Name: biochemical assays for analyzing activities of atp-dependent chromatin remodeling enzymes
Uploaded: 2014-10-25T14:00:00.000+00:00
Duration: 10 min 14 s
Description: Watch this Scientific Journal Video about Biochemical Assays for Analyzing Activities of ATP-dependent Chromatin Remodeling Enzymes at JoVE.com

Work in the authors' laboratory is supported by a grant from the National Institute of General Medical Sciences (GM41628) and by a grant to the Stowers Institute for Medical Research from the Helen Nelson Medical Research Fund at the Greater Kansas City Community Foundation.

1. ATP-dependentes nucleossoma Remodelação Ensaios Para medir as actividades de ATP-dependente nucleossoma remodelação, imunopurificada INO80 ou subcomplexos INO80 são incubados com ATP e um substrato mononucleosomal, que contém um único nucleossoma posicionado numa extremidade de um fragmento de ADN de 216 pb, 32 P-marcado. Os produtos da reacção são então sujeitos a electroforese em géis de poli-acrilamida nativo. <ol><li> Para gerar o, &#39;601&#39; fragmento de ADN marcado com 32 P, a partir de amplificar pGEM-3Z-4 601 um fragmento de ADN de 216 pb que contém uma sequência de 601 posicionamento nucleossoma posicionada-final, utilizando os oligonucleótidos 5&#39;-ACAGGATGTATATATCTGACACGTGCCTGG e 5&#39;-como AATACTCAAGCTTGGATGCCTGCAG frente e verso, primers. <ol><li> Defina-se uma reacção de PCR de 100 ul, tal como descrito na Tabela 1. </li><li> Realizar as reacções de PCR num termociclador utilizando o seguinte programa: 1 min a 96 ° C, followed por 45 seg a 94 ° C, 30 seg a 57 ° C, 60 segundos a 72 ° C durante 30 ciclos; terminando com 7 min a 72 ° C. </li><li> Após a reacção de PCR é terminado, remover os nucleótidos não incorporados fazendo passar os produtos de reacção duas vezes através de colunas de giro livre de nuclease. </li><li> Executar 5 ul do produto de PCR purificado em gel de agarose a 1,2% para confirmar que a reacção de PCR gerado a ~ 216 pb Fragmento de ADN desejado. </li><li> Dilui-se 5 ul do produto de PCR purificado de 20 vezes, e medir a concentração de ADN, utilizando um espectrofotómetro de UV. O rendimento médio é de aproximadamente 40 ng / mL. </li><li> Medir a radioactividade de 1 ul do produto de PCR purificado em um contador de cintilação. Estimar a eficiência de marcação pelo cálculo do cpm / ng. A reacção de marcação bem sucedida é esperado para produzir ~ 15,000 cpm / ng de fragmento de ADN 601. </li></ol></li><li> Transferir nucleossomas células HeLa na rotulada 601 DNA utilizando um método de diluição em série 5. <ol><li> Misture 2 pmol de32 601 fragmento de ADN marcado com P com 6 ug de nucleossomas Hela (preparado tal como descrito 5) em 50 ul de um tampão contendo 1,0 M de NaCl, 10 mM Tris-HCl, pH 8,0, EDTA 1 mM, PMSF 0,1 mM e 1 mM TDT e incubar a 30 ° C durante 30 min. </li><li> Sequencialmente diluir a mistura a 0,8 M, 0,6 M e 0,4 M de NaCl por diluição com 12,5 mL, 20,8 mL, e 41,6 ul, respectivamente, de 10 mM Tris-HCl (pH 8,0), EDTA 1 mM, PMSF 0,1 mM, e 1 mM de DTT, com uma incubação de 30 min a 30 ° C depois de cada diluição. </li><li> Diluir a mistura de 0,2 M e, em seguida, para NaCl 0,1 M por adição de 125 mL e, em seguida, 250 ul do mesmo tampão contendo 0,1% de Nonidet P-40, 20% de glicerol, e 200 ug / ml BSA, com uma incubação de 30 min a 30 ° C entre as duas diluições finais. Armazenar o substrato mononucleosome a 4 ° C durante até 3 meses. </li></ol></li><li> Realizar as reacções de nucleossomas deslizante dependentes de ATP num volume total de 10 ul. A reaction componentes estão listados na Tabela 2. vez que a concentração de NaCl para a actividade óptima remodelação nucleossoma INO80 ~ é NaCl 50 mM (resultados não publicados), ajustar a concentração total de cada reacção em NaCl a 50 mM, tendo em conta a quantidade de NaCl contido nas preparações de nucleossomas e enzima. <ol><li> Antes de começar a configurar os ensaios, lança gel de poli-acrilamida nativas (18 x 16 cm). Para preparar um único gel contendo 5% de acrilamida (acrilamida: bisacrilamida a 37,5: 1), TBE 0,5 x (45 mM Tris borato, 1 mM EDTA), 0,01% de persulfato de amónio (APS), e 0,001% de N, N, N &#39;, N&#39;-tetrametiletilenodiamina (TEMED), mistura dos ingredientes listados na Tabela 3. Permitir que o gel de polimerizar durante pelo menos 2 horas à temperatura ambiente. </li><li> Entretanto, para cada reacção a ser realizada, combinar num tubo siliconizado microcentrífuga de 1,5 ml pré-arrefecido ~ 20 nM ou INO80 INO80 subcomplexo (preparado como descrito 3) com uma quantidade de tampão EB100 ( <strong&gt; Tabela 4) suficiente para dar um volume de 4,75 mL. Imediatamente re-congelar qualquer restantes fracções contendo INO80 em gelo seco em pó ou em azoto líquido. </li><li> Defina-se um cocktail mestre com o resto dos ingredientes, ampliação de um factor de &#39;X&#39; (em que X = número total de reacções 3). A quantidade de cada ingrediente necessário para uma única reacção de 10 uL é listada na Tabela 5; a receita deve ser dimensionado de acordo com o número de reacções a serem realizadas. Misture bem, tocando o tubo ou pipetando para cima e para baixo com um Pipetman e girar o tubo por alguns segundos em uma microcentrífuga de bancada. </li><li> Dispensar 5,25 ul do cocktail de mestre para cada um dos tubos de reacção estabelecidas no passo 1.3.2. Misture bem pipetando para cima e para baixo. Iniciar as reacções através da transferência de tubos de reacção para um banho de 30 ° C de calor bloco ou água e incubar durante 2 horas. </li><li> Enquanto isso, a preparar »removendo mistura &#39;cocktail contendo ADN competidore nucleossomos, ampliação por um fator de X (X = número total de reações + 4). A quantidade de cada ingrediente necessário para a preparação de 1,5 ul da mistura para remoção de uma única reacção está listado na Tabela 6; a receita deve ser aumentado de acordo com o número de ensaios a serem realizados. </li><li> Terminar reações adicionando 1,5 mL da mistura de remover. Misture bem, girar para baixo, e incuba-se a 30 ° C durante mais 30 min. </li><li> Enquanto isso, a pré-rodar o gel de poliacrilamida nativa, em uma unidade de electroforese vertical, a 100 V durante 30 min a 4 ° C, usando TBE 0,5 x como tampão de corrida com uma barra de agitação magnética no interior da câmara inferior para manter a circulação tampão constante. </li><li> Para carregar a amostra, adicionar 2,5 l de corante de carga contendo TBE 3x, 30% de glicerol, 0,25% azul de bromofenol e 0,25% xileno cianol FF. Misture bem, girar rapidamente as amostras, e carregar no gel usando dicas de carregamento. </li><li> Submeter o gel a 200 V durante 4,5 horas a 4 ° C com tampão de circulação.</li><li> Para detectar o sinal, a transferência do gel para uma pilha de duas folhas de papel de filtro. Envolver o papel de filtro com o gel no topo usando plástico transparente, e, em seguida, expô-la a um ecrã de fósforo de armazenamento a 4 ° C durante o tempo desejado. </li><li> Digitalize o ecrã com um sistema de scanner de imagens isótopo e analisar os dados utilizando software apropriado. </li></ol></li></ol> 2. Mononucleosome Ensaios de Ligação Para ensaiar a afinidade de ligação de um dado complexo INO80 para mononucleosomes, realizar um deslocamento Electrophoretic Mobility Assay (EMSA), utilizando o substrato mononucleosomal gerado no passo 1.2. <ol><li> Configure a reação Misturas para ensaios de ligação, tal como descrito para os ensaios de remodelação nucleossomos, mas omitir o ATP e remover mix das reações; incubar a 30 ° C durante 30 min. </li><li> Adicionar 2,5 uL de corante de carga de cada uma das misturas de reacção, e aplicam-se a um gel de poliacrilamida nativa, contendo 3,5% de acrilamida (acrilamida: bis 37,5: 1), 1% de glicerol, TBE 0,5 x, 0,01% APS, 0,001% e TEMED. </li><li> Usando 0,5 x TBE como tampão de corrida, correr o gel a 200 V durante 2,5 horas a 4 ° C com tampão de circulação e expor a um ecrã de fósforo de armazenamento. </li></ol> 3. ADN e Nucleosome-ATPase Os ensaios dependentes Realizar ensaios ATPase em misturas de reacção contendo 5 ul de 20 mM Tris-HCl (pH 7,5), 60 mM de NaCl, 6,6 mM de MgCl2, 0,8 mM EDTA, 0,015% de Nonidet P-40, 2,5% de glicerol, 0,1 mg / ml de BSA, 1 DTT, 0,1 mM de PMSF, 2 mM ATP, 2 uCi de [α- 32 P] ATP (3000 Ci / mmol). Para cada complexo INO80 ou quantidade de complexo a ser ensaiada INO80 criou três reacções paralelas, uma contendo tampão EB100 para medir DNA- ou nucleossoma-ATPase independente, contendo um DNA de plasmídeo circular fechado (5000 pb, ~ 30 nM) para medir DNA- ATPase dependente, e outro contendo Hela oligonucleosomes (~ 185 nm) para medir nucleosome-ATPase dependente. Configure todas as reações no gelo. <ol&gt; <li> Para cada reacção, combinar 10-50 nM dos INO80 ou INO80 subcomplexos imunopurificados com uma quantidade de tampão EB100 suficiente para dar um volume de 2,2 mL em 1,5 mL lubrificados microtubos previamente arrefecidos. Imediatamente re-congelar quaisquer fracções contendo INO80 em gelo seco em pó ou em azoto líquido. </li><li> Configurar um cocktail mestre. A quantidade de cada ingrediente necessário para uma única reacção é apresentado na Tabela 7. Scale-se a receita por ampliação de um factor de 3 (X + 2) 1, em que X = número de preparações INO80 a ser ensaiada. </li><li> Para preparar contendo tampão &#39;sub-cocktails&#39; só, DNA, ou nucleossomos, dispensar 2.5 (X + 2) ul do cocktail mestre em três tubos separados. Adicionar 0,3 (X +2) ul de qualquer EB100, o DNA de plasmídeo circular fechado (1,5 ug / uL), ou Hela oligonucleosomes (1,5 ug / uL) e misturar bem. </li><li> Dispensar 2,8 ul da sub-coquetel adequado para os tubos de reacção contendo enzimas criados em rep 3.1. Pipeta suavemente para cima e para baixo para misturar; evitar a introdução de bolhas. </li><li> Para iniciar reações, transfira os tubos de reacção a um bloco de 30 ° C de calor. </li><li> Depois de 5, 15, 30, e 60 min de incubação, a mancha de 0,5 ul de cada mistura de reacção sobre uma cromatografia em camada fina de celulose polietilenoimina (CCF) da placa (20 x 10 cm) de uma linha recta, pelo menos, 1,5 cm a partir da extremidade inferior . Retornar imediatamente tubos de reação ao bloco C calor de 30 ° para múltiplos pontos temporais podem ser tomadas a partir de um único tubo. Depois de manchas, seque as placas de TLC usando um secador de cabelo. </li><li> Transferir as placas de TLC de uma câmara de vidro contendo o suficiente fosfato de potássio 0,375 M (pH 3,5) para permitir que o fundo de 0,5 cm da placa de TLC a ser submergido na solução. </li><li> Cobrir a câmara, e se desenvolvem até a frente da fase de líquido atinge o topo das placas de TLC. Immediate secar os pratos, cuidadosamente, com um secador de cabelo. </li><li> Expor as placas de TLC secas para uma tela de fósforo de armazenamento à temperatura ambiente.Digitalize o ecrã com um sistema de scanner de imagens isótopo e determinar a quantidade de substrato ATP radioativo e produtos ADP. </li><li> Para calcular a quantidade de ATP hidrolisado, multiplicar o ATP% hidrolisado por a quantidade de ATP presente na mistura da reacção de partida com a seguinte fórmula: pmol de ATP hidrolisado = 10 pmol de ATP na reacção de partida x [ADP / ATP (+ ADP)] </li></ol>

<ol>
	<li>Clapier, C. R., Cairns, B. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+biology+of+chromatin+remodeling+complexes.">The biology of chromatin remodeling complexes.</a> Annual Review of Biochemistry. 78, 273-304 (2009).</li><li>Narlikar, G. J., Sundaramoorthy, R., Owen-Hughes, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+and+functions+of+ATP-dependent+chromatin-remodeling+enzymes.">Mechanisms and functions of ATP-dependent chromatin-remodeling enzymes.</a> Cell. 154 (3), 490-503 (2013).</li><li>Chen, L., Ooi, S. K., Conaway, J. W., Conaway, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+and+purification+of+human+INO80+chromatin+remodeling+complexes+and+subcomplexes.">Generation and purification of human INO80 chromatin remodeling complexes and subcomplexes.</a> , (2013).</li><li>Lowary, P. T., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+DNA+sequence+rules+for+high+affinity+binding+to+histone+octamer+and+sequence-directed+nucleosome+positioning.">New DNA sequence rules for high affinity binding to histone octamer and sequence-directed nucleosome positioning.</a> J. Mol. Biol. 276 (1), (1006).</li><li>Owen-Hughes, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+nucleosome+disruption+by+ATP-driven+chromatin+remodeling+complexes.">Analysis of nucleosome disruption by ATP-driven chromatin remodeling complexes.</a> Methods Mol. Biol. 119, 319-331 (1999).</li><li>Udugama, M., Sabri, A., Bartholomew, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+INO80+ATP-dependent+chromatin+remodeling+complex+is+a+nucleosome+spacing+factor.">The INO80 ATP-dependent chromatin remodeling complex is a nucleosome spacing factor.</a> Mol. Cell Biol. 31 (4), 662-673 (2011).</li><li>Jin, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+mammalian+chromatin+remodeling+complex+with+similarities+to+the+yeast+INO80+complex.">A mammalian chromatin remodeling complex with similarities to the yeast INO80 complex.</a> Journal of Biological Chemistry. 280 (50), 41207-41212 (1074).</li><li>Chen, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Subunit+organization+of+the+human+INO80+chromatin+remodeling+complex:+an+evolutionarily+conserved+core+complex+catalyzes+ATP-dependent+nucleosome+remodeling.">Subunit organization of the human INO80 chromatin remodeling complex: an evolutionarily conserved core complex catalyzes ATP-dependent nucleosome remodeling.</a> Journal of Biological Chemistry. 286 (13), 11283-11289 (2011).</li><li>Hamiche, A., Sandaltzopoulos, R., Gdula, D. A., Wu, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ATP-dependent+histone+octamer+sliding+mediated+by+the+chromatin+remodeling+complex+NURF.">ATP-dependent histone octamer sliding mediated by the chromatin remodeling complex NURF.</a> Cell. 97 (7), 833-842 (1999).</li><li>Polach, K. J., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Restriction+enzymes+as+probes+of+nucleosome+stability+and+dynamics.">Restriction enzymes as probes of nucleosome stability and dynamics.</a> Methods Enzymol. 304, 278-298 (1999).</li><li>Anderson, J. D., Thastrom, A., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneous+access+of+proteins+to+buried+nucleosomal+DNA+target+sites+occurs+via+a+mechanism+that+is+distinct+from+nucleosome+translocation,+Mol.Cell+Biol.">Spontaneous access of proteins to buried nucleosomal DNA target sites occurs via a mechanism that is distinct from nucleosome translocation, Mol.Cell Biol.</a> 22 (20), 7147-7157 (2002).</li><li>Saha, A., Wittmeyer, J., Cairns, B. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+remodeling+through+directional+DNA+translocation+from+an+internal+nucleosomal+site.">Chromatin remodeling through directional DNA translocation from an internal nucleosomal site.</a> Nature Structural and Molecular Biology. 12 (9), 747-755 (2005).</li><li>Gottschalk, A. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Poly(ADP-ribosyl)ation+directs+recruitment+and+activation+of+an+ATP-dependent+chromatin+remodeler,+Proc.Natl.Acad.Sci.U.S.A.">Poly(ADP-ribosyl)ation directs recruitment and activation of an ATP-dependent chromatin remodeler, Proc.Natl.Acad.Sci.U.S.A.</a> 106 (33), 13770-13774 (2009).</li><li>Clapier, C. R., Cairns, B. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+ISWI+involves+inhibitory+modules+antagonized+by+nucleosomal+epitopes.">Regulation of ISWI involves inhibitory modules antagonized by nucleosomal epitopes.</a> Nature. 492 (7428), 280-284 (2012).</li><li>Brune, M., Hunter, J. L., Corrie, J. E. T., Direct Webb, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-Time+Measurement+of+Rapid+Inorganic+Phosphate+Release+Using+a+Novel+Fluorescent+Probe+and+Its+Application+to+Actomyosin+Subfragment+1+ATPase,+Biochemistry.">Real-Time Measurement of Rapid Inorganic Phosphate Release Using a Novel Fluorescent Probe and Its Application to Actomyosin Subfragment 1 ATPase, Biochemistry.</a> 33 (27), 8262-8271 (1994).</li><li>Luk, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stepwise+histone+replacement+by+SWR1+requires+dual+activation+with+histone+H2A.Z+and+canonical+nucleosome.">Stepwise histone replacement by SWR1 requires dual activation with histone H2A.Z and canonical nucleosome.</a> Cell. 143 (5), 725-736 (2010).</li></ol>

The authors declare that they have no competing financial interests.

Para garantir que a remodelação nucleosome e atividades ATPase observamos em ensaios dependem da atividade catalítica de complexos INO80, e não sobre a contaminação de remodelação e / ou enzimas ATPase, nós nucleosome rotineiramente ensaio remodelação e atividade ATPase de versões cataliticamente inativos de complexos INO80, purificado em paralelo com o tipo selvagem INO80 utilizando o mesmo procedimento. Uma reacção de controlo negativo a que falta o ATP também deve ser realizada quando se examina a acti...

SnF2 complexos de remodelação da cromatina família incluem um SnF2-como centro ATPase subunidade 1,2. Alguns ATPases função SnF2-como enzimas individuais de subunidade, enquanto que outros funcionam como a subunidade catalítica de grandes complexos de multi-subunidades. Elucidar os mecanismos moleculares pelos quais cada uma das subunidades da cromatina complexos de remodelação contribuir para as suas actividades requer a capacidade de realizar ensaios bioquímicos que dissecam o processo de remodelação. ATP-dependente remodelação nucleossoma pelo complexo INO80 humano e outras enzimas remodelação da cromatina pode ser concebido como um processo multi-etapas que começa com a ligação da enzima à remodelação nucleossomas, seguido por activação do seu ADN e / ou nucleossoma-ATPase dependente, translocação da enzima na remodelação ADN nucleossomal, e eventual reposicionamento de nucleossomas 1,2. Compreender os detalhes moleculares do dependente de ATP processo de remodelação da cromatina requires dissecção da reacção remodelação nos seus passos individuais e definição das contribuições das subunidades individuais do complexo de remodelação da cromatina para cada passo da reacção. Tais análises exigem a capacidade de analisar remodelação nucleosome e outras atividades utilizando substratos moleculares definidos in vitro. Em um protocolo JOVE anterior, descrevemos os procedimentos utilizados para gerar complexos de remodelação da cromatina INO80 e subcomplexos com composições de subunidades definidas 3. Aqui, apresentamos três ensaios bioquímicos que permitem a análise quantitativa da ligação, DNA- e nucleosome ativado ATPase, e as atividades de remodelação nucleossomos associados com tais complexos nucleosome.

<table><tbody><tr><td>Protease Inhibitor Cocktail</td><td>Sigma</td><td>P8340</td><td></td></tr><tr><td>10x PCR reaction buffer&amp;nbsp;</td><td>Roche Applied Science&amp;nbsp;</td><td>11435094001</td><td></td></tr><tr><td>Roche Taq DNA Polymerase</td><td>Roche Applied Science&amp;nbsp;</td><td>11435094001</td><td></td></tr><tr><td>NucAway Nuclease-free Spin Columns&amp;nbsp;</td><td>Ambion</td><td>Cat. # AM10070</td><td></td></tr><tr><td>ultrapure ATP&amp;nbsp;</td><td>USB/Affymetrix</td><td>77241 25 UM</td><td></td></tr><tr><td>bovine serum albumin&amp;nbsp;</td><td>Sigma</td><td>A9418&amp;nbsp;</td><td></td></tr><tr><td>40% Acrylamide/Bis 37.5:1</td><td>Amresco</td><td>0254-500ML</td><td></td></tr><tr><td>Sonicated salmon sperm DNAs&amp;nbsp;</td><td>GE Healthcare</td><td>27-4565-01</td><td></td></tr><tr><td>10% ammonium persulfate (APS)</td><td>Thermo Scientific</td><td>17874</td><td></td></tr><tr><td>benzonase&amp;nbsp;</td><td>Novagen</td><td>Cat. No. 70664</td><td></td></tr><tr><td>dCTP, [&amp;alpha;-&lt;sup&gt;32&lt;/sup&gt;P]- 6,000 Ci/mmol</td><td>PerkinElmer</td><td>BLU013Z250UC</td><td></td></tr><tr><td>PCR thermal cycler PTC 200</td><td>MJ Research</td><td>PTC 200</td><td></td></tr><tr><td>Hoefer vertical electrophoresis unit</td><td>Hoefer</td><td>SE600X-15-1.5</td><td></td></tr><tr><td>lubricated 1.5 ml microcentrifuge tubes&amp;nbsp;</td><td>Costar</td><td>3207</td><td></td></tr><tr><td>Storage Phosphor Screen&amp;nbsp;</td><td>Molecular Dynamics</td><td>63-0034-79</td><td></td></tr><tr><td>3MM filter paper</td><td>Whatman&amp;nbsp;</td><td>28458-005</td><td>VWR</td></tr><tr><td>Typhoon PhosphorImager&amp;nbsp;</td><td>GE Healthcare</td><td>8600</td><td></td></tr><tr><td>ImageQuant software</td><td>GE Healthcare</td><td>ver2003.02</td><td></td></tr><tr><td>TLC Glass Plates, PEI-Cellulose F</td><td>Millipore</td><td>5725-7</td><td></td></tr><tr><td>Immobilon-FL Transfer Membrane 7 x 8.4</td><td>Millipore</td><td>IPFL07810</td><td></td></tr><tr><td>General purpose survey meter with end-window or pancake GM (Geiger-Mueller) probe</td><td>Biodex</td><td>Model 14C</td><td></td></tr></tbody></table>

biochemical assays for analyzing activities of atp-dependent chromatin remodeling enzymes

Members of the SNF2 family of ATPases often function as components of multi-subunit chromatin remodeling complexes that regulate nucleosome dynamics and DNA accessibility by catalyzing ATP-dependent nucleosome remodeling. Biochemically dissecting the contributions of individual subunits of such complexes to the multi-step ATP-dependent chromatin remodeling reaction requires the use of assays that monitor the production of reaction products and measure the formation of reaction intermediates. This JOVE protocol describes assays that allow one to measure the biochemical activities of chromatin remodeling complexes or subcomplexes containing various combinations of subunits. Chromatin remodeling is measured using an ATP-dependent nucleosome sliding assay, which monitors the movement of a nucleosome on a DNA molecule using an electrophoretic mobility shift assay (EMSA)-based method. Nucleosome binding activity is measured by monitoring the formation of remodeling complex-bound mononucleosomes using a similar EMSA-based method, and DNA- or nucleosome-dependent ATPase activity is assayed using thin layer chromatography (TLC) to measure the rate of conversion of ATP to ADP and phosphate in the presence of either DNA or nucleosomes. Using these assays, one can examine the functions of subunits of a chromatin remodeling complex by comparing the activities of the complete complex to those lacking one or more subunits. The human INO80 chromatin remodeling complex is used as an example; however, the methods described here can be adapted to the study of other chromatin remodeling complexes.

As figuras mostram os resultados representativos de testes bioquímicos usados ​​para caracterizar as actividades, incluindo INO80 nucleossoma deslizante (Figura 1) e de ligação (Figura 2) e DNA- ensaios ou ensaios de ATPase dependente de nucleossoma (Figura 3). A experiência apresentada na Figura 1 compara a capacidade dos complexos INO80 intactas purificado através de FLAG-Ies2 ou FLAG-INO80E e de INO80 subcomplexo...

Watch this Scientific Journal Video about Biochemical Assays for Analyzing Activities of ATP-dependent Chromatin Remodeling Enzymes at JoVE.com

Biochemical Assays for Analyzing Activities of ATP-dependent Chromatin Remodeling Enzymes

Here we describe biochemical assays that can be used to characterize ATP-dependent chromatin remodeling enzymes for their abilities to 1) catalyze ATP-dependent nucleosome sliding, 2) engage with nucleosome substrates, and 3) hydrolyze ATP in a nucleosome- or DNA-dependent manner.

Os ensaios bioquímicos para analisar as actividades de ATP-dependente cromatina remodelação Enzimas

Members of the SNF2 family of ATPases often function as components of multi-subunit chromatin remodeling complexes that regulate nucleosome dynamics and ...

biochemical-assays-for-analyzing-activities-atp-dependent-chromatin

Universidad de Cartagena UDEC

Research

JoVE Journal

Biology

14.8K visualizações.  Stowers Institute for Medical Research. Here we describe biochemical assays that can be used to characterize ATP-dependent chromatin remodeling enzymes for their abilities to 1) catalyze ATP-dependent nucleosome sliding, 2) engage with nucleosome substrates, and 3) hydrolyze ATP in a nucleosome- or DNA-dependent manner.

Vídeo: Biochemical Assays for Analyzing Activities of ATP-dependent Chromatin Remodeling Enzymes

Sequential Salt Extractions for the Analysis of Bulk Chromatin Binding Properties of Chromatin Modifying Complexes

Elucidation of the binding properties of chromatin-targeting proteins can be very challenging due to the complex nature of chromatin and the heterogeneous nature of most mammalian chromatin-modifying complexes. In order to overcome these hurdles, we have adapted a sequential salt extraction (SSE) assay for evaluating the relative binding affinities of chromatin-bound complexes. This easy and straightforward assay can be used by non-experts to evaluate the relative difference in binding affinity of two related complexes, the changes in affinity of a complex when a subunit is lost or an individual domain is inactivated, and the change in binding affinity after alterations to the chromatin landscape. By sequentially re-suspending bulk chromatin in increasing amounts of salt, we are able to profile the elution of a particular protein from chromatin. Using these profiles, we are able to determine how alterations in a chromatin-modifying complex or alterations to the chromatin environment affect binding interactions. Coupling SSE with other in vitro and in vivo assays, we can determine the roles of individual domains and proteins on the functionality of a complex in a variety of chromatin environments.

Sequential salt extraction of chromatin bound proteins is a useful tool for determining the binding properties of large protein complexes. This method can be employed to evaluate the role of individual subunits or domains in the overall affinity of a protein complex to bulk chromatin.

Extrações de sal sequenciais para a análise da cromatina em massa vincular propriedades de cromatina modificando complexos

Elucidation of the binding properties of chromatin-targeting proteins can be very challenging due to the complex nature of chromatin and the heterogeneous ...

Genética

Real-time Analysis of Transcription Factor Binding, Transcription, Translation, and Turnover to Display Global Events During Cellular Activation

Upon activation, cells rapidly change their functional programs and, thereby, their gene expression profile. Massive changes in gene expression occur, for example, during cellular differentiation, morphogenesis, and functional stimulation (such as activation of immune cells), or after exposure to drugs and other factors from the local environment. Depending on the stimulus and cell type, these changes occur rapidly and at any possible level of gene regulation. Displaying all molecular processes of a responding cell to a certain type of stimulus/drug is one of the hardest tasks in molecular biology. Here, we describe a protocol that enables the simultaneous analysis of multiple layers of gene regulation. We compare, in particular, transcription factor binding (Chromatin-immunoprecipitation-sequencing (ChIP-seq)), de novo transcription (4-thiouridine-sequencing (4sU-seq)), mRNA processing, and turnover as well as translation (ribosome profiling). By combining these methods, it is possible to display a detailed and genome-wide course of action.
Sequencing newly transcribed RNA is especially recommended when analyzing rapidly adapting or changing systems, since this depicts the transcriptional activity of all genes during the time of 4sU exposure (irrespective of whether they are up- or downregulated). The combinatorial use of total RNA-seq and ribosome profiling additionally allows the calculation of RNA turnover and translation rates. Bioinformatic analysis of high-throughput sequencing results allows for many means for analysis and interpretation of the data. The generated data also enables tracking co-transcriptional and alternative splicing, just to mention a few possible outcomes.
The combined approach described here can be applied for different model organisms or cell types, including primary cells. Furthermore, we provide detailed protocols for each method used, including quality controls, and discuss potential problems and pitfalls.

This protocol describes the combinatorial use of ChIP-seq, 4sU-seq, total RNA-seq, and ribosome profiling for cell lines and primary cells. It enables tracking changes in transcription-factor binding, de novo transcription, RNA processing, turnover and translation over time, and displaying the overall course of events in activated and/or rapidly changing cells.

Análise em tempo real do fator de transcrição, ligação, transcrição, tradução e volume de negócios para exibir eventos globais durante a ativação celular

Upon activation, cells rapidly change their functional programs and, thereby, their gene expression profile. Massive changes in gene expression occur, for ...

In Vitro Ubiquitination and Deubiquitination Assays of Nucleosomal Histones

Ubiquitination is a post-translational modification that plays important roles in various signaling pathways and is notably involved in the coordination of chromatin function and DNA-associated processes. This modification involves a sequential action of several enzymes including E1 ubiquitin-activating, E2 ubiquitin-conjugating and E3 ubiquitin-ligase and is reversed by deubiquitinases (DUBs). Ubiquitination induces degradation of proteins or alteration of protein function including modulation of enzymatic activity, protein-protein interaction and subcellular localization. A critical step in demonstrating protein ubiquitination or deubiquitination is to perform in vitro reactions with purified components. Effective ubiquitination and deubiquitination reactions could be greatly impacted by the different components used, enzyme co-factors, buffer conditions, and the nature of the substrate.&#160; Here, we provide step-by-step protocols for conducting ubiquitination and deubiquitination reactions. We illustrate these reactions using minimal components of the mouse Polycomb Repressive Complex 1 (PRC1), BMI1, and RING1B, an E3 ubiquitin ligase that monoubiquitinates histone H2A on lysine 119. Deubiquitination of nucleosomal H2A is performed using a minimal Polycomb Repressive Deubiquitinase (PR-DUB) complex formed by the human deubiquitinase BAP1 and the DEUBiquitinase ADaptor (DEUBAD) domain of its co-factor ASXL2. These ubiquitination/deubiquitination assays can be conducted in the context of either recombinant nucleosomes reconstituted with bacteria-purified proteins or native nucleosomes purified from mammalian cells. We highlight the intricacies that can have a significant impact on these reactions and we propose that the general principles of these protocols can be swiftly adapted to other E3 ubiquitin ligases and deubiquitinases.

Ubiquitination is a post-translational modification that plays important roles in cellular processes and is tightly coordinated by deubiquitination. Defects in both reactions underlie human pathologies. We provide protocols for conducting ubiquitination and deubiquitination reaction in vitro using purified components.

Ensaios de Ubiquitinação e Deubiquitinação in vitro de histonas Nucleossomal

Ubiquitination is a post-translational modification that plays important roles in various signaling pathways and is notably involved in the coordination ...

Bioquímica

Assays for Validating Histone Acetyltransferase Inhibitors

Lysine acetyltransferases (KATs) catalyze acetylation of lysine residues on histones and other proteins to regulate chromatin dynamics and gene expression. KATs, such as CBP/p300, are under intense investigation as therapeutic targets due to their critical role in tumorigenesis of diverse cancers. The development of novel small molecule inhibitors targeting the histone acetyltransferase (HAT) function of KATs is challenging and requires robust assays that can validate the specificity and potency of potential inhibitors.
This article outlines a pipeline of three methods that provide rigorous in vitro validation for novel HAT inhibitors (HATi). These methods include a test tube HAT assay, Chromatin Hyperacetylation Inhibition (ChHAI) assay, and Chromatin Immunoprecipitation-quantitative PCR (ChIP-qPCR). In the HAT assay, recombinant HATs are incubated with histones in a test tube reaction, allowing for acetylation of specific lysine residues on the histone tails. This reaction can be blocked by a HATi and the relative levels of site-specific histone acetylation can be measured via immunoblotting. Inhibitors identified in the HAT assay need to be confirmed in the cellular environment.
The ChHAI assay uses immunoblotting to screen for novel HATi that attenuate the robust hyperacetylation of histones induced by a histone deacetylase inhibitor (HDACi). The addition of an HDACi is helpful because basal levels of histone acetylation can be difficult to detect via immunoblotting.
The HAT and ChHAI assays measure global changes in histone acetylation, but do not provide information regarding acetylation at specific genomic regions. Therefore, ChIP-qPCR is used to investigate the effects of HATi on histone acetylation levels at gene regulatory elements. This is accomplished through selective immunoprecipitation of histone-DNA complexes and analysis of the purified DNA through qPCR. Together, these three assays allow for the careful validation of the specificity, potency, and mechanism of action of novel HATi.

Inhibitors of histone acetyltransferases (HATs, also known as lysine acetyltransferases), such as CBP/p300, are potential therapeutics for treating cancer. However, rigorous methods for validating these inhibitors are needed. Three in vitro methods for validation include HAT assays with recombinant acetyltransferases, immunoblotting for histone acetylation in cell culture, and ChIP-qPCR.

Ensaios para validação de inibidores de acetiltransferase histone

Lysine acetyltransferases (KATs) catalyze acetylation of lysine residues on histones and other proteins to regulate chromatin dynamics and gene ...

Pesquisa do câncer

CD Spectroscopy to Study DNA-Protein Interactions

Circular dichroism (CD) spectroscopy is a simple and convenient method to investigate the secondary structure and interactions of biomolecules. Recent advancements in CD spectroscopy have enabled the study of DNA-protein interactions and conformational dynamics of DNA in different microenvironments in detail for a better understanding of transcriptional regulation in vivo. The area around a potential transcription zone needs to be unwound for transcription to occur. This is a complex process requiring the coordination of histone modifications, binding of the transcription factor to DNA, and other chromatin remodeling activities. Using CD spectroscopy, it is possible to study conformational changes in the promoter region caused by regulatory proteins, such as ATP-dependent chromatin remodelers, to promote transcription. The conformational changes occurring in the protein can also be monitored. In addition, queries regarding the affinity of the protein towards its target DNA and sequence specificity can be addressed by incorporating mutations in the target DNA. In short, the unique understanding of this sensitive and inexpensive method can predict changes in chromatin dynamics, thereby improving the understanding of transcriptional regulation.

The interaction of an ATP-dependent chromatin remodeler with a DNA ligand is described using CD spectroscopy. The induced conformational changes on a gene promoter analyzed by the peaks generated can be used to understand the mechanism of transcriptional regulation.

Espectroscopia de CD para estudar interações DNA-proteína

Circular dichroism (CD) spectroscopy is a simple and convenient method to investigate the secondary structure and interactions of biomolecules. Recent ...

In Vitro Characterization of Histone Chaperones using Analytical, Pull-Down and Chaperoning Assays

Histone proteins associate with DNA to form the eukaryotic chromatin. The basic unit of chromatin is a nucleosome, made up of a histone octamer consisting of two copies of the core histones H2A, H2B, H3, and H4, wrapped around by the DNA. The octamer is composed of two copies of an H2A/H2B dimer and a single copy of an H3/H4 tetramer. The highly charged core histones are prone to non-specific interactions with several proteins in the cellular cytoplasm and the nucleus. Histone chaperones form a diverse class of proteins that shuttle histones from the cytoplasm into the nucleus and aid their deposition onto the DNA, thus assisting the nucleosome assembly process. Some histone chaperones are specific for either H2A/H2B or H3/H4, and some function as chaperones for both. This protocol describes how in vitro laboratory techniques such as pull-down assays, analytical size-exclusion chromatography, analytical ultra-centrifugation, and histone chaperoning assay could be used in tandem to confirm whether a given protein is functional as a histone chaperone.

In Vitro Characterization of Histone Chaperones using Analytical, Pull-Down and Chaperoning Assays

This protocol describes a battery of methods that includes analytical size-exclusion chromatography to study histone chaperone oligomerization and stability, pull-down assay to unravel histone chaperone-histone interactions, AUC to analyze the stoichiometry of the protein complexes, and histone chaperoning assay to functionally characterize a putative histone chaperone in vitro.

In vitro Caracterização de Chaperones de Histonas utilizando Ensaios Analíticos, Pull-Down e Chaperoning

Histone proteins associate with DNA to form the eukaryotic chromatin. The basic unit of chromatin is a nucleosome, made up of a histone octamer consisting ...

Deciphering Molecular Mechanism of Histone Assembly by DNA Curtain Technique

Chromatin is a higher-order structure that packages eukaryotic DNA. Chromatin undergoes dynamic alterations according to the cell cycle phase and in response to environmental stimuli. These changes are essential for genomic integrity, epigenetic regulation, and DNA metabolic reactions such as replication, transcription, and repair. Chromatin assembly is crucial for chromatin dynamics and is catalyzed by histone chaperones. Despite extensive studies, the mechanisms by which histone chaperones enable chromatin assembly remains elusive. Moreover, the global features of nucleosomes organized by histone chaperones are poorly understood. To address these problems, this work describes a unique single-molecule imaging technique named DNA curtain, which facilitates the investigation of the molecular details of nucleosome assembly by histone chaperones. DNA curtain is a hybrid technique that combines lipid fluidity, microfluidics, and total internal reflection fluorescence microscopy (TIRFM) to provide a universal platform for real-time imaging of diverse protein-DNA interactions.Using DNA curtain, the histone chaperone function of Abo1, the Schizosaccharomyces pombe bromodomain-containing AAA+ ATPase, is investigated, and the molecular mechanism underlying histone assembly of Abo1 is revealed. DNA curtain provides a unique approach for studying chromatin dynamics.

DNA curtain, a high-throughput single-molecule imaging technique, provides a platform for real-time visualization of diverse protein-DNA interactions. The present protocol utilizes the DNA curtain technique to investigate the biological role and molecular mechanism of Abo1, a Schizosaccharomyces pombe bromodomain-containing AAA+ ATPase.

Decifrando o Mecanismo Molecular da Montagem de Histonas pela Técnica de Cortina de DNA

Chromatin is a higher-order structure that packages eukaryotic DNA. Chromatin undergoes dynamic alterations according to the cell cycle phase and in ...

Chromatin Immunoprecipitation (ChIP) to Assay Dynamic Histone Modification in Activated Gene Expression in Human Cells

In response to a variety of extracellular ligands, the STAT (signal transducer and activator of transcription) transcription factors are rapidly recruited from their latent state in the cytoplasm to cell surface receptors where they are activated by phosphorylation at a single tyrosine residue1. They then dimerize and translocate to the nucleus to drive the transcription of target genes, affecting growth, differentiation, homeostasis and the immune response. Not surprisingly, given their widespread involvement in normal cell processes, dysregulation of STAT function contributes to human disease, particularly to cancers2 and autoimmune diseases3. It is well established that transcription is regulated by alterations to the chromatin template4,5. These alterations include the activities of ATP-dependent complexes, as well as covalent histone modifications and DNA methylation6. Because STAT activation of gene expression is both rapid and transient, it requires specific mechanisms for modulating the chromatin template at STAT-dependent gene loci. To define these mechanisms, we characterize the histone modifications and the enzymatic activities that generate them at gene loci that respond to STAT signaling. This protocol describes chromatin immunoprecipitation, a method that is valuable for the study of STAT signaling to chromatin in activated gene expression.

Chromatin Immunoprecipitation ChIP to Assay Dynamic Histone Modification in Activated Gene Expression in Human Cells

This protocol describes how chromatin immunoprecipitation (ChIP) is used to study the dynamic alterations to the chromatin template that regulate transcription induced by a signal transduction pathway.

Cromatina imunoprecipitação (chips) para a Modificação do ensaio dinâmico Histone na expressão dos genes ativados em células humanas

In response to a variety of extracellular ligands, the STAT (signal transducer and activator of transcription) transcription factors are rapidly recruited ...

Biologia

Desenvolvimento de um ensaio baseado em clique para triagem da atividade da enzima HAT1

An Acetyl-Click Chemistry Assay to Measure Histone Acetyltransferase 1 Acetylation

HAT1, also known as Histone acetyltransferase 1, plays a crucial role in chromatin synthesis by stabilizing and acetylating nascent H4 before nucleosome assembly. It is required for tumor growth in various systems, making it a potential target for cancer treatment. To facilitate the identification of compounds that can inhibit HAT1 enzymatic activity, we have devised an acetyl-click assay for rapid screening. In this simple assay, we employ recombinant HAT1/Rbap46, which is purified from activated human cells. The method utilizes the acetyl-CoA analog 4-pentynoyl-CoA (4P) in a click-chemistry approach. This involves the enzymatic transfer of an alkyne handle through a HAT1-dependent acylation reaction to a biotinylated H4 N-terminal peptide. The captured peptide is then immobilized on neutravidin plates, followed by click-chemistry functionalization with biotin-azide. Subsequently, streptavidin-peroxidase recruitment is employed to oxidize amplex red, resulting in a quantitative fluorescent output. By introducing chemical inhibitors during the acylation reaction, we can quantify enzymatic inhibition based on a reduction of the fluorescence signal. Importantly, this reaction is scalable, allowing for high throughput screening of potential inhibitors for HAT1 enzymatic activity.

Autor em destaque: Desenvolvimento de ensaio de clique de acetil para triagem de inibidores de HAT1

Quick and accurate chemical assays to screen for specific inhibitors are an important tool in the drug development arsenal. Here, we present a scalable acetyl-click chemistry assay to measure the inhibition of HAT1 acetylation activity.

Um ensaio químico de acetil-clique para medir a acetilação de histona acetiltransferase 1

HAT1, also known as Histone acetyltransferase 1, plays a crucial role in chromatin synthesis by stabilizing and acetylating nascent H4 before nucleosome ...

Os ensaios bioquímicos para analisar as actividades de ATP-dependente cromatina remodelação Enzimas

Resumo

Explore mais vídeos

Capítulos neste vídeo

Extrações de sal sequenciais para a análise da cromatina em massa vincular propriedades de cromatina modificando complexos

Análise em tempo real do fator de transcrição, ligação, transcrição, tradução e volume de negócios para exibir eventos globais durante a ativação celular

Ensaios de Ubiquitinação e Deubiquitinação in vitro de histonas Nucleossomal

Ensaios para validação de inibidores de acetiltransferase histone

Espectroscopia de CD para estudar interações DNA-proteína

In vitro Caracterização de Chaperones de Histonas utilizando Ensaios Analíticos, Pull-Down e Chaperoning

Decifrando o Mecanismo Molecular da Montagem de Histonas pela Técnica de Cortina de DNA

Cromatina imunoprecipitação (chips) para a Modificação do ensaio dinâmico Histone na expressão dos genes ativados em células humanas

Um ensaio químico de acetil-clique para medir a acetilação de histona acetiltransferase 1

Um ensaio químico de acetil-clique para medir a acetilação de histona acetiltransferase 1