullanılabilir. Cerrahi paratiroidektomi (PTX) sıçanlarda, 2, 3, 4, 5, ve daha büyük memelilerde 6, 7, 8 kullanılabilir Ancak, bu teknik, çünkü bezlerin küçük boyutu ve değişken bir anatomik dağılımı farelerde çok zor 9. Bu nedenle, Thyro paratiroidektomi (TPTX), tipik olarak, tiroid, paratiroid bezleri birlikte 10 kaldırılır olduğu fare, gerçekleştirilir. Ancak, düşük tiroid hormon düzeyleri bu modeli komplike deneylerde potansiyel karıştırıcı vardır. Buna ek olarak, kalsitonin, kemirgenlerde Kalsiyum homeostazında önemli bir hormon üreten tiroid bezi olan Cı-hücrelerinin, aynı zamanda th çıkarılması üzerine kayıpyroids 11. Hipoparatiroidizm çeşitli genetik fare modelleri PTH nul faresi 12 GCM2 boş fare 13 ve kalsiyuma duyarlı reseptörü (CaSR) 14, 15, bir aktive mutasyonu ile NUF fare dahil olduğu, bulunmaktadır. Ancak, bu genetik bozukluklar zaten embriyonik gelişim sırasında mevcut ve paratiroid fonksiyonu, bu nedenle zaten embriyogenez sırasında bozulur. Bu, iskelet gibi organların gelişimini etkileyebilir. Bu sonraki yaşamında hastalığı kazanmak cerrahi sonrası hipoparatiroidi hasta ile tezat. Ayrıca, bu fare modelleri, bazı başka kullanımını 12, 13, 14 karmaşık hale erken öldürücülüğü ve azaltılmış doğurganlık, sergiler. Biz iki yeni fare m geliştirdiedinilen hipoparatiroidi için MODELLERİ. tiroid bezi çıkarmadan paratiroid bezleri kolayca cerrahi olarak çıkarılması için belirlenen sağlar, özellikle paratiroid GFP ifade genetiği fareler kullanma. Bu fare ROSA mTmG fare ile 5.5 kb PTH promoterinin 16 kontrolü altında Cre rekombinazı ifade PTH Cre fare kapısı ile oluşturulmuştur. Elde edilen PTHcre; mTmG farenin paratiroid hücrelerde spesifik olarak, yeşil floresan proteini ifade eder. İkinci bir fare modeli, aynı PTH Cre, paratiroid spesifik olarak difteri toksini reseptörünün eksprese edilmesine yol açan, uyarılabilir DTR fare DUR kaseti çıkarmak için bu kez kullanır. DT sistemik uygulaması hayvanlar ameliyat olmadan hipoparatiroid render, paratiroid hücreleri yok eder. Bu çalışmada sunulan iki fare modelleri üç aylık gözlem peri üzerinde istikrarlı bir hipokalsemik fenotip gösterene. Prosedürler gerçekleştirmek kolay, fenotip tekrarlanabilir ve hipoparatiroid fareler yüksek hayatta kalma oranı 17 sergilerler.

<table border="0" cellpadding="0" cellspacing="0" width="676">
	<tbody>
		<tr height="26">
			<td height="26" style="height:26px;width:188px;">ROSAmT/mG mice</td>
			<td style="width:183px;">The Jackson Laboratory</td>
			<td align="right" style="width:108px;">7676</td>
			<td style="width:197px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:188px;">PTH-Cre mice</td>
			<td style="width:183px;">The Jackson Laboratory</td>
			<td align="right" style="width:108px;">5989</td>
			<td style="width:197px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:188px;">iDTRmice</td>
			<td style="width:183px;">The Jackson Laboratory</td>
			<td align="right" style="width:108px;">7900</td>
			<td style="width:197px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:188px;">6-0 polyglactin 910 suture with needle</td>
			<td style="width:183px;">Ethicon, Inc</td>
			<td style="width:108px;">J510G</td>
			<td style="width:197px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:188px;">Safety Single Edge Razor Blades</td>
			<td style="width:183px;">American Safety Razor Company</td>
			<td style="width:108px;">66-0089</td>
			<td style="width:197px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:188px;">Disposable Scalpel</td>
			<td style="width:183px;">Feather Safety Razor Co., LTD</td>
			<td style="width:108px;">72042-11</td>
			<td style="width:197px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:188px;">Povidone-Iodine Prep Pads</td>
			<td style="width:183px;">Dynarex Corporation</td>
			<td align="right" style="width:108px;">1108</td>
			<td style="width:197px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:188px;">Ply gauze</td>
			<td style="width:183px;">Busse. Inc</td>
			<td style="width:108px;">BHD707</td>
			<td style="width:197px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:188px;">0.9% Sodium Chloride Solution</td>
			<td style="width:183px;">HOSPIRA Worldwide, Inc</td>
			<td style="width:108px;">07983-09</td>
			<td style="width:197px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:188px;">1mL 29G Insulin Syringe</td>
			<td style="width:183px;">BECTON DICKINSON</td>
			<td align="right" style="width:108px;">329622</td>
			<td style="width:197px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:188px;">Surgical Incise Drapes</td>
			<td style="width:183px;">3M</td>
			<td style="width:108px;">6640EZ</td>
			<td style="width:197px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:188px;">Dumstar Biology forceps</td>
			<td style="width:183px;">Roboz Surgical Instrument Co., Inc</td>
			<td style="width:108px;">RS-4984</td>
			<td style="width:197px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:188px;">Micro Dissecting Spring Scissors</td>
			<td style="width:183px;">Roboz Surgical Instrument Co., Inc</td>
			<td style="width:108px;">RS-5605</td>
			<td style="width:197px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:188px;">Needle Holder</td>
			<td style="width:183px;">MILTEX.,Inc</td>
			<td style="width:108px;">V98-42</td>
			<td style="width:197px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:188px;">2,2,2-Tribromethanol</td>
			<td style="width:183px;">Sigma-Aldrich</td>
			<td style="width:108px;">T48402</td>
			<td style="width:197px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:188px;">2-Methyl-2-Butanol</td>
			<td style="width:183px;">Sigma-Aldrich</td>
			<td align="right" style="width:108px;">152463</td>
			<td style="width:197px;">For dissolve the 2,2,2-Tribromethanol</td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:188px;">Diphtheria Toxin Powder</td>
			<td style="width:183px;">Sigma-Aldrich</td>
			<td style="width:108px;">D0564</td>
			<td style="width:197px;">Dissolve in 0.9% sodium chloride solution at 1mg/mL as the stock solution in -80C</td>
		</tr>
		<tr height="72">
			<td height="72" style="height:72px;width:188px;">Multicap Blood Collection Capillary tubes</td>
			<td style="width:183px;">Siemens Healthcare Diagnostics Ltd</td>
			<td align="right" style="width:108px;">855578</td>
			<td style="width:197px;">For collecting blood in iCa2+ analysis using RapidLab 348 Ca2+/pH analyzer</td>
		</tr>
		<tr height="47">
			<td height="47" style="height:47px;width:188px;">RapidLab 348 Ca2+/pH analyzer</td>
			<td style="width:183px;">Siemens Healthcare</td>
			<td style="width:108px;"></td>
			<td style="width:197px;">For iCa2+ analysis</td>
		</tr>
	</tbody>
</table>

two techniques to create hypoparathyroid mice: parathyroidectomy using gfp glands and diphtheria-toxin-mediated parathyroid ablation

Hypoparathyroidism (HP) is a disorder characterized by low levels of PTH which lead to hypocalcemia, hyperphosphatemia, and low bone turnover. The most common cause of the disease is accidental removal of the parathyroid glands during thyroid surgery. Novel therapies for HP are needed, but testing them requires reliable animal models of acquired HP. 
Here, we demonstrate the generation of two mouse models of acquired HP. In the GFP-PTX model, mice with green fluorescent protein (GFP) expressed specifically in the parathyroids (PTHcre-mTmG) were created by crossing PTHcre+ mice with Rosa-mTmGfl/fl mice. Green fluorescing parathyroid glands are easily identified under a fluorescence dissecting microscope and parathyroidectomy is performed in less than 20 min. After fluorescence-guided surgery, mice are profoundly hypocalcemic. Contrary to the traditional thyro-parathyroidectomy, this precise surgical approach leaves thyroid glands and thyroid function intact. The second model, which does not require surgery, is based on a diphtheria-toxin approach. PTHcre-iDTR mice, which express the diphtheria toxin (DT) receptor specifically in the parathyroids, were generated by crossing the inducible DTR mouse with the PTHcre mouse. Parathyroid cells are thus rendered sensitive to diphtheria toxin (DT) and can be selectively destroyed by systemically injecting mice with DT. The resulting hypocalcemic phenotype is stable.

Paratiroid Bezleri Konumu Floresan diseksiyon mikroskobu altında görüldüğü gibi Öncelikle, biz 54 PTHcre-mTmG farelerin paratiroid bezlerinin dağılımını kaydedildi. % 74 (40/54), farenin% 26 (14/54), farenin bir ilave üçüncü paratiroid bezi (Şekil 1B, D, F) olan iki yeşil paratiroid bezleri (Şekil 1A, C, E), vardı. Tek bir bez veya üçten fazla bezleri ile Resim fare gözlenmiştir. Genellikle, paratiroid bezleri, tiroid bezi (% 58, 71/122 üst sınırına yakın bulunduğu Şekil 1A (1,2), B (1,2), C (2), D (1,2), e (2), A (3)). % 27 (33/122) bezlerin tiroid bezinin alt sınırına yakın bulunduğu (Şekil 1C (1), D (3), F (1)), ve% 13 (16/122) uzak t bulunduğuTiroid bezi (Şekil 1B (3), D (1), E (2)). Bulgularımız ile tutarlı ve paratiroid bezlerinin 20 yerleri değişen önceki bulguları uzatmak. GFP-PTX Fareler cilt insizyonu kapatma anestezi tüm cerrahi fare başına yaklaşık 20 dakika sürdü. 3 aylık gözlem dönemi boyunca ameliyat sonrası farelerin hayatta kalma oranı% 96.3 (53/55) idi. % 92.4 (49/53) GFP-PTX fareler 2 SD sahte çalışan kontrol fareleri veya daha düşük ortalama altındaydı iyonize kalsiyum düzeyleri sergiledi. GFP-PTX farelerde (hipokalsemi, düşük PTH ve serum fosfat) olarak hipoparatiroid fenotip 3 ay tüm gözlem süresi boyunca stabil idi. Önemlisi, tiroid fonksiyon 42 ± 24 vs = 3 ay cerrahi (TSH sonra yapay olarak ameliyat edilmiş hayvanlardan farklı değildi 30 ± 15 mU / L, p = 0.171; T4 = 30,0 ± 0,6 vs 3,1 ± 0,9 mg / dL, p = 0.707 (Şekil 2). PTH-CRE-iDTR Fareler DT PTH-Cre-iDTR farelere geliştirilen hipoparatiroidizm (düşük kan iyonize kalsiyum, yüksek kan fosfor ve uygunsuz düşük-normal PTH düzeyleri) enjekte edilir. Daha önce ölçülebilir, dolaşımdaki PTH ve bu farelerin 17, bu nedenle biraz daha yumuşak fenotipi açıklayan birkaç PTH pozitif hücreler difteri toksini ile ablasyon kaçış bildirmiştir. GFP-PTX Fareler ve PTH-CRE-iDTR Farelerde hipoparatiroidizm Önemli kan Ca indirimleri ++ ve serum PTH düzeyleri sham operasyonu farelerde bulunan seviyelerde (Ca ++ = 1.05 ± 0.40 vs ile karşılaştırıldığında, 3 gün ameliyat sonrası GFP-PTX farelerde gözlendi </em&gt; 1.30 ± 0.03 mg / L, p &lt;0.05; PTH = 32 ± 22 vs 580 ± 137 pg / ml, p &lt;0.05). Hipoparatiroidizm fenotip 3 aylık gözlem dönemi boyunca istikrarlı oldu (Şekil 3A, izniyle (referans 17. yeniden basıldı)). 3 gün arayla, maksimal hipoparatiroid fenotip vermek için DT en az miktarda kullanmak için optimize edilmiş dozda ve rejimi de 5 ug / kg DT 2 enjeksiyondan sonra, DT PTH-CRE-iDTR fareler ile karşılaştırıldığında önemli hipokalsemi ve düşük PTH gösterdi enjekte 90 günlük gözlem süresi boyunca devam araç kontrol fareleri, (Ca ++ = 1.10 ± 0.07 mmol / L genel 1.26 ± 0.05 mmol / L, p &lt;0.05 &#39;= 218 ± 156 pg / ml vs 572 ± 164 pg PTH / ml, p &lt;0.05) (Şekil 3B, (referans # 17 izniyle)). <img alt="Şekil 1" src="/files/ftp_upload/55010/55010fig1.jpg" /> Şekil 1: <stRong&gt; Floresan Diseksiyon Mikroskop altında 54 PTHcre-mTmG Farelerde Paratiroid Bezleri çeşitli yerler Temsilcisi Görüntüler. Fareler, ya iki (A, C, E) ya da üç (B, D, F), yeşil paratiroid bezleri vardı. En paratiroid bezleri üst sınırının yakınında bulunan (A (1,2), B (1,2), C (2), D (1,2), D (2), A (3) ya da yakınındaki alt sınırı tiroid bezinin (C (1), D (3), F (1)). nadir durumlarda, bazı ektopik bulunduğu (B (3), E (1), F (2)). <a href="http://ecsource.jove.com/files/ftp_upload/55010/55010fig1large.jpg" target="_blank">için tıklayınız Bu rakamın daha büyük bir versiyonunu görmek.</a> <img alt="şekil 2" src="/files/ftp_upload/55010/55010fig2.jpg" /> Şekil 2: TSH ve GFP-PTX Fare T4 seviyesi. 3 ay GFP PTX sonra serum TSH ve T4 measurem elde edildi<html> hastalar. GFP-PTX fareler TSH konsantrasyonları (42 ± 24 mU / L) (A) ve T4 konsantrasyonları gösterdi (3.0 ± 0.6 ug / dl) kontrol farelerine (TSH = 30 ± 15 mU / L, p farklı değildi (B) = 0.171, n = 11, T4 = 3.1 ± 0.9, p = 0.707, n = 11). <a href="http://ecsource.jove.com/files/ftp_upload/55010/55010fig2large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> <img alt="Şekil 3," src="/files/ftp_upload/55010/55010fig3.jpg" /> Şekil 3: GFP-PTX Farelerde Kan Ca ++ ve PTH Düzeyleri ve DT PTH-CRE-iDTR Fare Enjekte. (Yeniden basılmış - (*** p &lt;0.001, n = 8 6) Hem GFP PTX fareleri (A) ve DT PTH-iDTR cre stabil hipokalsemi sergilenen fareleri (B) enjekte edilmiş ve 3 aylık bir gözlem dönemi boyunca, PTH seviyeleri, indirgenmiş referans # 17) izni ile.es / ftp_upload / 55010 / 55010fig3large.jpg &quot;target =&quot; _ blank &quot;&gt; bu rakamın daha büyük bir versiyonunu görmek için lütfen buraya tıklayınız.

Watch this Scientific Journal Video about Two Techniques to Create Hypoparathyroid Mice: Parathyroidectomy Using GFP Glands and Diphtheria-Toxin-Mediated Parathyroid Ablation at JoVE.com

Two Techniques to Create Hypoparathyroid Mice: Parathyroidectomy Using GFP Glands and Diphtheria-Toxin-Mediated Parathyroid Ablation

Mice with acquired hypoparathyroidism would be useful for studying novel drug therapies for hypoparathyroidism. Two procedures to create such mice are demonstrated. The GFP-PTX mouse is generated by surgical parathyroidectomy guided by green fluorescing parathyroid glands. A second, non-surgical approach is based on parathyroid-specific expression of the diphtheria toxin receptor.

Hipoparatiroid Fare oluşturma iki Teknikleri: Paratiroidektomi GFP Rakorlar ve Difteri-Toksin-Aracılı Paratiroid Ablasyonu kullanma

Hypoparathyroidism (HP) is a disorder characterized by low levels of PTH which lead to hypocalcemia, hyperphosphatemia, and low bone turnover. The most ...

two-techniques-to-create-hypoparathyroid-mice-parathyroidectomy-using

Universidad de Cartagena UDEC

Research

JoVE Journal

Medicine

14.4K Görüntüleme.  Harvard Medical School. Mice with acquired hypoparathyroidism would be useful for studying novel drug therapies for hypoparathyroidism. Two procedures to create such mice are demonstrated. The GFP-PTX mouse is generated by surgical parathyroidectomy guided by green fluorescing parathyroid glands. A second, non-surgical approach is based on parathyroid-specific expression of the diphtheria toxin receptor.

Video: Two Techniques to Create Hypoparathyroid Mice: Parathyroidectomy Using GFP Glands and Diphtheria-Toxin-Mediated Parathyroid Ablation

Inducing Myointimal Hyperplasia Versus Atherosclerosis in Mice: An Introduction of Two Valid Models

Various in vivo laboratory rodent models for the induction of artery stenosis have been established to mimic diseases that include arterial plaque formation and stenosis, as observed for example in ischemic heart disease. Two highly reproducible mouse models&#160;&#8211;&#160;both resulting in artery stenosis but each underlying a different pathway of development&#160;&#8211; are introduced here. The models represent the two most common causes of artery stenosis; namely one mouse model for each myointimal hyperplasia, and atherosclerosis are shown. To induce myointimal hyperplasia, a balloon catheter injury of the abdominal aorta is performed. For the development of atherosclerotic plaque, the ApoE -/- mouse model in combination with western fatty diet is used. Different model-adapted options for the measurement and evaluation of the results are named and described in this manuscript. The introduction and comparison of these two models provides information for scientists to choose the appropriate artery stenosis model in accordance to the scientific question asked.

This video shows two models of intimal plaque development in murine arteries and emphasizes the differences in myointimal hyperplasia and atherosclerosis.

Farelerde Ateroskleroz Karşı miyointimal hiperplazide uyaran: İki Geçerli Modellerinin An Introduction

Various in vivo laboratory rodent models for the induction of artery stenosis have been established to mimic diseases that include arterial plaque ...

Tıp

Acute Brain Trauma in Mice Followed By Longitudinal Two-photon Imaging

Although acute brain trauma often results from head damage in different accidents and affects a substantial fraction of the population, there is no effective treatment for it yet. Limitations of currently used animal models impede understanding of the pathology mechanism. Multiphoton microscopy allows studying cells and tissues within intact animal brains longitudinally under physiological and pathological conditions. Here, we describe two models of acute brain injury studied by means of two-photon imaging of brain cell behavior under posttraumatic conditions. A selected brain region is injured with a sharp needle to produce a trauma of a controlled width and depth in the brain parenchyma. Our method uses stereotaxic prick with a syringe needle, which can be combined with simultaneous drug application. We propose that this method can be used as an advanced tool to study cellular mechanisms of pathophysiological consequences of acute trauma in mammalian brain in vivo. In this video, we combine acute brain injury with two preparations: cranial window and skull thinning. We also discuss advantages and limitations of both preparations for multisession imaging of brain regeneration after trauma.

Acute brain trauma is a severe injury that has no adequate treatment to date. Multiphoton microscopy allows studying longitudinally the process of acute brain trauma development and probing therapeutical strategies in rodents. Two models of acute brain trauma studied with in vivo two-photon imaging of brain are demonstrated in this protocol.

Boyuna İki foton görüntüleme ile takip Farelerde Akut Beyin Travma

Although acute brain trauma often results from head damage in different accidents and affects a substantial fraction of the population, there is no ...

Robotic Ablation of Atrial Fibrillation

Background: Pulmonary vein isolation (PVI) is an established treatment for atrial fibrillation (AF). During PVI an electrical conduction block between pulmonary vein (PV) and left atrium (LA) is created. This conduction block prevents AF, which is triggered by irregular electric activity originating from the PV. However, transmural atrial lesions are required which can be challenging. Re-conduction and AF recurrence occur in 20 - 40% of the cases. Robotic catheter systems aim to improve catheter steerability. Here, a procedure with a new remote catheter system (RCS), is presented. Objective of this article is to show feasibility of robotic AF ablation with a novel system. Materials and Methods: After interatrial trans-septal puncture is performed using a long sheath and needle under fluoroscopic guidance. The needle is removed and a guide wire is placed in the left superior PV. Then an ablation catheter is positioned in the LA, using the sheath and wire as guide to the LA. LA angiography is performed over the sheath. A circular mapping catheter is positioned via the long sheath into the LA and a three-dimensional (3-D) anatomical reconstruction of the LA is performed. The handle of the ablation catheter is positioned in the robotic arm of the Amigo system and the ablation procedure begins. During the ablation procedure, the operator manipulates the ablation catheter via the robotic arm with the use of a remote control. The ablation is performed by creating point-by-point lesions around the left and right PV ostia. Contact force is measured at the catheter tip to provide feedback of catheter-tissue contact. Conduction block is confirmed by recording the PV potentials on the circular mapping catheter and by pacing maneuvers. The operator stays out of the radiationfield during ablation. Conclusion: The novel catheter system allows ablation with high stability on low operator fluoroscopy exposure.

Pulmonary vein isolation (PVI) with an ablation catheter is a curative treatment for atrial fibrillation (AF). Robotic catheter systems aim to improve catheter steerability. Here, a procedure with a new robotic catheter system is presented. The goal of the procedure is electrical block between pulmonary vein and left atrium.

Atriyal Fibrilasyon Robotik Ablasyon

Background: Pulmonary vein isolation (PVI) is an established treatment for atrial fibrillation (AF). During PVI an electrical conduction block between ...

A Simple Mechanical Procedure to Create Limbal Stem Cell Deficiency in Mouse

Limbal stem cell deficiency (LSCD) is a state of malfunction or loss of limbal epithelial stem cells, after which the corneal epithelium is replaced with conjunctiva. Patients suffer from recurrent corneal defects, pain, inflammation, and loss of vision.
Previously, a murine model of LSCD was described and compared to two other models. The goal was to produce a consistent mouse model of LSCD that both mimics the phenotype in humans and lasts long enough to make it possible to study the disease pathophysiology and to evaluate new treatments. Here, the technique is described in more detail.
A motorized tool with a rotating burr has been designed to remove the rust rings from the corneal surface or to smooth the pterygium bed in patients. It is a suitable device to create the desired LSCD model. It is a readily available, easy-to-use tool with a fine tip that makes it appropriate for working on small eyes, as in mice. Its application prevents unnecessary trauma to the eye and it does not result in unwanted injuries, as often is the case with chemical injury models. As opposed to a blunt scraper, it removes the epithelium with the basement membrane. In this protocol, the limbal area was abraded two times, and then the whole corneal epithelium was shaved from limbus to limbus. To avoid stroma injury, care was taken not to brush the corneal surface once the epithelium was already removed.

The following article provides an easy, reproducible technique to effectively create a sustainable mouse model of limbal stem cell deficiency (LSCD). This animal model is useful in testing and comparing the efficacy of treatments for limbal stem cell diseases.

Basit mekanik Prosedür Mouse Limbal Kök Hücre Eksikliği oluşturma

Limbal stem cell deficiency (LSCD) is a state of malfunction or loss of limbal epithelial stem cells, after which the corneal epithelium is replaced with ...

Techniques of Sleeve Gastrectomy and Modified Roux-en-Y Gastric Bypass in Mice

Obesity is a major public health issue, with a prevalence of 4 to 28% for men and 6.2 to 36.5% for women in Europe (from 2003 to 2008). Morbid obesity is frequently associated with metabolic complications, such as type 2 diabetes, hypertension, and dyslipidemia, reducing life expectancy and quality. In the absence of any effective noninvasive treatments, bariatric surgery is a valuable therapeutic option for patients with morbid obesity (body mass index (BMI) &#62;40 kg/m2), leading to long-term, sustained weight loss and improvements in metabolic complications. However, the underlying cellular and molecular mechanisms sustaining the beneficial effects of bariatric surgery are not yet fully understood. Due to the numerous genetically-modified strains available, the mouse model is the most convenient animal model to explore the molecular mechanisms behind the pleiotropic beneficial effects of bariatric surgeries. Here, we detailed the optimized healthcare methods and surgical protocols in mice for the two most widely-used bariatric surgeries: the sleeve gastrectomy and the modified Roux-en-Y gastric bypass. Deciphering the molecular mechanisms underlying the therapeutic effects of bariatric surgeries offers the promise of identifying new therapeutics targets.

Bariatric surgery is the most efficient way to reduce body weight and the deadly metabolic complications (diabetes, obesity, and dyslipidemia) frequently associated with morbid obesity. Mouse models of bariatric surgery represent a unique asset for deciphering molecular mechanisms behind the beneficial effects of these surgeries on diabetes, hypertension, and dyslipidemia.

Sleeve gastrektomi Teknikleri ve Farelerde Roux-en-Y Gastrik Bypass Modifiye

Obesity is a major public health issue, with a prevalence of 4 to 28% for men and 6.2 to 36.5% for women in Europe (from 2003 to 2008). Morbid obesity is ...

In Vivo Imaging of Cx3cr1gfp/gfp Reporter Mice with Spectral-domain Optical Coherence Tomography and Scanning Laser Ophthalmoscopy

Spectral domain optical coherence tomography (SD-OCT) and scanning laser ophthalmoscopy (SLO) are extensively used in experimental ophthalmology. In the present protocol, mice expressing green fluorescent protein (gfp) under the promoter of Cx3cr1 (BALB/c-Cx3cr1gfp/gfp) were used to image microglia cells in vivo in the retina. Microglia are resident macrophages of the retina and have been implicated in several retinal diseases1,2,3,4,5,6. This protocol provides a detailed approach for generation of retinal B-scans, with SD-OCT, and imaging of microglia cell distribution in Cx3cr1gfp/gfp mice with SLO in vivo, using an ophthalmic imaging platform system. The protocol can be used in several reporter mouse lines. However, there are some limitations to the protocol presented here. First, both SLO and SD-OCT, when used in the high-resolution mode, collect data with high axial resolution but the lateral resolution is lower (3.5 &#181;m and 6 &#181;m, respectively). Moreover, the focus and saturation level in SLO is highly dependent on parameter selection and correct alignment of the eye. Additionally, using devices designed for human patients in mice is challenging due to the higher total optical power of the mouse eye compared to the human eye; this can lead to lateral magnification inaccuracies7, which are also dependent on the magnification by the mouse lens among others. However, despite that the axial scan position is dependent upon lateral magnification, the axial SD-OCT measurements are accurate8.

In Vivo Imaging of Cx3cr1gfp/gfp Reporter Mice with Spectral-domain Optical Coherence Tomography and Scanning Laser Ophthalmoscopy

This protocol describes how high-resolution imaging techniques such as spectral domain optical coherence tomography and scanning laser ophthalmoscopy can be utilized in small rodents, using an ophthalmic imaging platform system, to obtain information on retinal thickness and microglial cell distribution, respectively.

Vivo Tayf alanlı optik Koherens tomografi ve lazer Ophthalmoscopy tarama Cx3cr1gfp/gfp muhabir farelerin görüntüleme

Spectral domain optical coherence tomography (SD-OCT) and scanning laser ophthalmoscopy (SLO) are extensively used in experimental ophthalmology. In the ...

Ablation of Ischemic Ventricular Tachycardia Using a Multipolar Catheter and 3-dimensional Mapping System for High-density Electro-anatomical Reconstruction

Ventricular tachycardia (VT) in patients with ischemic cardiomyopathy mainly results from endocardial scars after myocardial infarction; those scars represent zones of slow conduction that allow the occurrence and maintenance of reentrant circuits. Catheter ablation enables substrate modification of those low voltage areas and thus can help to alter the scar tissue in such a way that arrhythmias cannot appear anymore. Hospitalizations of concerned patients decrease, quality of life and outcome rise. Consequently, VT ablation represents a growing field in electrophysiology, especially for patients with endocardial scars in ischemic heart disease after myocardial infarction. However, ablation of ventricular tachycardia remains one of the most challenging procedures in the electrophysiology lab. Precise scar definition and localization of abnormal potentials are critical for ablation success. The following manuscript describes the use of a multipolar mapping catheter and 3-dimensional (3D) mapping system to create a high density electro-anatomical map of the left ventricle including a precise scar representation as well as mapping of fractionated and late potentials in order to allow a highly accurate substrate modification.

With the following protocol, we provide an approach to Ventricular Tachycardia (VT) ablation using high density mapping with a multipolar catheter and 3D mapping system enhancing the success of the procedure.

İskemik ventriküler taşikardi Multipolar kateter ve 3 boyutlu haritalama sistemi yüksek yoğunluklu elektro-anatomik imar için kullanılarak ablasyon

Ventricular tachycardia (VT) in patients with ischemic cardiomyopathy mainly results from endocardial scars after myocardial infarction; those scars ...

Protocol to Create Chronic Wounds in Diabetic Mice

Chronic wounds develop as a result of defective regulation in one or more complex cellular and molecular processes involved in proper healing. They impact ~6.5M people and cost ~$40B/year in the US alone. Although a significant effort has been invested in understanding how chronic wounds develop in humans, fundamental questions remain unanswered. Recently, we developed a novel mouse model for diabetic chronic wounds that have many characteristics of human chronic wounds. Using db/db-/- mice, we can generate chronic wounds by inducing high levels of oxidative stress (OS) in the wound tissue immediately after wounding, using a one-time treatment with inhibitors specific to the antioxidant enzymes catalase and glutathione peroxidase. These wounds have high levels of OS, develop biofilm naturally, become fully chronic within 20 days after treatment and can remain open more for more than 60 days. This novel model has many features of diabetic chronic wounds in humans and therefore can contribute significantly to advancing fundamental understanding of how wounds become chronic. This is a major breakthrough because chronic wounds in humans cause significant pain and distress to patients and result in amputation if unresolved. Moreover, these wounds are very expensive and time-consuming to treat, and lead to significant loss of personal income to patients. Advancements in this field of study through the use of our chronic wound model can significantly improve health care for millions who suffer under this debilitating condition. In this protocol, we describe in great detail the procedure to cause acute wounds to become chronic, which has not been done before.

Chronic wounds are developed from acute wounds on a diabetic mouse model by inducing high levels of oxidative stress after a full-thickness cutaneous wound. The wound is treated with inhibitors for catalase and glutathione peroxidase, resulting in impaired healing and biofilm development by bacteria present in the skin microbiome.

Diyabetik Farelerde Kronik Yaralar Oluşturma Protokolü

Chronic wounds develop as a result of defective regulation in one or more complex cellular and molecular processes involved in proper healing. They impact ...

Two-Dimensional X-Ray Angiography to Examine Fine Vascular Structure Using a Silicone Rubber Injection Compound

Angiography is an essential tool for the study of vascular structures in various research fields. The aim of this study is to introduce a simple angiographic method for examining the fine vascular structure of unfixed, fresh tissue using a silicone rubber injection compound and soft tissue X-ray system. This study is especially focused on flap territories used in reconstructive surgery. This study employs angiography with a silicone rubber injection compound in various experimental conditions using Sprague-Dawley rats. First, 15 mL of MV compound and 15 mL of diluent is mixed. Then, 1.5 mL of the curing agent is prepared, and a 24G catheter is cannulated in the common carotid artery of the rat. A three-way stopcock is then connected to a catheter, and the radiopaque agent, after being mixed with the prepared curing agent, is injected immediately without spillage. Finally, as the agent solidifies, the specimen is harvested, and an angiographic image is obtained using a soft tissue X-ray system. This method indicates that high-quality angiography showing fine vascular structures can be easily and simply obtained within in a short period of time.

This study presents a simple two-dimensional angiographic method to examine fine vascular structures using a silicone rubber injection compound and soft tissue X-ray system.

Silikon Kauçuk enjeksiyon bileşik kullanarak iyi vasküler yapı incelemek için iki boyutlu röntgen anjiyografi

Angiography is an essential tool for the study of vascular structures in various research fields. The aim of this study is to introduce a simple ...

Sleeve Gastrectomy in Mice using Surgical Clips

The number of people who are overweight and obese is continually increasing both in the adult and adolescent populations. This coincides with the increased universal phenomenon of type 2 diabetes (T2D) and other metabolic problems. Bariatric surgery, such as SG, is currently one of the most effective and commonly used long-term treatment for obesity and T2D, but the association between them is not completely explored yet. The mechanisms underlying the outcomes seen after bariatric surgery in humans can be investigated based on preclinical animal studies. The SG reduces body weight, glucose levels and many metabolic parameters, and is easy to perform with a low incidence of complications. The goal of this work is to provide a simple method and an uncomplicated preclinical model of bariatric surgery in animals for researchers.

The prevalence of diabetes and obesity is continuously increasing worldwide. The mechanisms between diabetes, obesity and their associated mortality and co-morbidities need to be further investigated. Here, we present a protocol for sleeve gastrectomy (SG) in animals as an uncomplicated preclinical model of bariatric surgery.

Hipoparatiroid Fare oluşturma iki Teknikleri: Paratiroidektomi GFP Rakorlar ve Difteri-Toksin-Aracılı Paratiroid Ablasyonu kullanma

Özet

Daha Fazla Video Keşfet

Bu videodaki bölümler