저자는 국가 주요 연구 및 개발 프로그램의 중국에서 재정 지원을 인정 (샤 오 Guang 첸에 2016YFC1200500), 국립 자연 과학 재단의 중국 (81672054 및 81371846), 자연의 연구 팀 프로그램 광 (2014A030312016)의 과학 재단 하 고 광주 (201508020263)의 과학 및 기술 프로그램. 친절 하 게 촬영 및 p7NS1 GFP 플라스 미드를 제공 하 고 비판적으로이 원고를 읽고 우리는 기꺼이 교수 조나단 칼 슨 (콜로라도 주립 대학)을 인정 합니다.

모든 프로토콜 윤리 위원회의 남부 의료 대학에 의해 승인 했다.
 1. 인공 Intron 설계 참고:이 작업에 사용 되는 인공 intron는 65 길이, 및 순서에 혈압이 5 &#39;-GTAAGAGTCGATCGACGCGTTACTAACTGGTACCTCTTCTTTTTTTTTTGATATCCTGCAG-3 &#39;.
<ol><li>Hpa 배치 나 제한 사이트 인공 intron의 양쪽 끝에 그래서 그 Hpa 나 소화 플라스 미드 ( 그림 1 참조)에서 intron을 해제할 수 있습니다.</li>
	<li>장소 두 Xba 나 제한 사이트는 intron에서 그래서 그 Xba 나 소화 작은 RNA 식 시퀀스를 삽입 하는 데 사용할 수 있습니다.</li>
	<li>는 DNA 제조 업체에서 인공 intron의 전장 DNA 시퀀스의 화학 합성을 주문. 합성 DNA 생성은 표준 pUC19 플라스 미드에 클로닝에서. 
	참고: 인공 intron의 필수 구성 요소 포함 5를 포함 하 여 여러 합의 뉴클레오티드 요소, &#39; GUAAGAGU, UACUAAC, 폴 리 pyrimidine 순서 보존된 지점 포인트 시퀀스 (BPS) 시퀀스와 기증자 스플라이스 사이트 (DS) 로 (PPT) 10 시퀀스 UCUUC(U) 3 &#39;-수락자 스플라이스 사이트 (AS) 시퀀스 GAUAUCCUGCAG ( 그림 1 A). 두 개의 Xba 나 제한 사이트 DS와 작은 RNA 식 시퀀스를 삽입 하는 데 사용할 수 있는 BPS 사이 소개 되었다. 이 인공 intron 포유류와 모기 세포에서 효과적으로 결합 하는 능력 이전 확인된 14 되었습니다.</li>
</ol> 2. 설계는 인공 Intronic 작은 RNA 식 카세트 참고: overexpression 또는 생 miRNA의 최저, 전조 미르 미르 스폰지를 인코딩 시퀀스 DS와 BPS 사이 삽입 했다. 예를 들어, 봉사 애 albopictus aal-하자-7에서 생 전조 미르 미르 overexpression 및 최저 재조합 형 바이러스 성 벡터를 생성 선정 됐다. 반대로 let 7 스폰지는 앞에서 설명한 방법 15에 따라 설계 되었습니다. 애벌레에서 대상 유전자를 허물고, 우리 설계 된 특정 인공 미르 (amiRNA) 또는 온라인 소프트웨어 16 , 17;를 사용 하 여 짧은 헤어핀 RNA (shRNA) 순서 예를 들어, V ATPase 소 단위를 mRNA 역할을 (취득 no. AY864912)는이 연구에서 유전자를 대상으로 선정 됐다. amiRNA 것입니다 라고 하 amiVTP이. 사전-미르, 스폰지, amiRNA, 및 shRNA 모든 시퀀스 세부 사항을 보충 표 1에 설명 되어 있습니다.
<ol><li>전조 miRNAs, 미르 스폰지, 및 Xba와 shRNA의 전장 cDNA 시퀀스의 화학 합성 주문 나 DNA 제조 업체에서 양쪽 끝에 제한 사이트.</li>
	<li>정렬 된 DNA, 스핀 10000-14000 x DNA 블록을 포함 하는 관을 받은 후 g 모두 DNA 건조 되도록 1 분에 대 한 튜브의 하단에는.</li>
	<li>10 ng / µ L의 최종 농도 달성 하기 위해 DNase 무료 물에 말린된 DNA resuspend.</li>
	<li>소화 플라스 미드 백본 및 DNA 시퀀스를 Xba와 내가 1 시간 동안 37 ° C에서 그리고 다음 5 dephosphorylate &#39;와 종 아리 장 알칼리 성 인산 가수분해 효소 (CIAP) 제조 업체에 따라 선형화 플라스 미드 등뼈의 끝 &#39; s 프로토콜 .</li>
	<li>65에서 60 분이 열에 의해 비활성화 CIAP ° c.</li>
	<li>는 1.0 %agarose 젤을 실행 하 고 선형화 등뼈를 잘라. 다음 제조 업체에 따라 젤 추출 키트를 사용 하 여 젤 조각에서 DNA를 추출 &#39; s 지침.</li>
	<li>Ligate 1 h. 22 ° C에서 backboneby T4 DNA 리가 (5 U / µ L)으로 DNA 조각</li>
	<li>유능한 대장균 (대장균)에 2.7 단계 세포 및 암 피 실린 (100 µ g/mL의 농도)에 포함 된 Lysogeny 국물 (파운드) 한 접시에 접시에서 결 찰 반응의 제품은 변환.
	<ol><li>수행 열 충격 방법 18를 사용 하 여 적절 한 대장균을 통해 변환 스트레인. 예를 들어 대장균 긴장 DH5α를 사용 하 여 열 충격 변화에 대 한.</li>
	</ol></li> <li>선택에서 단일 식민지 2.8 고 3 mL의 문화에서 품 어 농축 (100 µ g/mL의 농도)에서 중간 포함 암 피 실린.</li>
	<li>제조 업체에 따라 소형 예비 키트를 사용 하 여 세균성 문화에서 플라스 미드 DNA를 추출 &#39; s 지시. DNA 시퀀싱 회사 샘플 보내기. 
	참고: overexpression 또는 생 miRNA의 최저, 전조 미르 미르 스폰지를 인코딩 시퀀스 삽입 되었다 2 사이 Xba 나 사이트. 모든 미르 식 또는 스폰지 구조 400 보다 짧은 있어야 바이러스 19의 포장 제한 때문에 bp (바이러스 성 게놈 길이의 10%).</li>
</ol> 3. RAeaDV 구문 생성 하 플라스 미드 등뼈로 미르 또는 shRNA 식 카세트를 복제 참고: 촬영, 촬영 플라스 미드 포함 하는 AaeDV 게놈의 구성 하는 전염 성 클론 (3,981 nt) 19, 친절 하 게 교수 조나단 칼 슨에 의해 제공 되었다 고 이전 세부 사항 11에서 설명 하고있다. 비 구조 단백질 1 (NS1)를 표현 하는 p7NS1-DsRed-p7 발기인에서 빨간 형광 성 단백질 (DsRed) 융합 단백질 되었습니다 자세히 다른 14 설명. 인간 전용 미르-941-1 전조 20와 그것의 스폰지, 스크램블된 shRNA (CGACGACTATCGTGCAATTTCAAGAG AATTGCACGATAGTCGTCG), 또한 부정적인 제어로 AaeDV에 subcloned 했다.
<ol><li>Pre-미르, 스폰지, shRNA 또는 amiVTP 식 카세트 Hpa 사이트에 선의 촬영 플라스 미드 백본 프로토콜 단계 2.4 2.7에에서 설명 된 대로 AaeDV NS1 코딩 영역.</li>
	<li>유능한 대장균 세포 및 단계 2.8 2.10에서에서 설명한 대로 긍정적인 클론을 선택 Stbl3 DNA 변환.</li>
	<li>제조 업체에 따라 맥시 준비 키트를 사용 하 여 세균 세포에서 rAaeDV 플라스 미드 추출, 다음 &#39; s 지침. 
	참고: Stbl3 또는 Stbl4 대장균 세포 원치 않는 ITR 재결합을 최소화 하기 위해 rAaeDV DNA 변환에 대 한 활용 되어야 합니다. 맥시 prep rAaeDV 플라스 미드 DNA의 대량을 추출 하는 데 사용할 해야 (&#62; 100 µ g). 바이러스를 생성 하기 전에 rAaeDV 플라스 미드의 시퀀스 무결성 분석 해야 합니다 항상 여 DNA 시퀀싱 21.</li>
</ol> 4. RAaeDV 플라스 미드와 transfecting C6/36 셀 <ol><li>문화 C6/36 세포 로스웰 파크 기념 연구소 (RPMI) 1640 매체 10% 태아 둔감 한 혈 청 (FBS)와 28 ° C 배양 기에서 1% 페니실린/스 포함.</li>
	<li>0 일에 접시 10 25 cm 2 문화 플라스 크에 세포 transfection 90-95%는 1:2 희석에 confluent 셀을 분할 하기 전에 18-20 h. 
	참고: 하루 1, 셀에 도달 해야 90-95% 합류.</li>
	<li>하루에 1, rAaeDV 플라스 미드 22 시리즈와 셀 transfect.
	<li><ol>Microcentrifuge 튜브에서 RPMI 1640 매체의 600 µ L에 10 µ g의 DNA를 희석 하 고 부드럽게 혼합. 한편, RPMI 1640 매체의 600 µ L 25 µ L 당 transfection transfection 시 약의 준비.</li>
		<li>품 실 온 (RT)에서 5-10 분 그런 다음, 1640-플라스 미드 DNA 혼합물에 1640 transfection 시 혼합물의 625 µ L를 추가.</li>
		<li>는 실시간에 20-30 분 동안이 혼합물을 품 어 Transfection, 전에 씻어 RPMI 1640 매체의 2 mL로 두 번 셀.</li>
		<li>RT 후 보육 (4.3.3 단계), 25 cm 2 문화 플라스 크를 the1640 transfection 시 DNA 플라스 미드 혼합물을 추가 하 고 28에서 6 h에 대 한 품 어 ° c.</li>
		<li>약 6 h 후 transfection에 제거 transfection 미디어 RPMI 1640 매체의 5 mL로 두 번 셀을 세척 하 고 10%와 RPMI 1640 매체 추가 FBS. 
		그러나 참고: rAaeDV Ae albopictus 애벌레 감염 (95%)의 높은 속도에서는,, 우리의 경험에서는, 감염 된 애벌레의 거의 50%에서 감염 없이 1 차 감염 사이트 (예를 들어, 항문 용의자와 다름 셀)에 제한 했다 보급 23. 따라서, 여러 조직에서 애벌레를 감염 시킬 필요가 있는 경우에, 형광 단백질을 표현 하는 결함이 재조합 바이러스 감염 사이트의 시각화 수 있도록 공동 감염 되어야 합니다. 예를 들어 DsRed을 표현 하는 결함이 있는 재조합 바이러스 생산, p7NS1-DsRed 위에서 설명한 절차에 따라 C6/36 세포로 도우미 플라스 미드와 공동 transfected 이어야 한다 (cotransfection 농도 비율 2:1 이어야 함).</li>
	</ol></li></ol> 5. 페 C6/36 세포에서 rAaeDV Virions 수확 <ol><li>수확 세포 transfection 후 5 일. 꺼내 려 하 고 5 mL 유리 dropper, 문화 매체를 위아래로 pipetting으로 요리에 셀 중단. 모든 셀 정지 균 15 mL 튜브에 전송.</li>
	<li>-80 ° C에서 드라이 아이스/에탄올 목욕 30 분에 고정 하 고 37에 녹여 다음 1 분에 대 한 ° C. 소용돌이 동결 및 해 동 절차 3 번 반복.</li>
	<li>원심 4 °C.Collect은 상쾌한에 20 분 동안 4800 x g에서 샘플 하 고 펠 릿을 삭제. 그런 다음는 상쾌한 통과 0.22 μ m 일회용 주사기 필터. 최종 정제 virion-80에서 주식 약 수 및 저장소 ° c. 
	참고: 반복된 freeze-thaw 주기 방지.</li>
</ol> 6. RAaeDV 측정 <ol><li>준비 DNA 표준. 선형화 Hpa와 모든 rAaeDV 플라스 미드 나, 젤 추출 키트 24 소화 제품을 정화.</li>
	<li>절대 양적 표준 곡선을 생성 하 고 앞에서 설명한 방법 25에 따라 바이러스 titer 측정.</li>
</ol> 7. 모기 변환 <ol><li>세척 100 1 세인트 탈피 Ae albopictus 애벌레 세 번 사용 하 여 이온 물, 그리고 다음, 95 이온된 물 들어 있는 비 커에 애벌레를 전송. RAaeDV 주식 (최종 농도 10 복사본/10ml x 1.00)의 5 mL을 추가.</li>
	<li>품 어 24 28 ° c, h 이온된 수를 사용 하 여 시간 3 애벌레를 세척 하 고 다음 애벌레는 접시에 다시 전송 하 고 정기적으로 피드.</li>
	<li>모니터링 정량 또는 서쪽 오 점 (대표 결과 그림 3과 4에 나와 있습니다) 애벌레에 대상 유전자 발현의 수준. 
	참고: 형광 신호 검출 방식 보다 정확 하 게 감염 된 유 충을 사용할 수 있습니다. 예를 들어 DsRed을 표현 하는 재조합 형 바이러스에 감염 된 애벌레에서 형광 신호를 감지, 애벌레 수 오목 함 슬라이드에 배치 되며 감염 된 후 2 일까지 모든 8 h는 거꾸로 형광 현미경 관찰. 형광 애벌레 감지 되 면 이후 지속적인 관찰 수 있도록 개별 플라스틱 테스트 컵으로 분리 되어야 한다. 이 메서드를 사용 하 여 여러 조직 감염 된 애벌레를 확인할 수 있습니다.</li>
</ol>

<ol>
	<li>Tolle, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mosquito-borne+diseases.">Mosquito-borne diseases.</a> Current problems in pediatric and adolescent health care. 39, 97-140 (2009).</li><li>Petersen, L. R., Jamieson, D. J., Powers, A. M., Honein, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika+Virus.">Zika Virus.</a> The New England journal of medicine. 374, 1552-1563 (2016).</li><li>Roberts, D. R., Andre, R. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insecticide+resistance+issues+in+vector-borne+disease+control.">Insecticide resistance issues in vector-borne disease control.</a> The American journal of tropical medicine and hygiene. 50, 21-34 (1994).</li><li>Attaran, A., Roberts, D. R., Curtis, C. F., Kilama, W. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Balancing+risks+on+the+backs+of+the+poor.">Balancing risks on the backs of the poor.</a> Nature medicine. 6, 729-731 (2000).</li><li>Volohonsky, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transgenic+Expression+of+the+Anti-parasitic+Factor+TEP1+in+the+Malaria+Mosquito+Anopheles+gambiae.">Transgenic Expression of the Anti-parasitic Factor TEP1 in the Malaria Mosquito Anopheles gambiae.</a> PLoS pathogens. 13, 1006113 (2017).</li><li>Galizi, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+synthetic+sex+ratio+distortion+system+for+the+control+of+the+human+malaria+mosquito.">A synthetic sex ratio distortion system for the control of the human malaria mosquito.</a> Nature communications. 5, 3977 (2014).</li><li>Bourtzis, K., Lees, R. S., Hendrichs, J., Vreysen, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=More+than+one+rabbit+out+of+the+hat:+Radiation,+transgenic+and+symbiont-based+approaches+for+sustainable+management+of+mosquito+and+tsetse+fly+populations.">More than one rabbit out of the hat: Radiation, transgenic and symbiont-based approaches for sustainable management of mosquito and tsetse fly populations.</a> Acta tropica. 157, 115-130 (2016).</li><li>Kumar, S. S., Puttaraju, H. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improvised+microinjection+technique+for+mosquito+vectors.">Improvised microinjection technique for mosquito vectors.</a> The Indian journal of medical research. 136, 971-978 (2012).</li><li>Attardo, G. M., Higgs, S., Klingler, K. A., Vanlandingham, D. L., Raikhel, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+interference-mediated+knockdown+of+a+GATA+factor+reveals+a+link+to+anautogeny+in+the+mosquito+Aedes+aegypti.">RNA interference-mediated knockdown of a GATA factor reveals a link to anautogeny in the mosquito Aedes aegypti.</a> Proceedings of the National Academy of Sciences of the United States of America. 100, 13374-13379 (2003).</li><li>Singh, A. D., Wong, S., Ryan, C. P., Whyard, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oral+delivery+of+double-stranded+RNA+in+larvae+of+the+yellow+fever+mosquito,+Aedes+aegypti:+implications+for+pest+mosquito+control.">Oral delivery of double-stranded RNA in larvae of the yellow fever mosquito, Aedes aegypti: implications for pest mosquito control.</a> Journal of insect science. 13, 69 (2013).</li><li>Ward, T. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aedes+aegypti+transducing+densovirus+pathogenesis+and+expression+in+Aedes+aegypti+and+Anopheles+gambiae+larvae.">Aedes aegypti transducing densovirus pathogenesis and expression in Aedes aegypti and Anopheles gambiae larvae.</a> Insect molecular biology. 10, 397-405 (2001).</li><li>Carlson, J., Suchman, E., Buchatsky, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Densoviruses+for+control+and+genetic+manipulation+of+mosquitoes.">Densoviruses for control and genetic manipulation of mosquitoes.</a> Advances in virus research. 68, 361-392 (2006).</li><li>Barreau, C., Jousset, F. X., Bergoin, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pathogenicity+of+the+Aedes+albopictus+parvovirus+(AaPV),+a+denso-like+virus,+for+Aedes+aegypti+mosquitoes.">Pathogenicity of the Aedes albopictus parvovirus (AaPV), a denso-like virus, for Aedes aegypti mosquitoes.</a> Journal of invertebrate pathology. 68, 299-309 (1996).</li><li>Liu, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+non-defective+recombinant+densovirus+vectors+for+microRNA+delivery+in+the+invasive+vector+mosquito,+Aedes+albopictus.">Development of non-defective recombinant densovirus vectors for microRNA delivery in the invasive vector mosquito, Aedes albopictus.</a> Scientific reports. 6, 20979 (2016).</li><li>Ortega, M. M., Bouamar, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Guidelines+on+Designing+MicroRNA+Sponges:+From+Construction+to+Stable+Cell+Line.">Guidelines on Designing MicroRNA Sponges: From Construction to Stable Cell Line.</a> Methods in molecular biology. 1509, 221-233 (2017).</li><li>Froger, A., Hall, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+plasmid+DNA+into+E.+coli+using+the+heat+shock+method.">Transformation of plasmid DNA into E. coli using the heat shock method.</a> Journal of visualized experiments : JoVE. , e253 (2007).</li><li>Afanasiev, B. N., Kozlov, Y. V., Carlson, J. O., Beaty, B. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Densovirus+of+Aedes+aegypti+as+an+expression+vector+in+mosquito+cells.">Densovirus of Aedes aegypti as an expression vector in mosquito cells.</a> Experimental parasitology. 79, 322-339 (1994).</li><li>Hu, H. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolution+of+the+human-specific+microRNA+miR-941.">Evolution of the human-specific microRNA miR-941.</a> Nature communications. 3, 1145 (2012).</li><li>Sanger, F., Nicklen, S., Coulson, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+sequencing+with+chain-terminating+inhibitors.">DNA sequencing with chain-terminating inhibitors.</a> Proceedings of the National Academy of Sciences of the United States of America. 74, 5463-5467 (1977).</li><li>Dalby, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advanced+transfection+with+Lipofectamine+2000+reagent:+primary+neurons,+siRNA,+and+high-throughput+applications.">Advanced transfection with Lipofectamine 2000 reagent: primary neurons, siRNA, and high-throughput applications.</a> Methods (San Diego, Calif). 33, 95-103 (2004).</li><li>Gu, J. B., Dong, Y. Q., Peng, H. J., Chen, X. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+recombinant+AeDNA+containing+the+insect-specific+toxin,+BmK+IT1,+displayed+an+increasing+pathogenicity+on+Aedes+albopictus.">A recombinant AeDNA containing the insect-specific toxin, BmK IT1, displayed an increasing pathogenicity on Aedes albopictus.</a> The American journal of tropical medicine and hygiene. 83, 614-623 (2010).</li><li>Hou, Y., Zhang, H., Miranda, L., Lin, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serious+overestimation+in+quantitative+PCR+by+circular+(supercoiled)+plasmid+standard:+microalgal+pcna+as+the+model+gene.">Serious overestimation in quantitative PCR by circular (supercoiled) plasmid standard: microalgal pcna as the model gene.</a> PloS one. 5, 9545 (2010).</li><li>Ding, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+of+rAAV9+to+Overexpress+or+Knockdown+Genes+in+Mouse+Hearts.">Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts.</a> Journal of visualized experiments : JoVE. , (2016).</li></ol>

저자 들은 아무 경쟁 금융 관심사 선언 합니다.

그것은 두 rAaeDV 건설을 제한 하는 주요 장벽을 극복 하는 것이 중요입니다. 첫 번째 결함 재조합 바이러스의 생산 이다. 그것은 알려졌다 적절 하 게 표현 하는 벡터 크기의 GFP 단백질; 전갈 곤충 전용 neurotoxins20 등 외국 유전자 MDV를 사용할 수 있습니다. 그러나, 건설 전략에 MDV ORFs 삽입 또는 세 유전자를 대체 하는 일단 virions 형성할 수 없습니다 독립적으로 도우미 플라스 미드 누락 된 필수적인 ?...

모기-품 어진 질병 말라리아, 황열병, 뎅기열, zika 발열 등은 계속 글로벌 전염 성 질병 부담1,2의 중요 한 일부분을 담당 하는 주요 국제 공중 보건 문제입니다. 벡터에 대 한 응답에 사용 된, 전통적인 살충제 모기 품 어진 질병의 예방에 대 한 지속 가능한 통합된 모기 제어 전략의 주요 구성 요소입니다. 그러나, 이러한 전략 상대적으로 효과 없는 또는 관련된 부정적인 환경에 미치는 영향 뿐만 아니라 모기 인구3,4내성의 진화로 인해 원하지 않는 것을 입증 했다. 이러한 이유로, 모기의 다른 방법에 대 한 긴급 한 필요 제어 및 불 임 남성 모기를 생산 하는 유전자 변형 방법의 사용 이며 병원 체 저항 모기의 릴리스 유망한 새로운 제어 전략으로 발현. 개발 효과적인 새로운 컨트롤 방법, vivo에서 유전자 전달 모기 유전자 기능의 포괄적인 분석에 대 한 안전 하 고 효과적인 방법으로 필요한 같은.
플라스 미드 DNA, 더블의 직접 microinjection RNA (dsRNA) 좌초 또는 작은 간섭 RNA (siRNA)는 가장 일반적으로 사용 되 vivo에서 유전자 전달 방법 모기에. 사실, 모기의 유전자 변형 종자의 생산 여전히 태아 microinjection5,,67의 과정에 의존 합니다. 그러나, microinjection는 몇 가지 제한이 있습니다. 첫째,이 기술은 기술적으로 요구 하 고 복잡 한 절차를 포함 한다. 둘째, 주입 하면 태아, 애벌레, pupae, 및 성인 대상 생물의 생존에 직접적인 영향을 실제 모욕. 셋째, 대부분 수 중 서식 지에서 살고 먹 운동 특성을가지고 있기 때문에 microinjection에 대 한 모기 유 충을 무력화 하기가 어렵습니다. 넷째, 1st-2nd 탈피 애벌레의 크기는 10-에 20 배 작은 4번째 보다 탈피 및 오래 된 애벌레, 그리고 전 손톱 더 섬세 한. 이러한 기능 1st-2nd 탈피 애벌레 이전 단계에서 그들에 비해 조작 하기 어려울. 결합, 이러한 요소는 애벌레 (약 5%) 성인8에 비해 감소 후 주입 생존 율에 기여 한다. 바이러스 성 기반 전달 시스템 관련된 extracellular와 세포 장벽을 극복 하기 위해 개발 되었습니다. 이러한 시스템 쉬운 조작, 높은 변환 효율, 장기와 강력한 식의 수준과 영구 효과 vivo에서생산 하는 것의 이점이 있다. 따라서, 유전자 전달 시스템 활용 레트로 바이러스, lentiviruses, adenoviruses 널리 되었습니다 사용 모델 종 inmammalian 세포 라인. Sindbis 바이러스 식 시스템 이전 성인 모기;에 유전자 기능을 분석 하는 데 사용 되었다는 그러나 biosafety 관심사 외, 주입은 여전히 바이러스 감염9필요한 과정. DsRNA 해결책에 애벌레를 몸을 담글 하 여 구두 납품은으로 알려졌다 이전 가능한 전달 방법으로, 비록 작은 RNA 기능 분석10위해 적당 하다. 그래서, 효과적인 바이러스 전달 방법 아직도 모기에 대 한 개발 해야 합니다.
모기 densoviruses (MDVs) Parvoviridae, 그리고 Brevidensovirus11속에서 하나를 제외한 모든가 Densovirinae subfamily의 일부입니다. MDV virions 비 싸여 있으며 단일 가닥 DNA (ssDNA) 게놈과 icosahedral capsid의 구성 (20 nm 직경에서). 바이러스 성 게놈 크기에 약 4kb 이며 호스트 세포의 핵 내에서 복제 됩니다. MDVs 환경에서 상대적으로 안정 하 고 모기에 대 한 높은 특이성으로 좁은 호스트 범위를 보여. 이 바이러스를 확산 하 고 모기 인구에서 자연스럽 게 지속 가능성 있고 거의 모든 장기와 조직 midgut, 말 tubules, 뚱뚱한 몸, 근육, 신경, 그리고 침 샘12를 포함 하 여 이러한 곤충의 침입 수 있습니다.
그대로 MDV 유전자를 플라스 미드 기반의 전염 성 클론; 생성 하 플라스 미드 벡터에 subcloned 수 있습니다. 이러한 모기 세포에 배달, 바이러스 성 게놈 플라스 미드 벡터에서 추출 되 고 전염 성 바이러스 입자를 생산 됩니다. MDV 작은 ssDNA 게놈 있기 때문에, 전염 성 클론은 쉽게 건설 하 고 바이러스 성 게놈 쉽게 조작된11,13를 수 있습니다. 이러한 특성 모기 생물학 검토를 위해 귀중 한 에이전트 MDV 확인 합니다. 그러나, 바이러스 성 게놈 시퀀스의 거의 모든 바이러스 확산을 위해 필수적 이다, 때문에 교체를 통해 재조합 바이러스의 생성 또는 외국 유전자의 삽입 하면 손실 바이러스 성 포장 및/또는 복제 능력에 만듭니다 있는 유전자 납품 벡터로 MDVs의 개발에 대 한 장벽 했다. 여기, 우리는 인공 intronic 작은 RNA 식 전략을 사용 하 여 시스템을 개발 비 결함 rAaeDV vivo에서 RNA 배달은 쉽게 플라스 미드 건설의 이점 및 생성할 수 있는 기능 바이러스의 유지 보수를 보고 야생 형 바이러스에 대 한 필요 없이 호스트 세포에 안정적이 고 장기적인 식입니다. 또한이 메서드는 애벌레의 쉬운 변환에 대 한 수 있습니다.
다음 단계에 대 한 프로토콜은이 연구에서 설명 하는: 1) rAaeDVs 인코딩 intronic 작은 RNA 식 카세트, C6/36 포장 셀을 사용 하 여 재조합 바이러스 입자의 2) 생산의 디자인 라인, 셀 무료의 3) 정량 분석 rAaeDV 게놈 숫자, 및 4 복사) Ae albopictus 애벌레 애벌레 서식 지의 물 몸으로 바이러스의 직접 소개에 의해의 감염. 전반적으로,이 작품에는 특정 작은 RNAs 또는 대상 유전자 overexpressed 하거나 수 개발된 MDV 전달 시스템을 사용 하 여 모기 애벌레에 뜨 시연 했다.

<table width="901">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="24">
			<td height="24" style="width:401px;height:24px;">Centrifuge machine</td>
			<td style="width:215px;">Thermo Scientific</td>
			<td style="width:119px;">75004260</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:401px;height:21px;">Centrifuge System</td>
			<td style="width:215px;">Beckman Coulter</td>
			<td style="width:119px;">363118</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:401px;height:21px;">GeneJET Gel Extraction Kit</td>
			<td style="width:215px;">Thermo Scientific</td>
			<td style="width:119px;">K0691</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:401px;height:21px;">E.Z.N.A. Plasmid Midi Kit</td>
			<td style="width:215px;">Omega Biotech</td>
			<td style="width:119px;">D6904</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:401px;height:21px;">Purified Agar</td>
			<td style="width:215px;">OXOID</td>
			<td style="width:119px;">LP0028A</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:401px;height:21px;">FastAP Thermosensitive Alkaline Phosphatase (1 U/&#181;L)</td>
			<td style="width:215px;">Thermo Scientific</td>
			<td style="width:119px;">EF0651</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:401px;height:21px;">FastDigest HpaI</td>
			<td style="width:215px;">Thermo Scientific</td>
			<td style="width:119px;">FD1034</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:401px;height:21px;">FastDigest XbaI</td>
			<td style="width:215px;">Thermo Scientific</td>
			<td style="width:119px;">FD0684</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:401px;height:21px;">T4 DNA Ligase (5 U/&#181;L)</td>
			<td style="width:215px;">Thermo Scientific</td>
			<td style="width:119px;">EL0011</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:401px;height:21px;">TransStbl3 Chemically Competent Cell</td>
			<td style="width:215px;">Beijing Transgen Biotech</td>
			<td style="width:119px;">CD521-01</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:401px;height:21px;">Ampicillin&#160;</td>
			<td style="width:215px;">Beijing Tiangen Biotech</td>
			<td style="width:119px;">RT501</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:401px;height:21px;">Roswell Park Memorial Institute (RPMI) 1640 medium</td>
			<td style="width:215px;">Gibco&#65292; Life Technologies</td>
			<td style="width:119px;">&#160;21875109</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:401px;height:21px;">Fetal Bovine Serum&#65288; Australia Origin&#65289;</td>
			<td style="width:215px;">Gibco&#65292; Life Technologies</td>
			<td style="width:119px;">10099141</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:401px;height:21px;">penicillin/streptomycin</td>
			<td style="width:215px;">Gibco&#65292; Life Technologies</td>
			<td style="width:119px;">15070063</td>
			<td></td>
		</tr>
		<tr height="23">
			<td height="23" style="width:401px;height:23px;">Lipofectamine 2000 Transfection Reagent</td>
			<td style="width:215px;">&#160;Invitrogen&#65292;Life Technologies</td>
			<td style="width:119px;">11668019</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:401px;height:21px;">Proteinase K</td>
			<td style="width:215px;">Promega</td>
			<td>MC5008</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:401px;height:21px;">DNase I (RNase-free)</td>
			<td style="width:215px;">&#160;Invitrogen&#65292;Life Technologies</td>
			<td style="width:119px;">AM2222</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:401px;height:21px;">SuperReal PreMix Plus (SYBR Green)</td>
			<td style="width:215px;">Beijing Tiangen Biotech</td>
			<td style="width:119px;">FP205</td>
			<td></td>
		</tr>
	</tbody>
</table>

use of a recombinant mosquito densovirus as a gene delivery vector for the functional analysis of genes in mosquito larvae

Vivo에서 microinjection 개별 모기의 유전자 기능 분석을 위한 가장 일반적으로 사용 되 진 전송 기술입니다. 그러나,이 방법을 기술적으로 요구 하는 작업이 더 필요 하 고 그들의 작은 크기, 상대적으로 얇고 깨지기 쉬운 표 피 및 높은 사망률, 그것의 응용 프로그램을 제한 하는 애벌레에서 사용 하는 경우에 특히 복잡 한 절차를 포함. 반면, 유전자 배달에 대 한 바이러스 성 벡터 extracellular와 세포 장벽을 극복 하 개발 되었습니다. 이러한 시스템 쉬운 조작, 높은 유전자 전달 효율, 유전자 발현의 장기적인 유지 관리 및 영구 효과 vivo에서생산 하는 것의 이점이 있다. 모기 densoviruses (MDVs)는 효과적으로 모기 세포;로 외국 핵 산을 제공할 수 있는 모기 관련, 작은 단일 가닥 DNA 바이러스 그러나, 교체 또는 일반적으로 재조합 바이러스를 만드는 외국 유전자의 삽입으로 배달 벡터가이 바이러스의 개발에 장애가 포장 또는 복제 능력의 손실을 발생 합니다.
여기, 우리가 아닌 결함 재조합 Aedes aegypti densovirus (AaeDV) vivo에서 전달 시스템을 개발 하는 인공 intronic 작은 RNA 식 전략을 사용 하 여 보고 합니다. 건설, 포장 및 rAaeDV 벡터의 정량 분석 그리고 애벌레 감염에 대 한 자세한 절차를 설명 합니다.
이 학문은 설명 한다, 처음으로 비 결함 재조합 MDV 마이크로 RNA (miRNA) 식 시스템 개발, 따라서 모기에서 유전자의 기능 분석을 위한 강력한 도구를 제공 하 고 기본 설정의 타당성은 모기 품 어진 질병을 제어 하기 위한 바이러스 paratransgenesis의 응용 프로그램. 우리는 Aedes albopictus 1세인트 탈피 애벌레 감염 될 수 쉽게 그리고 효과적으로 사이트를 사육 하는 애벌레의 물 본문에 바이러스를 도입 하 여와 개발된 rAaeDVs overexpress 또는 노크 하는 데 사용 될 수 입증 된 유전자 모기의 기능 분석을 위한 도구를 제공 하는 유 충에 특정 대상 유전자의 표현.

RAaeDV 건설을 위한 전략 결함이 rAaeDV 벡터 모기 애벌레에 DsRed 유전자를 표현 하기 위해 생성 되었습니다. 결과 플라스 미드 부사장 단백질 삭제 (그림 1A) 함께 NS1 DsRed 융합 단백질 카세트를 포함. rAaeDV 미르에 대 한 식 구문을 포함 하는 플라스 미드, 미르 스폰지, shRNA 및 amiRNA 설계 되었습니다 ( 그림 1...

Watch this Scientific Journal Video about Use of a Recombinant Mosquito Densovirus As a Gene Delivery Vector for the Functional Analysis of Genes in Mosquito Larvae at JoVE.com

Use of a Recombinant Mosquito Densovirus As a Gene Delivery Vector for the Functional Analysis of Genes in Mosquito Larvae

모기 유 충에서 유전자의 기능 분석에 대 한 유전자 납품 벡터로 재조합 모기 Densovirus의 사용

우리는 비 결함 재조합 Aedes aegypti densovirus (AaeDV) vivo에서 전달 시스템을 개발 하는 인공 intronic 작은 RNA 식 전략을 사용 하 여 보고 합니다. 건설, 포장, 및 애벌레 감염에 관해서는 뿐만 아니라 rAaeDV 벡터의 정량 분석에 대 한 자세한 절차를 설명 합니다.

In vivo microinjection is the most commonly used gene transfer technique for analyzing the gene functions in individual mosquitoes. However, this method ...

use-recombinant-mosquito-densovirus-as-gene-delivery-vector-for

Universidad de Cartagena UDEC

Research

JoVE Journal

Developmental Biology

6.7K 조회수.  Southern Medical University. 우리는 비 결함 재조합 Aedes aegypti densovirus (AaeDV) vivo에서 전달 시스템을 개발 하는 인공 intronic 작은 RNA 식 전략을 사용 하 여 보고 합니다. 건설, 포장, 및 애벌레 감염에 관해서는 뿐만 아니라 rAaeDV 벡터의 정량 분석에 대 한 자세한 절차를 설명 합니다.

비디오: Use of a Recombinant Mosquito Densovirus As a Gene Delivery Vector for the Functional Analysis of Genes in Mosquito Larvae

Mosaic Zebrafish Transgenesis for Functional Genomic Analysis of Candidate Cooperative Genes in Tumor Pathogenesis

Comprehensive genomic analysis has uncovered surprisingly large numbers of genetic alterations in various types of cancers. To robustly and efficiently identify oncogenic &#8220;drivers&#8221; among these tumors and define their complex relationships with concurrent genetic alterations during tumor pathogenesis remains a daunting task. Recently, zebrafish have emerged as an important animal model for studying human diseases, largely because of their ease of maintenance, high fecundity, obvious advantages for in vivo imaging, high conservation of oncogenes and their molecular pathways, susceptibility to tumorigenesis and, most importantly, the availability of transgenic techniques suitable for use in the fish. Transgenic zebrafish models of cancer have been widely used to dissect oncogenic pathways in diverse tumor types. However, developing a stable transgenic fish model is both tedious and time-consuming, and it is even more difficult and more time-consuming to dissect the cooperation of multiple genes in disease pathogenesis using this approach, which requires the generation of multiple transgenic lines with overexpression of the individual genes of interest followed by complicated breeding of these stable transgenic lines. Hence, use of a mosaic transient transgenic approach in zebrafish offers unique advantages for functional genomic analysis in vivo. Briefly, candidate transgenes can be coinjected into one-cell-stage wild-type or transgenic zebrafish embryos and allowed to integrate together into each somatic cell in a mosaic pattern that leads to mixed genotypes in the same primarily injected animal. This permits one to investigate in a faster and less expensive manner whether and how the candidate genes can collaborate with each other to drive tumorigenesis. By transient overexpression of activated ALK in the transgenic fish overexpressing MYCN, we demonstrate here the cooperation of these two oncogenes in the pathogenesis of a pediatric cancer, neuroblastoma that has resisted most forms of contemporary treatment.

The goal of this study is to demonstrate how the mosaic transgenesis strategy can be used in zebrafish to rapidly and efficiently assess the relative contributions of multiple oncogenes in tumor initiation and progression in vivo.

종양의 병인에 후보 협동 유전자의 기능 게놈 분석을위한 모자이크 Zebrafish의 Transgenesis

Comprehensive genomic analysis has uncovered surprisingly large numbers of genetic alterations in various types of cancers.  To robustly and efficiently ...

연구

발생학

Capturing Tissue Repair in Zebrafish Larvae with Time-lapse Brightfield Stereomicroscopy

The zebrafish larval tail fin is ideal for studying tissue regeneration due to the simple architecture of the larval fin-fold, which comprises of two layers of skin that enclose undifferentiated mesenchyme, and because the larval tail fin regenerates rapidly within 2-3 days. Using this system, we demonstrate a method for capturing the repair dynamics of the amputated tail fin with time-lapse video brightfield stereomicroscopy. We demonstrate that fin amputation triggers a contraction of the amputation wound and extrusion of cells around the wound margin, leading to their subsequent clearance. Fin regeneration proceeds from proximal to distal direction after a short delay. In addition, developmental growth of the larva can be observed during all stages. The presented method provides an opportunity for observing and analyzing whole tissue-scale behaviors such as fin development and growth in a simple microscope setting, which is easily adaptable to any stereomicroscope with time-lapse capabilities.

We present a protocol for capturing the dynamics of zebrafish larval tail fin regeneration on a whole-tissue scale using brightfield-based stereomicroscopy. This technique enables capturing the regeneration dynamics with single cell resolution. This methodology can be adapted to any stereomicroscope equipped with a CCD camera and time-lapse software.

시간 경과 브라이트 실체 현미경으로 Zebrafish의 애벌레에서 조직 복구를 캡처

The zebrafish larval tail fin is ideal for studying tissue regeneration due to the simple architecture of the larval fin-fold, which comprises of two ...

Analysis of Zebrafish Larvae Skeletal Muscle Integrity with Evans Blue Dye

The zebrafish model is an emerging system for the study of neuromuscular disorders. In the study of neuromuscular diseases, the integrity of the muscle membrane is a critical disease determinant. To date, numerous neuromuscular conditions display degenerating muscle fibers with abnormal membrane integrity; this is most commonly observed in muscular dystrophies. Evans Blue Dye (EBD) is a vital, cell permeable dye that is rapidly taken into degenerating, damaged, or apoptotic cells; in contrast, it is not taken up by cells with an intact membrane. EBD injection is commonly employed to ascertain muscle integrity in mouse models of neuromuscular diseases. However, such EBD experiments require muscle dissection and/or sectioning prior to analysis. In contrast, EBD uptake in zebrafish is visualized in live, intact preparations. Here, we demonstrate a simple and straightforward methodology for performing EBD injections and analysis in live zebrafish. In addition, we demonstrate a co-injection strategy to increase efficacy of EBD analysis. Overall, this video article provides an outline to perform EBD injection and characterization in zebrafish models of neuromuscular disease.

In this study, we describe a straightforward method to perform Evans Blue Dye (EBD) analysis on zebrafish larvae. This technique is a powerful tool for the characterization of skeletal muscle integrity and delineation of zebrafish models of muscular dystrophy, and is a valuable method for the development of novel therapeutics.

에반스 블루 염료와 Zebrafish의 애벌레 골격 근육 무결성 분석

The zebrafish model is an emerging system for the study of neuromuscular disorders.  In the study of neuromuscular diseases, the integrity of the muscle ...

Methods to Examine the Lymph Gland and Hemocytes in Drosophila Larvae

Many parallels exist between the Drosophila and mammalian hematopoietic systems, even though Drosophila lack the lymphoid lineage that characterize mammalian adaptive immunity. Drosophila and mammalian hematopoiesis occur in spatially and temporally distinct phases to produce several blood cell lineages. Both systems maintain reservoirs of blood cell progenitors with which to expand or replace mature lineages. The hematopoietic system allows Drosophila and mammals to respond to and to adapt to immune challenges. Importantly, the transcriptional regulators and signaling pathways that control the generation, maintenance, and function of the hematopoietic system are conserved from flies to mammals. These similarities allow Drosophila to be used to genetically model hematopoietic development and disease.
Here we detail assays to examine the hematopoietic system of Drosophila larvae. In particular, we outline methods to measure blood cell numbers and concentration, visualize a specific mature lineage in vivo, and perform immunohistochemistry on blood cells in circulation and in the hematopoietic organ. These assays can reveal changes in gene expression and cellular processes including signaling, survival, proliferation, and differentiation and can be used to investigate a variety of questions concerning hematopoiesis. Combined with the genetic tools available in Drosophila, these assays can be used to evaluate the hematopoietic system upon defined genetic alterations. While not specifically outlined here, these assays can also be used to examine the effect of environmental alterations, such as infection or diet, on the hematopoietic system.

Methods to Examine the Lymph Gland and Hemocytes in Drosophila Larvae

Drosophila and mammalian hematopoietic systems share many common features, making Drosophila an attractive genetic model to study hematopoiesis. Here we demonstrate dissection and mounting of the major larval hematopoietic organ for immunohistochemistry. We also describe methods to assay various larval hematopoietic compartments including circulating hemocytes and sessile crystal cells.

방법은 림프 글 랜드와 혈구 세포에서를 검사합니다<em&gt; 초파리</em&gt; 애벌레

Many parallels exist between the Drosophila and mammalian hematopoietic systems, even though Drosophila lack the lymphoid lineage that characterize ...

Rapid Isolation of BMPR-IB+ Adipose-Derived Stromal Cells for Use in a Calvarial Defect Healing Model

Invasive cancers, major injuries, and infection can cause bone defects that are too large to be reconstructed with preexisting bone from the patient's own body. The ability to grow bone de novo using a patient's own cells would allow bony defects to be filled with adequate tissue without the morbidity of harvesting native bone. There is interest in the use of adipose-derived stromal cells (ASCs) as a source for tissue engineering because these are obtained from an abundant source: the patient's own adipose tissue. However, ASCs are a heterogeneous population and some subpopulations may be more effective in this application than others. Isolation of the most osteogenic population of ASCs could improve the efficiency and effectiveness of a bone engineering process. In this protocol, ASCs are obtained from subcutaneous fat tissue from a human donor. The subpopulation of ASCs expressing the marker BMPR-IB is isolated using FACS. These cells are then applied to an in vivo calvarial defect healing assay and are found to have improved osteogenic regenerative potential compared with unsorted cells.

Adipose-derived stromal cells may be useful for engineering new tissue from a patient's own cells. We present a protocol for the isolation of a subpopulation of human adipose-derived stromal cells (ASCs) with increased osteogenic potential, followed by application of the cells in an in vivo calvarial healing assay.

BMPR-IB +의 신속한 격리 두개골 결함 치유 모델에서 사용을위한 기질 세포를 지방이는 유래

Invasive cancers, major injuries, and infection can cause bone defects that are too large to be reconstructed with preexisting bone from the patient's own ...

Hypoxic Preconditioning of Marrow-derived Progenitor Cells As a Source for the Generation of Mature Schwann Cells

This manuscript describes a means to enrich for neural progenitors from the marrow stromal cell (MSC) population and thereafter to direct them to the mature Schwann cell fate. We subjected rat and human MSCs to transient hypoxic conditions (1% oxygen for 16 h) followed by expansion as neurospheres upon low-attachment substratum with epidermal growth factor (EGF)/basic fibroblast growth factor (bFGF) supplementation. Neurospheres were seeded onto poly-D-lysine/laminin-coated tissue culture plastic and cultured in a gliogenic cocktail containing &#946;-Heregulin, bFGF, and platelet-derived growth factor (PDGF) to generate Schwann cell-like cells (SCLCs). SCLCs were directed to fate commitment via coculture for 2 weeks with purified dorsal root ganglia (DRG) neurons obtained from E14-15 pregnant Sprague Dawley rats. Mature Schwann cells demonstrate persistence in S100&#946;/p75 expression and can form myelin segments. Cells generated in this manner have potential applications in autologous cell transplantation following spinal cord injury, as well as in disease modeling.

Marrow stromal cells (MSCs) with neural potential exist within the bone marrow. Our protocol enriches this population of cells via hypoxic preconditioning and thereafter directs them to become mature Schwann cells.

성숙한 슈반 세포 생성을위한 골수 유래 선조 세포의 저산소 전처리

This manuscript describes a means to enrich for neural progenitors from the marrow stromal cell (MSC) population and thereafter to direct them to the ...

A Method for Characterizing Embryogenesis in Arabidopsis

Given the highly predictable nature of their development, Arabidopsis embryos have been used as a model for studies of morphogenesis in plants. However, early stage plant embryos are small and contain few cells, making them difficult to observe and analyze. A method is described here for characterizing pattern formation in plant embryos under a microscope using the model organism Arabidopsis. Following the clearance of fresh ovules using Hoyer's solution, the cell number in and morphology of embryos could be observed, and their developmental stage could be determined by differential interference contrast microscopy using a 100X oil immersion lens. In addition, the expression of specific marker proteins tagged with Green Fluorescent Protein (GFP) was monitored to annotate cell identity specification during embryo patterning by confocal laser scanning microscopy. Thus, this method can be used to observe pattern formation in wild-type plant embryos at the cellular and molecular levels, and to characterize the role of specific genes in embryo patterning by comparing pattern formation in embryos from wild-type plants and embryo-lethal mutants. Therefore, the method can be used to characterize embryogenesis in Arabidopsis.

A Method for Characterizing Embryogenesis in Arabidopsis

This protocol outlines a method for observing embryogenesis in Arabidopsis via ovule clearance followed by the inspection of embryo pattern formation under a microscope.

애기 에서 Embryogenesis를 특성화 하는 방법

Given the highly predictable nature of their development, Arabidopsis embryos have been used as a model for studies of morphogenesis in plants. However, ...

A Novel Use of Three-dimensional High-frequency Ultrasonography for Early Pregnancy Characterization in the Mouse

High-frequency ultrasonography (HFUS) is a common method to non-invasively monitor the real-time development of the human fetus in utero. The mouse is routinely used as an in vivo model to study embryo implantation and pregnancy progression. Unfortunately, such murine studies require pregnancy interruption to enable follow-up phenotypic analysis. To address this issue, we used three-dimensional (3-D) reconstruction of HFUS imaging data for early detection and characterization of murine embryo implantation sites and their individual developmental progression in utero. Combining HFUS imaging with 3-D reconstruction and modeling, we were able to accurately quantify embryo implantation site number as well as monitor developmental progression in pregnant C57BL6J/129S mice from 5.5 days post coitus (d.p.c.) through to 9.5 d.p.c. with the use of a transducer. Measurements included: number, location, and volume of implantation sites as well as inter-implantation site spacing; embryo viability was assessed by cardiac activity monitoring. In the immediate post-implantation period (5.5 to 8.5 d.p.c.), 3-D reconstruction of the gravid uterus in both mesh and solid overlay format enabled visual representation of the developing pregnancies within each uterine horn. As genetically engineered mice continue to be used to characterize female reproductive phenotypes derived from uterine dysfunction, this method offers a new approach to detect, quantify, and characterize early implantation events in vivo. This novel use of 3-D HFUS imaging demonstrates the ability to successfully detect, visualize, and characterize embryo-implantation sites during early murine pregnancy in a non-invasive manner. The technology offers a significant improvement over current methods, which rely on the interruption of pregnancies for gross tissue and histopathologic characterization. Here we use a video and text format to describe how to successfully perform ultrasounds of early murine pregnancy to generate reliable and reproducible data with reconstruction of the uterine form in mesh and solid 3-D images.

Mice are widely used to study gestational biology. However, pregnancy termination is required for such studies which precludes longitudinal investigations and necessitates the use of large numbers of animals. Therefore, we describe a non-invasive technique of high-frequency ultrasonography for early detection and monitoring of post-implantation events in the pregnant mouse.

마우스에서 초기 임신 특성에 대 한 3 차원 높은-주파수 초음파의 새로운 사용

High-frequency ultrasonography (HFUS) is a common method to non-invasively monitor the real-time development of the human fetus in utero. The mouse is ...

Generation of Scaffold-free, Three-dimensional Insulin Expressing Pancreatoids from Mouse Pancreatic Progenitors In Vitro

The pancreas is a complex organ composed of many different cell types that work together to regulate blood glucose homeostasis and digestion. These cell types include enzyme-secreting acinar cells, an arborized ductal system responsible for the transportation of enzymes to the gut, and hormone-producing endocrine cells. 
Endocrine beta-cells are the sole cell type in the body that produce insulin to lower blood glucose levels. Diabetes, a disease characterized by a loss or the dysfunction of beta-cells, is reaching epidemic proportions. Thus, it is essential to establish protocols to investigate beta-cell development that can be used for screening purposes to derive the drug and cell-based therapeutics. While the experimental investigation of mouse development is essential, in vivo studies are laborious and time-consuming. Cultured cells provide a more convenient platform for screening; however, they are unable to maintain the cellular diversity, architectural organization, and cellular interactions found in vivo. Thus, it is essential to develop new tools to investigate pancreatic organogenesis and physiology.
Pancreatic epithelial cells develop in the close association with mesenchyme from the onset of organogenesis as cells organize and differentiate into the complex, physiologically competent adult organ. The pancreatic mesenchyme provides important signals for the endocrine development, many of which are not well understood yet, thus difficult to recapitulate during the in vitro culture. Here, we describe a protocol to culture three-dimensional, cellular complex mouse organoids that retain mesenchyme, termed pancreatoids. The e10.5 murine pancreatic bud is dissected, dissociated, and cultured in a scaffold-free environment. These floating cells self-assemble with mesenchyme enveloping the developing pancreatoid and a robust number of endocrine beta-cells developing along with the acinar and the duct cells. This system can be used to study the cell fate determination, structural organization, and morphogenesis, cell-cell interactions during organogenesis, or for the drug, small molecule, or genetic screening.

Generation of Scaffold-free, Three-dimensional Insulin Expressing Pancreatoids from Mouse Pancreatic Progenitors In Vitro

Here, we present a protocol to generate insulin expressing 3D murine pancreatoids from free-floating e10.5 dissociated pancreatic progenitors and the associated mesenchyme.

비 계, 3 차원 인슐린 표현 Pancreatoids 마우스 췌 장 창시자에 체 외에서 의 세대

The pancreas is a complex organ composed of many different cell types that work together to regulate blood glucose homeostasis and digestion. These cell ...

Preparation of Small RNA Libraries for Sequencing from Early Mouse Embryos

MicroRNAs (miRNAs) are important for the complex regulation of cell fate decisions and developmental timing. In vivo studies of the contribution of miRNAs during early development are technically challenging due to the limiting cell number. Moreover, many approaches require a miRNA of interest to be defined in assays such as northern blotting, microarray, and qPCR. Therefore, the expression of many miRNAs and their isoforms have not been studied during early development. Here, we demonstrate a protocol for small RNA sequencing of sorted cells from early mouse embryos to enable relatively unbiased profiling of miRNAs in early populations of neural crest cells. We overcome the challenges of low cell input and size selection during library preparation using amplification and gel-based purification. We identify embryonic age as a variable accounting for variation between replicates and stage-matched mouse embryos must be used to accurately profile miRNAs in biological replicates. Our results suggest that this method can be broadly applied to profile the expression of miRNAs from other lineages of cells. In summary, this protocol can be used to study how miRNAs regulate developmental programs in different cell lineages of the early mouse embryo.

We describe a technique for profiling microRNAs in early mouse embryos. This protocol overcomes the challenge of low cell input and small RNA enrichment. This assay can be used to analyze changes in miRNA expression over time in different cell lineages of the early mouse embryo.

초기 마우스 배아에서 시퀀싱을 위한 작은 RNA 라이브러리 의 준비

MicroRNAs (miRNAs) are important for the complex regulation of cell fate decisions and developmental timing. In vivo studies of the contribution of miRNAs ...