Name: in vivo sirna transfection and gene knockdown in spinal cord via rapid noninvasive lumbar intrathecal injections in mice
Uploaded: 2014-03-22T14:00:00.000+00:00
Duration: 5 min 24 s
Description: Watch this Scientific Journal Video about In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice at JoVE.com

Tüm hayvan kullanım prosedürleri yerel yönetim organı (Regierungspräsidium Karlsruhe, Karlsruhe, Almanya) tarafından belirlenen etik kurallara uygun idi. 1.. SiRNA / PEI Kompleksi hazırlanması SiRNA / PEI kompleks çözeltisi aşağıdaki gibi üreticinin talimatlarını kullanarak hazırlanır: <ol><li> Çözelti A: uç hacminin dörtte birine kadar steril su ile siRNA istenilen miktarda (eğer gerekli ise) seyreltin ve son hacminin yarısına% 10 glükoz çözeltisi ile daha da bu seyreltin. Vortex hafifçe yukarı veya aşağı pipetleme karıştırın. SiRNA optimal miktarı deneysel olarak tespit edilmesi gerekmektedir, ancak, hayvan başına 10 ul kompleksi çözeltisi içinde 1 | ig siRNA optimizasyonu için iyi bir başlangıç ​​noktasıdır. </li><li> Çözelti B: uç hacminin dörtte birine kadar steril su ile PEI reaktifinin gerekli hacmi seyreltin ve uç hacminin yarısına% 10 glükoz çözeltisi kadar bu daha fazla seyreltilir. Vortex gently veya aşağı yukarı pipetleme karıştırın. Not: PEI maddesi miktarı, transfeksiyon verimini etkilemektedir kompleks içindeki iyonik denge belirler. Aynı şekilde PEI solüsyonu optimal miktarı deneysel olarak tespit edilmelidir. Bizim ellerde, optimal miktarı 1 mikrogram siRNA&#39;nın başına PEI çözeltisinin 0.12 ul. </li><li> B çözeltisi ile çözüm A karıştırın seferde, vorteks nazikçe. </li><li> Kullanmadan önce, oda sıcaklığında 15 dakika boyunca karıştırılmış çözelti inkübe edin. Bu kompleks, 4 ° C&#39;de, oda sıcaklığında 2 saat boyunca ve 24 saat boyunca stabildir </li></ol> 2. Intratekal Enjeksiyon <ol><li> Bu refleksi hiçbir belirti gösterir kadar,% 3 izofluran ile fare anestezisi. Buna ek olarak, ayrıca anestezi sağlamak için devlet kuyruk ve / veya pençe tutam refleksi kontrol edin. </li><li> Iğne yerleştirilmesi sırasında daha iyi bir görüntü sağlamak için kuyruğun tabanına yakın hayvanın arka ucunda kürk yaklaşık 2 cm 2 tıraş. </li><li> Içinde fare yerleştirinişlem sırasında sürekli bir izofluran uygulanması için bir burun konisi,% 1.5 izofluran azaltmak ve göz yağ ile fare gözleri kapsamaktadır. </li><li> Iğne, bir 30 G 0.5 bağlanmış bir 25 ul Hamilton şırıngası kullanılarak siRNA karışık çözelti, kullanıma hazır hazırlayın. </li><li> En önemli biri ve hafifçe basarak bu alanı çevresinde omurgalı sütun düzeltmek gerekir L6 spinöz süreci bulun. </li><li> Dikkatli L5 ve L6 vertebra yiv arasında iğne yerleştirin ve bu işareti intradural uzayda iğnenin başarılı bir giriş anlaşılacağı gibi bir kuyruk hareketiyle gözleyin. İpucu: tırnağınızı kullanarak, bir de oluk bulmak gerekir. </li><li> Tail flick görülmektedir kez, hemen, ama dikkatle, tek elle iğne konumunu güvenli ve diğer taraftan yavaş yavaş ile maddenin istenilen hacmi enjekte. İpucu: 5-10 arasında bir hacim ul hacim en az 5 olarak optimal &amp;# 181; l güvenilmez ve 10 ul daha büyük bir hacim çok fazla baskı yol açar. </li><li> Enjeksiyonu yapılır sonra, anestezi kurtarmak için kafesine geri fareyi hareket ettirin. </li><li> Hedeflenen genin optimum infekte elde etmek için bu enjeksiyon en az 2 defa daha, her 24 saat tekrarlayın. </li></ol>

<ol>
	<li>Hylden, J. L., Wilcox, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intrathecal+morphine+in+mice:+a+new+technique.">Intrathecal morphine in mice: a new technique.</a> Eur. J. Pharmacol. 67, 313-316 (1980).</li><li>Stokes, J. A., Corr, M., Yaksh, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transient+tactile+allodynia+following+intrathecal+puncture+in+mouse:+contributions+of+Toll-like+receptor+signaling.">Transient tactile allodynia following intrathecal puncture in mouse: contributions of Toll-like receptor signaling.</a> Neurosci. Lett. 504, 215-218 (2011).</li><li>Goula, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyethylenimine-based+intravenous+delivery+of+transgenes+to+mouse+lung.">Polyethylenimine-based intravenous delivery of transgenes to mouse lung.</a> Gene Ther. , 1291-1295 (1998).</li><li>Fairbanks, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spinal+delivery+of+analgesics+in+experimental+models+of+pain+and+analgesia.">Spinal delivery of analgesics in experimental models of pain and analgesia.</a> Adv. Drug. Deliv. Rev. 55, 1007-1041 (2003).</li><li>Hohmann, A. G., Tsou, K., Walker, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cannabinoid+modulation+of+wide+dynamic+range+neurons+in+the+lumbar+dorsal+horn+of+the+rat+by+spinally+administered+WIN55,212-2.">Cannabinoid modulation of wide dynamic range neurons in the lumbar dorsal horn of the rat by spinally administered WIN55,212-2.</a> Neurosci. Lett. 257, 119-122 (1998).</li><li>Song, Z. H., Takemori, A. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Involvement+of+spinal+kappa+opioid+receptors+in+the+antinociception+produced+by+intrathecally+administered+corticotropin-releasing+factor+in+mice.">Involvement of spinal kappa opioid receptors in the antinociception produced by intrathecally administered corticotropin-releasing factor in mice.</a> J. Pharmacol. Exp. Ther. 254, 363-368 (1990).</li><li>Trang, T., Sutak, M., Jhamandas, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Involvement+of+cannabinoid+(CB1)-receptors+in+the+development+and+maintenance+of+opioid+tolerance.">Involvement of cannabinoid (CB1)-receptors in the development and maintenance of opioid tolerance.</a> Neuroscience. , 1275-1288 (2007).</li><li>Yaksh, T. L., Rudy, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chronic+catheterization+of+the+spinal+subarachnoid+space.">Chronic catheterization of the spinal subarachnoid space.</a> Physiol. Behav. 17, 1031-1036 (1976).</li><li>Tappe, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synaptic+scaffolding+protein+Homer1a+protects+against+chronic+inflammatory+pain.">Synaptic scaffolding protein Homer1a protects against chronic inflammatory pain.</a> Nat. Med. , 677-681 (2006).</li><li>Bourinet, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silencing+of+the+Cav3.2+T-type+calcium+channel+gene+in+sensory+neurons+demonstrates+its+major+role+in+nociception.">Silencing of the Cav3.2 T-type calcium channel gene in sensory neurons demonstrates its major role in nociception.</a> EMBO J. 24, 315-324 (2005).</li><li>Wang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+transfer+to+dorsal+root+ganglia+by+intrathecal+injection:+effects+on+regeneration+of+peripheral+nerves.">Gene transfer to dorsal root ganglia by intrathecal injection: effects on regeneration of peripheral nerves.</a> Mol. Ther. 12, 314-320 (2005).</li><li>Wigdor, S., Wilcox, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Central+and+systemic+morphine-induced+antinociception+in+mice:+contribution+of+descending+serotonergic+and+noradrenergic+pathways.">Central and systemic morphine-induced antinociception in mice: contribution of descending serotonergic and noradrenergic pathways.</a> J. Pharmacol. Exp. Ther. 242, 90-95 (1987).</li></ol>

Yazarlar herhangi bir mali çıkarlarını beyan.

Bu nedenle, iğne intratekal enjeksiyonlar yukarıda tarif edilen teknik, etkili, hızlı, spesifik olarak lokalize edilmiş ve geri dönüşlü bir. Teknik olarak, bu prosedür, en kritik yönü oluk içine iğne sokulması noktasıdır. Bu prosedür çok sakin elleri ve sabır ile yapılır önemlidir. Birçok cerrahi işlemler gibi, eğitim başarılı enjeksiyon oranını artırır. Gerçek bir deney sırasında, bu teknik, doğrudan enjeksiyon başarılı olup olmadığını teyit etmek için açık bir göstergesi...

Omurilik işleme ve ağrılı (nosiseptif) girişlerine 4-7 iletim dahil kilit biyolojik süreçler ve fizyolojik fonksiyonları, çeşitli çok önemli bir merkezdir. Çeşitli deneysel teknikler, intratekal kateter 8 kronik implantasyonu, omurilik mikroenjeksiyon ve intratekal enjeksiyon iğne 9 ile omurilik, farmakolojik modülasyonuna kolaylaştırmak için geliştirilmiştir. Her teknik kendine özgü avantajları ve dezavantajları vardır, ve deney paradigma bağlı olarak bir teknik diğerlerine göre daha uygun olabilir. Intratekal kateter kronik implantasyonu sıçanda kolayca mümkün olduğu iken, bu yöntem, boyut kısıtlamaları göz önüne alındığında, fare çok zordur. Başarı oranı çok düşüktür ve motor açıkları nedeniyle sık sık fare ciddi sınırlı subdural alanda bir kateterin büyük varlığı nedeniyle meydana gelir. Ayrıca, ilaçların uzun süreli teslimat nedeniyle sık pıhtılaşma işlenirkronik kateter yerleştirildi. Son olarak, bağışıklık reaksiyonları yaygındır. Bu sorunlar, farelerde omurilik için ilaç ve reaktiflerin hızlı ve anatomik olarak sınırlı uygulama sağlayan bir preimplanted kateter yokluğunda bir iğne vasıtasıyla, akut intratekal enjeksiyon yöntemi kullanılarak atlatılabilir. Bu yöntem, tam olarak böyle spinal düşük dozajları ve sınır yan etkileri izin modülasyonu, hem de maddelerin yok sunmak için yeteneği özgüllük gibi diğer sistemik tatbikat yolları (örneğin, oral, intravenöz, intraperitonal vs) üzerinden teslim intratekal yararlarını muhafaza intratekal enjeksiyon sırasında iğne dura mater ve omurilik arasına sokulur olduğundan, normal olarak kan-beyin bariyerinden geçmezler. Önemli olarak, ancak, intratekal teslimat diğer yöntemlere kıyasla, intratekal enjeksiyon iğne yöntem olup, çok sayıda uygulama sağlayan, en az invazivHerhangi bir ciddi doku hasarına neden veya bağlı yabancı madde implantasyonuna bağışıklık reaksiyonunu çağrıştıran olmadan aynı hayvan. Ancak, bu etkinlik için izin iğnenin çok hassas hedefleme için teknik beceri gerektirir. Burada, özellikle görsel olarak lumbar spinal kordon hedeflenmesi için bir başarı oranı elde etmek için uygun bir yöntem göstermektedir. Bu deneyde seçilmiş enjeksiyonu site L5 ve omurga zarar olasılığını en aza indirmek için, spinal kordon uçları yere yakın L6 omurgalı kolonu arasındaki oluktur. Ayrıca, siRNA&#39;lar kullanarak omurilikte genleri yıkmak için bu tekniğin kullanımını göstermektedir.

<table><tbody><tr><td>&lt;em&gt;In Vivo&lt;/em&gt;-jetPEI</td><td>Polyplus</td><td>201-10G</td><td>&amp;nbsp;</td></tr><tr><td>WAVE1 siRNA</td><td>Santa Cruz</td><td>sc-36832</td><td>&amp;nbsp;</td></tr><tr><td>Control siRNA-A</td><td>Santa Cruz</td><td>sc-37007</td><td>&amp;nbsp;</td></tr><tr><td>Anti-&amp;szlig;-Tubulin III antibody</td><td>Sigma</td><td>T2200</td><td>&amp;nbsp;</td></tr><tr><td>Anti-WAVE1 antibody</td><td>R&amp;amp;D Systems</td><td>AF5514</td><td>&amp;nbsp;</td></tr><tr><td>Fast green dye</td><td>Sigma</td><td>F-7252</td><td>&amp;nbsp;</td></tr><tr><td>Isoflurane</td><td>Baxter</td><td></td><td>&amp;nbsp;</td></tr><tr><td>Isoflurane setup</td><td>Dr&amp;auml;ger L&amp;uuml;beck</td><td></td><td>&amp;nbsp;</td></tr><tr><td>Shaver</td><td>Wella</td><td></td><td>&amp;nbsp;</td></tr><tr><td>Hamilton syringe Gastight 1702</td><td>Hamilton</td><td></td><td>&amp;nbsp;</td></tr><tr><td>30 G 1/2 in 13 mm Needle</td><td>BD Microlance</td><td>304000</td><td>&amp;nbsp;</td></tr><tr><td>Microscope Leica MS5</td><td>Leica</td><td></td><td>&amp;nbsp;</td></tr><tr><td>WAVE1 forward primer for qRT-PCR</td><td>Sigma</td><td></td><td>cacagagcctcaggacagg</td></tr><tr><td>WAVE1 reversed primer for qRT-PCR</td><td>Sigma</td><td></td><td>cttttcaccaacggcatctt</td></tr><tr><td>FastStart Essential DNA Green Master</td><td>Roche</td><td>6402712001</td><td>&amp;nbsp;</td></tr></tbody></table>

in vivo sirna transfection and gene knockdown in spinal cord via rapid noninvasive lumbar intrathecal injections in mice

Bu rapor, non-invaziv bir şekilde akut intratekal iğne enjeksiyon tekniği, kateter implantasyonu yani bağımsız bir adım-adım kılavuz açıklanır. Bu cerrahi tekniğin teknik sınırlama ellerin incelik yatıyor. Enjeksiyon, özellikle eğitimli bir deneyci için, hızlı, ve bu teknikle doku bozulma az olduğundan, tekrarlanan enjeksiyonlar mümkündür; yabancı araçlara ayrıca bağışıklık reaksiyonu (. Örneğin kateter) oluşmaz, böylece daha iyi ve daha spesifik dışarı oku verme spinal kord modülasyon. Maddenin uygulanması büyük ölçüde omurilik hedef bölge ile sınırlı olduğu için, ilaçlar büyük dozlarda uygulanması gerekmez ve diğer dokusu üzerinde istenmeyen etkileri daha da önemlisi, bir sistemik uygulama ile gözlemlendiği üzere, 1 aşılabilir 2. Ayrıca, polyethylenim yardımıyla nükleik asidin in vivo transfeksiyonu ile bu teknik kombineine (PEI) farmakolojik maddelerin teslimi hem de gen, RNA ve protein modülatörleri ile spinal fonksiyonlarını incelemek için büyük bir çok yönlü ve çok reaktif 3.,.

Başarılı bir enjeksiyon örnekle açıklamak için, erişkin C57BL6 farelerde hızlı yeşil boya FCF (yaş, 8-10 haftalık) kullanarak bu tekniği uygulandı. Hayvan boya yayılmış ve daha sonra CO2 bir dozu ile öldürülmüş için yeterli zamanı sağlamak üzere enjeksiyon sonrası birkaç dakika geri bırakıldı. Daha sonra, omurgalı kolon kesitlere ayrılmıştır ve omurilik ortaya çıkmıştır. Dağınık boya karşılık gelen Mavi puncta, enjeksiyon yerinde oldu. Omurilik yaralanma izi yok...

Watch this Scientific Journal Video about In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice at JoVE.com

In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

Bu rapor, kısa süreli hafif anestezi altında fare lumbar spinal kordda siRNA yerelleştirilmiş transfeksiyonu için intratekal iğne giriş basit ve hızlı bir yöntem açıklanır.

Farelerde Hızlı noninvaziv Lomber İntratekal enjeksiyon yoluyla Vivo siRNA&#39;nın Transfaksiyon ve Omurilik Gen demonte olarak

This report describes a step-by-step guide to the technique of acute intrathecal needle injections in a noninvasive manner, i.e. independent of catheter ...

in-vivo-sirna-transfection-gene-knockdown-spinal-cord-via-rapid

Universidad de Cartagena UDEC

Research

JoVE Journal

Biology

In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

46.5K Görüntüleme.  University of Heidelberg.  Bu rapor, kısa süreli hafif anestezi altında fare lumbar spinal kordda siRNA yerelleştirilmiş transfeksiyonu için intratekal iğne giriş basit ve hızlı bir yöntem açıklanır. 

Video: In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

In vivo Imaging of the Mouse Spinal Cord Using Two-photon Microscopy

In vivo imaging using two-photon microscopy 1 in mice that have been genetically engineered to express fluorescent proteins in specific cell types 2-3 has significantly broadened our knowledge of physiological and pathological processes in numerous tissues in vivo 4-7. In studies of the central nervous system (CNS), there has been a broad application of in vivo imaging in the brain, which has produced a plethora of novel and often unexpected findings about the behavior of cells such as neurons, astrocytes, microglia, under physiological or pathological conditions 8-17. However, mostly technical complications have limited the implementation of in vivo imaging in studies of the living mouse spinal cord. In particular, the anatomical proximity of the spinal cord to the lungs and heart generates significant movement artifact that makes imaging the living spinal cord a challenging task.
We developed a novel method that overcomes the inherent limitations of spinal cord imaging by stabilizing the spinal column, reducing respiratory-induced movements and thereby facilitating the use of two-photon microscopy to image the mouse spinal cord in vivo. This is achieved by combining a customized spinal stabilization device with a method of deep anesthesia, resulting in a significant reduction of respiratory-induced movements. This video protocol shows how to expose a small area of the living spinal cord that can be maintained under stable physiological conditions over extended periods of time by keeping tissue injury and bleeding to a minimum. Representative raw images acquired in vivo detail in high resolution the close relationship between microglia and the vasculature. A timelapse sequence shows the dynamic behavior of microglial processes in the living mouse spinal cord. Moreover, a continuous scan of the same z-frame demonstrates the outstanding stability that this method can achieve to generate stacks of images and/or timelapse movies that do not require image alignment post-acquisition. Finally, we show how this method can be used to revisit and reimage the same area of the spinal cord at later timepoints, allowing for longitudinal studies of ongoing physiological or pathological processes in vivo.

In vivo Imaging of the Mouse Spinal Cord Using Two-photon Microscopy

A minimally invasive protocol to stabilize the mouse spinal column and perform repetitive in vivo spinal cord imaging using two-photon microscopy is described. This method combines a spinal stabilization device and an anesthetic regimen to minimize respiratory-induced movements and produce raw imaging data that require no alignment or other post-processing.

Fare Omurilik İki foton Mikroskop kullanarak in vivo Görüntüleme

In vivo imaging using two-photon microscopy 1 in mice that have been genetically engineered to express fluorescent proteins in specific cell types 2-3 has ...

Nörobilim

Stereotaxic Injection of a Viral Vector for Conditional Gene Manipulation in the Mouse Spinal Cord

Intraparenchymal injection of a viral vector enables conditional gene manipulation in distinct populations of neurons or particular regions of the central nervous system. We demonstrate a stereotaxic injection technique that allows targeted gene expression or silencing in the dorsal horn of the mouse spinal cord. The surgical procedure is brief. It requires laminectomy of a single vertebra, providing for quick recovery of the animal and unimpaired motility of the spine. Controlled injection of a small vector suspension volume at low speed and use of a microsyringe with beveled glass cannula minimize the tissue lesion. The local immune response to the vector depends on the intrinsic properties of the virus employed; in our experience, it is minor and short-lived when a recombinant adeno-associated virus is used. A reporter gene such as enhanced green fluorescent protein facilitates monitoring spatial distribution of the vector, and the efficacy and cellular specificity of the transfection.

Viral vectors allow for targeted gene manipulation. We demonstrate a method for conditional gene expression or ablation in the mouse spinal cord, using stereotaxic injection of a viral vector into the dorsal horn, a prominent site of synaptic contact between primary somatosensory afferents and neurons of the central nervous system.

Fare Omurilik Koşullu Gen Manipülasyon için bir Viral Vector Stereotaksik Enjeksiyon

Intraparenchymal injection of a viral vector enables conditional gene manipulation in distinct populations of neurons or particular regions of the central ...

<meta charset="utf8"></head><body>Spinal Kord Gliomu için Verimli ve Hassas Fare Modeli Geliştirme

Surgical Transplantation of Tumor Cells into the Spinal Cord of Mice

Spinal cord gliomas are commonly malignant tumors of the spinal cord, leading to a high rate of disability. However, uniform treatment guidelines and comprehensive data on spinal cord gliomas remain limited due to the lack of suitable preclinical animal models. Developing a simple and reproducible animal model has become essential for advancing basic and translational research. A murine model is ideal, as the murine spinal cord shares structural similarities with the human spinal cord. This protocol describes the generation of a reproducible murine model of spinal cord glioma by directly injecting tumor cells into the intervertebral space using the spinous process of the seventh cervical vertebra as a guide. Compared to other methods, this approach is more effective and convenient, involving a smaller incision, reduced invasiveness and blood loss, faster recovery, and more stable tumor formation. This model is expected to advance the understanding of disease mechanisms, optimize surgical strategies, and support the development of therapeutic drugs for spinal cord gliomas.

<meta charset="utf8"></head><body>Tümör Hücrelerinin Farelerin Omuriliğine Cerrahi Nakli

The present protocol describes the development of a reproducible murine model of spinal cord glioma by injecting tumor cells into the intervertebral space, offering a more effective and less invasive approach for research and therapeutic development.

Tümör Hücrelerinin Farelerin Omuriliğine Cerrahi Nakli

Spinal cord gliomas are commonly malignant tumors of the spinal cord, leading to a high rate of disability. However, uniform treatment guidelines and ...

Kanser Araştırmaları

In Vivo Gene Transfer to Schwann Cells in the Rodent Sciatic Nerve by Electroporation

The formation of the myelin sheath by Schwann cells (SCs) is essential for rapid conduction of nerve impulses along axons in the peripheral nervous system. SC-selective genetic manipulation in living animals is a powerful technique for studying the molecular and cellular mechanisms of SC myelination and demyelination in vivo. While knockout/knockin and transgenic mice are powerful tools for studying SC biology, these methods are costly and time consuming. Viral vector-mediated transgene introduction into the sciatic nerve is a simpler and less laborious method. However, viral methods have limitations, such as toxicity, transgene size constraints, and infectivity restricted to certain developmental stages. Here, we describe a new method that allows selective transfection of myelinating SCs in the rodent sciatic nerve using electroporation. By applying electric pulses to the sciatic nerve at the site of plasmid DNA injection, genes of interest can be easily silenced or overexpressed in SCs in both neonatal and more mature animals. Furthermore, this in vivo electroporation method allows for highly efficient simultaneous expression of multiple transgenes. Our novel technique should enable researchers to efficiently manipulate SC gene expression, and facilitate studies on SC development and function.

In Vivo Gene Transfer to Schwann Cells in the Rodent Sciatic Nerve by Electroporation

Here, we present an in vivo technique for gene transfer to Schwann cells (SCs) in the rodent sciatic nerve. This simple technique is useful for investigating signaling mechanisms involved in the development and maintenance of myelinating SCs.

Elektroporasyon tarafından Kemirgen Siyatik Sinir Schwann Hücreleri için Vivo Gen Transferi

The formation of the myelin sheath by Schwann cells (SCs) is essential for rapid conduction of nerve impulses along axons in the peripheral nervous ...

Adeno-associated Virus-mediated Transgene Expression in Genetically Defined Neurons of the Spinal Cord

Selective manipulation of spinal neuronal subpopulations has mainly been achieved by two different methods: 1) Intersectional genetics, whereby double or triple transgenic mice are generated in order to achieve selective expression of a reporter or effector gene (e.g., from the Rosa26 locus) in the desired spinal population. 2) Intraspinal injection of Cre-dependent recombinant adeno-associated virus (rAAV); here Cre-dependent AAV vectors coding for the reporter or effector gene of choice are injected into the spinal cord of mice expressing Cre recombinase in the desired neuronal subpopulation. This protocol describes how to generate Cre-dependent rAAV vectors and how to transduce neurons in the dorsal horn of the lumbar spinal cord segments L3-L5 with rAAVs. As the lumbar spinal segments L3-L5 are innervated by those peripheral sensory neurons that transmit sensory information from the hindlimbs, spontaneous behavior and responses to sensory tests applied to the hindlimb ipsilateral to the injection side can be analyzed in order to interrogate the function of the manipulated neurons in sensory processing. We provide examples of how this technique can be used to analyze genetically defined subsets of spinal neurons. The main advantages of virus-mediated transgene expression in Cre transgenic mice compared to classical reporter mouse-induced transgene expression are the following: 1) Different Cre-dependent rAAVs encoding various reporter or effector proteins can be injected into a single Cre transgenic line, thus overcoming the need to create several multiple transgenic mouse lines. 2) Intraspinal injection limits manipulation of Cre-expressing cells to the injection site and to the time after injection. The main disadvantages are: 1) Reporter gene expression from rAAVs is more variable. 2) Surgery is required to transduce the spinal neurons of interest. Which of the two methods is more appropriate depends on the neuron population and research question to be addressed.

Intraspinal injection of recombinase dependent recombinant adeno-associated virus (rAAV) can be used to manipulate any genetically labelled cell type in the spinal cord. Here we describe how to transduce neurons in the dorsal horn of the lumbar spinal cord. This technique enables functional interrogation of the manipulated neuron subtype.

Omurilik genetik olarak tanımlanmış nöronlar Adeno ilişkili virüs-aracılı Transgene ifade

Selective manipulation of spinal neuronal subpopulations has mainly been achieved by two different methods: 1) Intersectional genetics, whereby double or ...

Direct Intrathecal Injection of Recombinant Adeno-associated Viruses in Adult Mice

Intrathecal (IT) injection of adeno-associated virus (AAV) has drawn considerable interest in CNS gene therapy by virtue of its safety, noninvasiveness, and excellent transduction efficacy in the CNS.&#160;Previous studies have demonstrated the therapeutic potency of AAV-delivered gene therapy in neurodegenerative disorders by IT administration. However, high rates of unpredictable failure due to the technical limitation of IT administration in small animals have been reported. Here, we established a scoring system to indicate the success extent of lumbar puncture in small animals by adding 1% lidocaine hydrochloride into the injection solution. We further show that the extent of transient weakness following injection can predict the transduction efficiency of AAV. Thus, this IT injection method can be used to optimize therapeutic trials in mouse models of CNS diseases that afflict wide regions of the CNS.

Here we present a direct intrathecal injection technique using 1% lidocaine hydrochloride in a viral solution to ensure efficient adeno-associated virus delivery to small animals and establish a scoring system to predict transduction efficiency in the central nervous system according to the degree of transient weakness induced by lidocaine.

Rekombinant Adeno ilişkili virüs yetişkin farelerde doğrudan intratekal enjeksiyon

Intrathecal (IT) injection of adeno-associated virus (AAV) has drawn considerable interest in CNS gene therapy by virtue of its safety, noninvasiveness, ...

Direct Injection of a Lentiviral Vector Highlights Multiple Motor Pathways in the Rat Spinal Cord

Introducing proteins of interest into cells in the nervous system is challenging due to innate biological barriers that limit access to most molecules. Injection directly into spinal cord tissue bypasses these barriers, providing access to cell bodies or synapses where molecules can be incorporated. Combining viral vector technology with this method allows for introduction of target genes into nervous tissue for the purpose of gene therapy or tract tracing. Here a virus engineered for highly efficient retrograde transport (HiRet) is introduced at the synapses of propriospinal interneurons (PNs) to encourage specific transport to neurons in the spinal cord and brainstem nuclei. Targeting PNs takes advantage of the numerous connections they receive from motor pathways such as the rubrospinal and reticulospinal tracts, as well as their interconnection with each other throughout spinal cord segments. Representative tracing using the HiRet vector with constitutively active green fluorescent protein (GFP) shows high fidelity details of cell bodies, axons and dendritic arbors in thoracic PNs and in reticulospinal neurons in the pontine reticular formation. HiRet incorporates well into brainstem pathways and PNs but shows age dependent integration into corticospinal tract neurons. In summary, spinal cord injection using viral vectors is a suitable method for introduction of proteins of interest into neurons of targeted tracts.

This protocol demonstrates injection of a retrogradely transportable viral vector into rat spinal cord tissue. The vector is taken up at the synapse and transported to the cell body of target neurons. This model is suitable for retrograde tracing of important spinal pathways or targeting cells for gene therapy applications.

Birden fazla Motor yolları sıçan Spinal Kord Lentiviral bir vektör direkt enjeksiyon vurgulamaktadır

Introducing proteins of interest into cells in the nervous system is challenging due to innate biological barriers that limit access to most molecules. ...

Intrathecal Delivery of Antisense Oligonucleotides in the Rat Central Nervous System

The blood brain barrier (BBB) is an important defense against the entrance of potentially toxic or pathogenic agents from the blood into the central nervous system (CNS). However, its existence also dramatically lowers the accessibility of systemically administered therapeutic agents to the CNS. One method to overcome this, is to inject those agents directly into the cerebrospinal fluid (CSF), thus bypassing the BBB. This can be done via implantation of a catheter for either continuous infusion using an osmotic pump, or for single bolus delivery. In this article, we describe a surgical protocol for delivery of CNS-targeting antisense oligonucleotides (ASOs) via a catheter implanted directly into the cauda equina space of the adult rat spine. As representative results, we show the efficacy of a single bolus ASO intrathecal (IT) injection via this catheterization system in knocking down the target RNA in different regions of the rat CNS. The procedure is safe, effective and does not require expensive equipment or surgical tools. The technique described here can be adapted to deliver drugs in other modalities as well.

Here, we describe a method for delivering drugs to the rat central nervous system by implanting a catheter into the lumbar intrathecal space of the spine. We focus on the delivery of antisense oligonucleotides, though this method is suitable for delivery of other therapeutic modalities as well.

Sıçan Merkezi Sinir Sisteminde Antisense Oligonükleotidlerin İntinal Teslimi

The blood brain barrier (BBB) is an important defense against the entrance of potentially toxic or pathogenic agents from the blood into the central ...

Farelerde Hızlı noninvaziv Lomber İntratekal enjeksiyon yoluyla Vivo siRNA'nın Transfaksiyon ve Omurilik Gen demonte olarak

Özet

Daha Fazla Video Keşfet

Bu videodaki bölümler

Fare Omurilik İki foton Mikroskop kullanarak in vivo Görüntüleme

Fare Omurilik Koşullu Gen Manipülasyon için bir Viral Vector Stereotaksik Enjeksiyon

Tümör Hücrelerinin Farelerin Omuriliğine Cerrahi Nakli

Tümör Hücrelerinin Farelerin Omuriliğine Cerrahi Nakli

Tümör Hücrelerinin Farelerin Omuriliğine Cerrahi Nakli

Elektroporasyon tarafından Kemirgen Siyatik Sinir Schwann Hücreleri için Vivo Gen Transferi

Omurilik genetik olarak tanımlanmış nöronlar Adeno ilişkili virüs-aracılı Transgene ifade

Rekombinant Adeno ilişkili virüs yetişkin farelerde doğrudan intratekal enjeksiyon

Birden fazla Motor yolları sıçan Spinal Kord Lentiviral bir vektör direkt enjeksiyon vurgulamaktadır

Sıçan Merkezi Sinir Sisteminde Antisense Oligonükleotidlerin İntinal Teslimi