Wir möchten, dass beim Erwerb von TEM-Aufnahmen von gefilterten superparamagnetische Nanopartikel und bei der Durchführung ihrer Röntgenanalyse G. Fulda (Elektronenmikroskopie Zentrum, Universität Rostock, Deutschland) für die technische Unterstützung. Die Arbeit an der RTC Rostock durchgeführt wurde vom Bundesministerium für Bildung und Forschung Deutschland (FKZ 0312138A, FKZ 316159 und VIP + 03VP00241) und dem Staat Mecklenburg-Vorpommern mit EU-Strukturfonds (ESF / IV-WM-B34- unterstützt 0030/10 und ESF / IV-BM-B35-0010 / 12) und von der DFG (DA 1296-1), die Damp-Foundation und der deutschen Herz Foundation (F / 01/12). Frank Wiekhorst wurde von dem EU FP7 Forschungsprogramm &quot;Nanomag&quot; FP7-NMP-2013-LARGE-7 unterstützt.

Wir haben keine konkurrierenden finanziellen Interessen offen zu legen.

Die Herstellung von gentechnisch veränderten Zellen, beladen mit superparamagnetische Nanopartikel für ihre weiteren magnetisch gesteuerte Führung wird in dem aktuellen Protokoll dargestellt. Die erfolgreiche Anwendung dieser Strategie ermöglicht die Auflösung einiger Schwierigkeiten der Zelltherapie, wie geringe Retention und schlechte Einpflanzung in dem verletzten Bereich 2, 3, 4, durch ein anzielbare Zellprodukt zur Tr...

Gen- und Zelltherapie sind leistungsfähige Werkzeuge, die das Potenzial haben, um die aktuellen Herausforderungen in CVD-Behandlung zu lösen. Trotz der Tatsache , dass diese beiden Ansätze derzeit in klinischen Studien getestet werden, sind sie noch nicht bereit für eine breite klinische Anwendung 1. Bemerkenswert ist, ein gemeinsames Konzept für die Herausforderungen der Gen- und Zelltherapie zu bekämpfen ist multifunktional Genabgabevektoren geeignet für die klinische Anwendung zu entwickeln. Der Mangel an sicheren und effizienten Genabgabesysteme ist das Hauptanliegen der Gentherapie. Zur gleichen Zeit, die gentechnische Veränderung von Zellprodukten vor der Transplantation konnte die schweren Herausforderungen der Zelltherapie, wie geringe Effizienz (zB im Herzfeld, nur ca. 5% der funktionellen Verbesserung erreichte nach Stammzelltransplantation überwunden 1 ) und schlechte Retention / Verpflanzung an der Stelle der Verletzung (dh fällt Zellbindung unter von 5 bis 10% innerhalb von Minuten bis Stunden post-Anwendung, unabhängig vom Applikationsweg 2, 3, 4). Bisher überschreiten virale Vektoren stark nicht-virale Systeme in Bezug auf Effizienz, die in ihrer breiteren Anwendung in klinischen Studien (~ 67%) 5 geführt hat. Allerdings trägt virales Vehikel ernsthafte Risiken, wie Immunogenität (und die nachfolgende Entzündungsreaktion mit schweren Komplikationen), Onkogenizität und Einschränkungen in der Größe des durch genetische Material 6. Aufgrund dieser Sicherheitsbedenken und die hohen Kosten der Produktion viraler Vektor, ist die Verwendung von nicht-viralen Systemen bevorzugt in bestimmten Fällen 7, 8. Es ist besonders geeignet für Erkrankungen , die transient genetische Korrektur, wie beispielsweise die Expression von Wachstumsfaktoren erfordern Steuerung der Angiogenese (zB für die CVD - Behandlung) oder die delivery von Impfstoffen. In unserer Gruppe wurde ein Abgabesystem durch die Kombination von verzweigtem 25 kDa-Polyethylenimin (PEI) und superparamagnetische Eisenoxid - Nanopartikel (MNP) miteinander verbunden ist durch Biotin-Streptavidin - Wechselwirkung 9 ausgelegt. Dieser Vektor ist ein mögliches Instrument für die gentechnische Veränderung von Zellen, so dass für ihre gleichzeitige Magnetisierung vor der Transplantation. Letzteres stellt eine Basis für die magnetische Orientierung / Retention, die heutzutage besonders vielversprechend, da die erweiterte Targeting Techniken erfolgreich 10 entwickelt. Zudem 12 die resultierenden magnetisch ansprechenden Zellen , die das Potential haben , nicht-invasiv durch Magnetresonanztomographie (MRI) oder Magnetic Particle Imaging 11, überwacht zu werden. Im Fall des PEI / MNP-Vektor, stellt sicher, Polyamin-Kondensations Nukleinsäure- und somit Schutz vor abbauenden Faktor<html> s, Vektor - Internalisierung in Zellen und endosomalen 5 entkommen. Die MNP ergänzen die Eigenschaften von PEI, nicht nur in Bezug auf die magnetische Orientierung, sondern auch durch die bekannte PEI Toxizität reduzieren 7, 13, 14. Zuvor in Bezug auf die Abgabeeffizienz (dh pDNA und miRNA) und Sicherheits PEI / MNP Vektor Eigenschaften wurden eingestellt durch Fibroblasten und humanen mesenchymalen Stammzellen , 15, 16 verwendet wird . In diesem Manuskript wird ein ausführliches Protokoll zur Anwendung von PEI / MNP zur Erzeugung von miRNA-modifizierten Zellen wird 17 beschrieben. Zu diesem Zweck werden HUVECs verwendet und ein etabliertes Modell für die in - vitro - Angiogenese darstellen. Sie sind schwierig zu transfizieren und sind anfällig für toxische Einflüsse 18, 19,ass = &quot;xref&quot;&gt; 20. Zusätzlich stellen wir einen Algorithmus solche Zellen in vitro zu bewerten, einschließlich ihrer Ausrichtung, die interzelluläre Kommunikation, und MRI - Erkennung.

<table><tbody><tr><td>PEI 25 kDa</td><td>Sigma Aldrich</td><td>408727</td><td></td></tr><tr><td>EZ-Link Sulfo-NHS-LC-Biotin</td><td>Thermo Scientific</td><td>21335</td><td></td></tr><tr><td>PD-10 Desalting Columns</td><td>GE Healthcare</td><td>17085101</td><td>Containing Sephadex G-25 Medium</td></tr><tr><td>Ninhydrin Reagent solution 2%</td><td>Sigma Aldrich</td><td>7285</td><td></td></tr><tr><td>Glycine</td><td>Sigma Aldrich</td><td>410225</td><td></td></tr><tr><td>Pierce Biotin Quantitation Kit</td><td>Thermo Scientific</td><td>28005</td><td></td></tr><tr><td>Microplate reader Model 680</td><td>Bio-Rad</td><td></td><td></td></tr><tr><td>Streptavidin MagneSphere Paramagnetic Particles</td><td>Promega</td><td>Z5481</td><td></td></tr><tr><td>Millex-HV PVDF Filter</td><td>Merck</td><td>SLHV013SL</td><td>0.45 &amp;micro;m</td></tr><tr><td>Libra 120 transmission electron microscope</td><td>Zeiss</td><td></td><td>Acceleration Voltage 120&amp;nbsp;kV</td></tr><tr><td>Sapphire X-ray detector</td><td>EDAX-Amatek</td><td></td><td></td></tr><tr><td>Cell culture plastic</td><td>TPP</td><td></td><td></td></tr><tr><td>NHS-Esther Atto 565</td><td>ATTO-TEC GmbH</td><td>AD 565-31</td><td></td></tr><tr><td>NHS-Esther Atto 488&amp;nbsp;</td><td>ATTO-TEC GmbH</td><td>AD 488-31</td><td></td></tr><tr><td>Cy5 miRNA Label IT kit</td><td>Mirus Bio</td><td>MIR 9650</td><td></td></tr><tr><td>Biotin Atto 565</td><td>ATTO-TEC GmbH</td><td>AD 565-71</td><td></td></tr><tr><td>Collagense Type IV Gibco</td><td>Thermo Scientific</td><td>17104019</td><td></td></tr><tr><td>Endothelial growth medium, EGM-2</td><td>Lonza</td><td>CC-3156 &amp;amp; CC-4176</td><td></td></tr><tr><td>Penicillin/Streptomycin</td><td>Thermo Scientific</td><td>15140122</td><td>100 U/mL, 100 &amp;micro;g/mL</td></tr><tr><td>Matrigel</td><td>BD Biosciences</td><td>356234</td><td></td></tr><tr><td>anti-PECAM-1 antibody</td><td>Santa Cruz</td><td>sc-1506</td><td></td></tr><tr><td>MS MACS columns</td><td>Miltenyi Biotec&amp;nbsp;</td><td>130-042-201</td><td></td></tr><tr><td>Near-IR Live/Dead Cell Stain Kit</td><td>Thermo Scientific</td><td>L10119</td><td></td></tr><tr><td>Cy3 Dye-Labeled Pre-miR Negative Control</td><td>Thermo Scientific</td><td>AM17120</td><td>&quot;Cy3-miR&quot; or &quot;Cyanine-miR3&quot; in the manuscript</td></tr><tr><td>Pre-miR miRNA Precursor Molecules - Negative Control&amp;nbsp;</td><td>Thermo Scientific</td><td>AM17110</td><td>&quot;scr-miR&quot; in the manuscript</td></tr><tr><td>Anti-hsa-miR92a-3p synthetic Inhibitor&amp;nbsp;</td><td>Thermo Scientific</td><td>AM10916</td><td></td></tr><tr><td>LSM 780 ELYRA PS.1 system</td><td>Zeiss</td><td></td><td></td></tr><tr><td>Paraformaldehyde</td><td>Sigma Aldrich</td><td>158127</td><td>4% solution in PBS</td></tr><tr><td>DAPI nuclear stain</td><td>Thermo Scientific</td><td>D1306</td><td></td></tr><tr><td>NucleoSpin RNA isolation Kit</td><td>Machery-Nagel</td><td>740955</td><td></td></tr><tr><td>mirVana miRNA Isolation Kit</td><td>Thermo Scientific</td><td>AM1560</td><td></td></tr><tr><td>TaqMan MicroRNA Reverse Transcription Kit</td><td>Thermo Scientific</td><td>4366596</td><td></td></tr><tr><td>StepOnePlus Real-Time PCR System</td><td>Applied Biosystems</td><td></td><td></td></tr><tr><td>High-Capacity cDNA Reverse Transcription Kit</td><td>Thermo Scientific</td><td>4368814</td><td></td></tr><tr><td>hsa-miR-92a TaqMan assay</td><td>Thermo Scientific</td><td>000431</td><td>Mature miRNA Sequence: UAUUGCACUUGUCCCGGCCUGU</td></tr><tr><td>FastGene Taq Ready Mix</td><td>Nippon Genetics</td><td>LS27</td><td></td></tr><tr><td>ITGA5 TaqMan assay</td><td>Thermo Scientific</td><td>Hs01547673_m1</td><td></td></tr><tr><td>RNU6B TaqMan assay</td><td>Thermo Scientific</td><td>001093</td><td></td></tr><tr><td>18S rRNA Endogenous Control</td><td>Thermo Scientific</td><td>4333760F</td><td></td></tr><tr><td>Gelatin</td><td>Sigma Aldrich</td><td>G7041</td><td></td></tr><tr><td>CellTrace Calcein Red-Orange</td><td>Thermo Scientific</td><td>C34851</td><td></td></tr><tr><td>PBS</td><td>Pan Biotech</td><td>P04-53500</td><td></td></tr><tr><td>BSA</td><td>Sigma Aldrich</td><td></td><td></td></tr><tr><td>MACS buffer</td><td>Miltenyi Biotec&amp;nbsp;</td><td>130-091-221</td><td></td></tr><tr><td>Agarose</td><td>Sigma Aldrich</td><td>A9539</td><td></td></tr><tr><td>7.1 Tesla animal MRI system</td><td>Bruker Corporation</td><td>A7906</td><td></td></tr><tr><td>ImageJ software</td><td>National Institutes of Health</td><td></td><td>upgraded with an AngiogenesisAnalyzer (NIH)</td></tr><tr><td>MPS device</td><td>Bruker Biospin</td><td></td><td></td></tr><tr><td>Matlab software</td><td>Mathworks</td><td></td><td></td></tr><tr><td>Ring Neodym Magnet&amp;nbsp;</td><td>magnets4you GmbH</td><td>RM-10x04x05-G</td><td>&amp;oslash; 10 mm; remanescence is ~ 1.3&amp;nbsp;T, coercivity &amp;ge; 955 kA/m</td></tr><tr><td>Click-iT EdU Alexa Fluor 647 Imaging Kit</td><td>Thermo Scientific</td><td>C10340</td><td></td></tr><tr><td>FluorSave Reagent</td><td>Merck</td><td>345789</td><td></td></tr><tr><td>Ultrasonic bath</td><td>Bandelin electronic</td><td>Type: RK 100 SH</td><td></td></tr></tbody></table>

preparation and in vitro characterization of magnetized mir-modified endothelial cells

Bis heute sind die verfügbaren chirurgischen und pharmakologischen Behandlungen für Herz-Kreislauf-Erkrankungen (CVD) sind begrenzt und oft palliativ. Zur gleichen Zeit, Gen- und Zelltherapien sind vielversprechende alternative Ansätze für eine CVD-Behandlung. Allerdings ist die breite klinische Anwendung der Gentherapie durch den Mangel an geeigneten Genabgabesysteme stark eingeschränkt. Die Entwicklung geeigneter Genübertragungsvektoren können, eine Lösung für die aktuellen Herausforderungen in der Zelltherapie bereitzustellen. Insbesondere bestehende Nachteile, wie begrenzte Effizienz und niedrige Zelleinlagerungen im Organe verletzt, konnte durch entsprechendes Zell - Engineering (dh genetische) vor der Transplantation überwunden werden. Das dargestellte Protokoll beschreibt die effiziente und sichere vorübergehende Modifikation von Endothelzellen ein Polyethylenimin superparamagnetischen Nanopartikel (PEI / MNP) -basierten Auslieferungsvektor verwendet wird. Außerdem werden der Algorithmus und Methoden zur Zellcharakterisierung definiert. Die erfolgreiche intracelluLAR Lieferung von microRNA (du) in menschliche Nabelvenen-Endothelzellen (HUVECs) hat, ohne die Lebensfähigkeit der Zellen zu beeinflussen, Funktionalität oder die interzelluläre Kommunikation erzielt worden. Darüber hinaus wurde dieser Ansatz eine starke funktionelle Wirkung in eingeführten exogen ich verursachen unter Beweis gestellt. Wichtig ist, gewährleistet die Anwendung dieser MNP-basierte Vektorzelle Magnetisierung, mit Möglichkeiten des magnetischen Ausrichtung und nicht-invasiven MRI-Tracing begleitet. Dies kann eine Grundlage für die magnetisch geführt wird, gentechnisch hergestellten Zelltherapeutika bereitzustellen, die nicht-invasiv mit MRI überwacht werden kann.

Der Hauptzweck des vorgeschlagenen Protokolls ist magnetisch ansprechende ich-modifizierten Zellen zu erzeugen , und ihre genaue Charakterisierung (Figur 1) zu leiten. Als Ergebnis sollten effizient transfizierten Zellen, die auf magnetische Auswahl und Führung und nachweisbar mit MRI, erhalten werden. Zunächst wird die Identitäten von isolierten HUVECs wurden durch typische Färbung mit dem endothelialen M...

Watch this Scientific Journal Video about Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells at JoVE.com

Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells

Dieses Manuskript beschreibt die effiziente, nicht-virale Abgabe von miR-Zellen durch einen PEI / MNP-Vektor und ihre Magnetisierung an Endothelzellen. Somit kann zusätzlich zu genetischer Veränderung, ermöglicht dieser Ansatz für die magnetische Zellführung und MRI Nachweisbarkeit. Die Technik kann verwendet werden, um die Eigenschaften von therapeutischen Zellprodukten zu verbessern.

Vorbereitung und<em&gt; In Vitro</em&gt; Charakterisierung von Magnetized miR-modifizierten Endothelzellen

To date, the available surgical and pharmacological treatments for cardiovascular diseases (CVD) are limited and often palliative. At the same time, gene ...

preparation-vitro-characterization-magnetized-mir-modified

Universidad de Cartagena UDEC

Research

JoVE Journal

Medicine

Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells

7.6K Aufrufe.  University of Rostock.  Dieses Manuskript beschreibt die effiziente, nicht-virale Abgabe von miR-Zellen durch einen PEI / MNP-Vektor und ihre Magnetisierung an Endothelzellen. Somit kann zusätzlich zu genetischer Veränderung, ermöglicht dieser Ansatz für die magnetische Zellführung und MRI Nachweisbarkeit. Die Technik kann verwendet werden, um die Eigenschaften von therapeutischen Zellprodukten zu verbessern. 

Serie: Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells

Generation of an Immortalized Murine Brain Microvascular Endothelial Cell Line as an In Vitro Blood Brain Barrier Model

Epithelial and endothelial cells (EC) are building paracellular barriers which protect the tissue from the external and internal environment. The blood-brain barrier (BBB) consisting of EC, astrocyte end-feet, pericytes and the basal membrane is responsible for the protection and homeostasis of the brain parenchyma. In vitro BBB models are common tools to study the structure and function of the BBB at the cellular level. A considerable number of different in vitro BBB models have been established for research in different laboratories to date. Usually, the cells are obtained from bovine, porcine, rat or mouse brain tissue (discussed in detail in the review by Wilhelm et al. 1). Human tissue samples are available only in a restricted number of laboratories or companies 2,3. While primary cell preparations are time consuming and the EC cultures can differ from batch to batch, the establishment of immortalized EC lines is the focus of scientific interest.
Here, we present a method for establishing an immortalized brain microvascular EC line from neonatal mouse brain. We describe the procedure step-by-step listing the reagents and solutions used. The method established by our lab allows the isolation of a homogenous immortalized endothelial cell line within four to five weeks. The brain microvascular endothelial cell lines termed cEND 4 (from cerebral cortex) and cerebEND 5 (from cerebellar cortex), were isolated according to this procedure in the F&ouml;rster laboratory and have been effectively used for explanation of different physiological and pathological processes at the BBB. Using cEND and cerebEND we have demonstrated that these cells respond to glucocorticoid- 4,6-9 and estrogen-treatment 10 as well as to pro-infammatory mediators, such as TNFalpha 5,8. Moreover, we have studied the pathology of multiple sclerosis 11 and hypoxia 12,13 on the EC-level. The cEND and cerebEND lines can be considered as a good tool for studying the structure and function of the BBB, cellular responses of ECs to different stimuli or interaction of the EC with lymphocytes or cancer cells.

Generation of an Immortalized Murine Brain Microvascular Endothelial Cell Line as an In Vitro Blood Brain Barrier Model

This method describes how to isolate and immortalize microvascular endothelial cells from mouse brain. We describe a step-by-step protocol starting from the homogenization of brain tissue, digestion steps, seeding and immortalization of the cells. Usually, it takes about five weeks to obtain a homogenous, immortalized microvascular endothelial cell line.

Erzeugung eines Immortalisierte Murine Gehirn mikrovaskulären Endothelzellen Zelllinie als<em&gt; In Vitro</em&gt; Blut-Hirn-Barriere Modell

Epithelial and endothelial cells (EC) are building paracellular barriers which protect the tissue from the external and internal environment. The ...

Forschung

Neurowissenschaften

Ferromagnetic Bare Metal Stent for Endothelial Cell Capture and Retention

Rapid endothelialization of cardiovascular stents is needed to reduce stent thrombosis and to avoid anti-platelet therapy which can reduce bleeding risk. The feasibility of using magnetic forces to capture and retain endothelial outgrowth cells (EOC) labeled with super paramagnetic iron oxide nanoparticles (SPION) has been shown previously. But this technique requires the development of a mechanically functional stent from a magnetic and biocompatible material followed by in-vitro and in-vivo testing to prove rapid endothelialization. We developed a weakly ferromagnetic stent from 2205 duplex stainless steel using computer aided design (CAD) and its design was further refined using finite element analysis (FEA). The final design of the stent exhibited a principal strain below the fracture limit of the material during mechanical crimping and expansion. One hundred stents were manufactured and a subset of them was used for mechanical testing, retained magnetic field measurements, in-vitro cell capture studies, and in-vivo implantation studies. Ten stents were tested for deployment to verify if they sustained crimping and expansion cycle without failure. Another 10 stents were magnetized using a strong neodymium magnet and their retained magnetic field was measured. The stents showed that the retained magnetism was sufficient to capture SPION-labeled EOC in our in-vitro studies. SPION-labeled EOC capture and retention was verified in large animal models by implanting 1 magnetized stent and 1 non-magnetized control stent in each of 4 pigs. The stented arteries were explanted after 7 days and analyzed histologically. The weakly magnetic stents developed in this study were capable of attracting and retaining SPION-labeled endothelial cells which can promote rapid healing.

Our goals were to design, manufacture and test ferromagnetic stents for endothelial cell capture. Ten stents were tested for fracture and 10 more stents were tested for retained magnetism. Finally, 10 stents were tested in-vitro and 8 more stents were implanted in 4 pigs to show cell capture and retention.

Ferromagnetische Bare Metal Stent für Endothelzellen-Abscheidung und Retention

Rapid endothelialization of cardiovascular stents is needed to reduce stent thrombosis and to avoid anti-platelet therapy which can reduce bleeding risk. ...

Biotechnik

Synthesis of Cationized Magnetoferritin for Ultra-fast Magnetization of Cells

Many important biomedical applications, such as cell imaging and remote manipulation, can be achieved by labeling cells with superparamagnetic iron oxide nanoparticles (SPIONs). Achieving sufficient cellular uptake of SPIONs is a challenge that has traditionally been met by exposing cells to elevated concentrations of SPIONs or by prolonging exposure times (up to 72 hr). However, these strategies are likely to mediate toxicity. Here, we present the synthesis of the protein-based SPION magnetoferritin as well as a facile surface functionalization protocol that enables rapid cell magnetization using low exposure concentrations. The SPION core of magnetoferritin consists of cobalt-doped iron oxide with an average particle diameter of 8.2 nm mineralized inside the cavity of horse spleen apo-ferritin. Chemical cationization of magnetoferritin produced a novel, highly membrane-active SPION that magnetized human mesenchymal stem cells (hMSCs) using incubation times as short as one minute and iron concentrations as lows as 0.2 mM.

A protocol for the synthesis and cationization of cobalt-doped magnetoferritin is presented, as well as a method to rapidly magnetize stem cells with cationized magnetoferritin.

Synthese von kationisiertem Magnetoferritin für ultraschnelle Magnetisierungs von Zellen

Many important biomedical applications, such as cell imaging and remote manipulation, can be achieved by labeling cells with superparamagnetic iron oxide ...

A Patient-Derived Xenograft Model for Venous Malformation

Venous malformation (VM) is a vascular anomaly that arises from impaired development of the venous network resulting in dilated and often dysfunctional veins. The purpose of this article is to carefully describe the establishment of a murine xenograft model that mimics human VM and is able to reflect patient heterogeneity. Hyper-activating non-inherited (somatic) TEK (TIE2) and PIK3CA mutations in endothelial cells (EC) have been identified as the main drivers of pathological vessel enlargement in VM. The following protocol describes the isolation, purification and expansion of patient-derived EC expressing mutant TIE2 and/or PIK3CA. These EC are injected subcutaneously into the back of immunodeficient athymic mice to generate ectatic vascular channels. Lesions generated with TIE2 or PIK3CA-mutant EC are visibly vascularized within 7&#8210;9 days of injection and recapitulate histopathological features of VM patient tissue. This VM xenograft model provides a reliable platform to investigate the cellular and molecular mechanisms driving VM formation and expansion. In addition, this model will be instrumental for translational studies testing the efficacy of novel drug candidates in preventing the abnormal vessel enlargement seen in human VM.

We present a detailed protocol to generate a murine xenograft model of venous malformation. This model is based on the subcutaneous injection of patient-derived endothelial cells containing hyper-activating TIE2 and/or PIK3CA gene mutations. Xenograft lesions closely recapitulate the histopathological features of VM patient tissue.

Ein vom Patienten abgeleitetes Xenograft-Modell für Venöse Fehlbildungen

Venous malformation (VM) is a vascular anomaly that arises from impaired development of the venous network resulting in dilated and often dysfunctional ...

Entwicklungsbiologie

Isolation of Primary Murine Brain Microvascular Endothelial Cells

The blood-brain-barrier is ultrastructurally assembled by a monolayer of brain microvascular endothelial cells (BMEC) interconnected by a junctional complex of tight and adherens junctions. Together with other cell-types such as astrocytes or pericytes, they form the neurovascular unit (NVU), which specifically regulates the interchange of fluids, molecules and cells between the peripheral blood and the CNS. Through this complex and dynamic system BMECs are involved in various processes maintaining the homeostasis of the CNS. A dysfunction of the BBB is observed as an essential step in the pathogenesis of many severe CNS diseases. However, specific and targeted therapies are very limited, as the underlying mechanisms are still far from being understood. 
Animal and in vitro models have been extensively used to gain in-depth understanding of complex physiological and pathophysiological processes. By reduction and simplification it is possible to focus the investigation on the subject of interest and to exclude a variety of confounding factors. However, comparability and transferability are also reduced in model systems, which have to be taken into account for evaluation. The most common animal models are based on mice, among other reasons, mainly due to the constantly increasing possibilities of methodology. In vitro studies of isolated murine BMECs might enable an in-depth analysis of their properties and of the blood-brain-barrier under physiological and pathophysiological conditions. Further insights into the complex mechanisms at the BBB potentially provide the basis for new therapeutic strategies.
This protocol describes a method to isolate primary murine microvascular endothelial cells by a sequence of physical and chemical purification steps. Special considerations for purity and cultivation of MBMECs as well as quality control, potential applications and limitations are discussed.

Brain microvascular endothelial cells (BMEC) are interconnected by specific junctional proteins forming a highly regulated barrier separating blood and the central nervous system (CNS), the so-called blood-brain-barrier (BBB). The isolation of primary murine brain microvascular endothelial cells, as discussed in this protocol, enables detailed in vitro studies of the BBB.

Isolierung von primären murinen Gehirn mikrovaskulären Endothelzellen

The blood-brain-barrier is ultrastructurally assembled by a monolayer of brain microvascular endothelial cells (BMEC) interconnected by a junctional ...

An In Vitro Model of the Blood-brain Barrier Using Impedance Spectroscopy: A Focus on T Cell-endothelial Cell Interaction

Breakdown of the blood-brain barrier (BBB) is a critical step in the development of autoimmune diseases such as multiple sclerosis (MS) and its animal model experimental autoimmune encephalomyelitis (EAE). This process is characterized by the transmigration of activated T cells across brain endothelial cells (ECs), the main constituents of the BBB. However, the consequences on brain EC function upon interaction with such T cells are largely unknown. Here we describe an assay that allows for the evaluation of primary mouse brain microvascular EC (MBMEC) function and barrier integrity during the interaction with T cells over time. The assay makes use of impedance cell spectroscopy, a powerful tool for studying EC monolayer integrity and permeability, by measuring changes in transendothelial electrical resistance (TEER) and cell layer capacitance (Ccl). In direct contact with ECs, stimulated but not na&#239;ve T cells are capable of inducing EC monolayer dysfunction, as visualized by a decrease in TEER and an increase in Ccl. The assay records changes in EC monolayer integrity in a continuous and automated fashion. It is sensitive enough to distinguish between different strengths of stimuli and levels of T cell activation and it enables the investigation of the consequences of a targeted modulation of T cell-EC interaction using a wide range of substances such as antibodies, pharmacological reagents and cytokines. The technique can also be used as a quality control for EC integrity in in vitro T-cell transmigration assays. These applications make it a versatile tool for studying BBB properties under physiological and pathophysiological conditions.

An In Vitro Model of the Blood-brain Barrier Using Impedance Spectroscopy: A Focus on T Cell-endothelial Cell Interaction

Here, we describe an in vitro murine model of the blood-brain barrier that makes use of impedance cell spectroscopy, with a focus on the consequences on endothelial cell integrity and permeability upon interaction with activated T cells.

Ein<em&gt; In Vitro</em&gt; Modell der Blut-Hirn-Schranke Mit Impedanzspektroskopie: Ein Fokus auf T-Zell-Endothelzellinteraktion

Breakdown of the blood-brain barrier (BBB) is a critical step in the development of autoimmune diseases such as multiple sclerosis (MS) and its animal ...

Immunologie und Infektion

Protocol for MicroRNA Transfer into Adult Bone Marrow-derived Hematopoietic Stem Cells to Enable Cell Engineering Combined with Magnetic Targeting

While CD133+ hematopoietic stem cells (SCs) have been proven to provide high potential in the field of regenerative medicine, their low retention rates after injection into injured tissues as well as the observed massive cell death rates lead to very restricted therapeutic effects. To overcome these limitations, we sought to establish a non-viral based protocol for suitable cell engineering prior to their administration. The modification of human CD133+ expressing SCs using microRNA (miR) loaded magnetic polyplexes was addressed with respect to uptake efficiency and safety as well as the targeting potential of the cells. Relying on our protocol, we can achieve high miR uptake rates of 80&#8211;90% while the CD133+ stem cell properties remain unaffected. Moreover, these modified cells offer the option of magnetic targeting. We describe here a safe and highly efficient procedure for the modification of CD133+ SCs. We expect this approach to provide a standard technology for optimization of therapeutic stem cell effects and for monitoring of the administered cell product via magnetic resonance imaging (MRI).

This protocol illustrates a safe and efficient procedure to modify CD133+ hematopoietic stem cells. The presented non-viral, magnetic polyplex-based approach may provide a basis for the optimization of therapeutic stem cell effects as well as for monitoring the administered cell product via magnetic resonance imaging.

Protokoll für MicroRNA Transfer an adulten Knochenmark gewonnenen Hämatopoetischen Stammzellen Zelle Engineering kombiniert mit magnetischen Ausrichtung ermöglichen

While CD133+ hematopoietic stem cells (SCs) have been proven to provide high potential in the field of regenerative medicine, their low retention rates ...

Isolation of Primary Murine Skeletal Muscle Microvascular Endothelial Cells

The endothelial cells of skeletal muscle capillaries (muscle microvascular endothelial cells, MMEC) build up the barrier between blood stream and skeletal muscles regulating the exchange of fluids and nutrients as well as the immune response against infectious agents by controlling immune cell migration. For these functions, MMEC form a functional &#34;myovascular unit&#34; (MVU), with further cell types, such as fibroblasts, pericytes and skeletal muscle cells. Consequently, a dysfunction of MMEC and therefore the MVU contributes to a vast variety of myopathies. However, regulatory mechanisms of MMEC in health and disease remain insufficiently understood and their elucidation precedes more specific treatments for myopathies. The isolation and in-depth investigation of primary MMEC functions in the context of the MVU might facilitate a better understanding of these processes.
This article provides a protocol to isolate primary murine MMEC of the skeletal muscle by mechanical and enzymatic dissociation including purification and culture maintenance steps.

Microvascular endothelial cells of skeletal muscles (MMEC) shape the inner wall of muscle capillaries and regulate both, exchange of fluids/molecules and migration of (immune) cells between muscle tissue and blood. Isolation of primary murine MMEC, as described here, enables comprehensive in vitro investigations of the &#34;myovascular unit&#34;.

Isolierung der primären murinen Skelettmuskulatur mikrovaskuläre Endothelzellen

The endothelial cells of skeletal muscle capillaries (muscle microvascular endothelial cells, MMEC) build up the barrier between blood stream and skeletal ...

Differentiation of Human Induced Pluripotent Stem Cells to Brain Microvascular Endothelial Cell-Like Cells with a Mature Immune Phenotype

Blood-brain barrier (BBB) dysfunction is a pathological hallmark of many neurodegenerative and neuroinflammatory diseases affecting the central nervous system (CNS). Due to the limited access to disease-related BBB samples, it is still not well understood whether BBB malfunction is causative for disease development or rather a consequence of the neuroinflammatory or neurodegenerative process. Human induced pluripotent stem cells (hiPSCs) therefore provide a novel opportunity to establish in vitro BBB models from healthy donors and patients, and thus to study disease-specific BBB characteristics from individual patients. Several differentiation protocols have been established for deriving brain microvascular endothelial cell (BMEC)-like cells from hiPSCs. Consideration of the specific research question is mandatory for the correct choice of the respective BMEC-differentiation protocol. Here, we describe the extended endothelial cell culture method (EECM), which is optimized to differentiate hiPSCs into BMEC-like cells with a mature immune phenotype, allowing the study of immune cell-BBB interactions. In this protocol, hiPSCs are first differentiated into endothelial progenitor cells (EPCs) by activating Wnt/&#946;-catenin signaling. The resulting culture, which contains smooth muscle-like cells (SMLCs), is then sequentially passaged to increase the purity of endothelial cells (ECs) and to induce BBB-specific properties. Co-culture of EECM-BMECs with these SMLCs or conditioned medium from SMLCs allows for the reproducible, constitutive, and cytokine-regulated expression of EC adhesion molecules. Importantly, EECM-BMEC-like cells establish barrier properties comparable to primary human BMECs, and due to their expression of all EC adhesion molecules, EECM-BMEC-like cells are different from other hiPSC-derived in vitro BBB models. EECM-BMEC-like cells are thus the model of choice for investigating the potential impact of disease processes at the level of the BBB, with an impact on immune cell interaction in a personalized fashion.

Here, we describe a protocol, the extended endothelial cell culture method (EECM), that allows differentiation of pluripotent stem cells to brain microvascular endothelial cell (BMEC)-like cells. These cells show endothelial cell adhesion molecule expression and are thus a human blood-brain barrier model suitable to study immune cell interactions in vitro.

Differenzierung von humanen induzierten pluripotenten Stammzellen zu mikrovaskulären Endothelzellzellen des Gehirns mit einem reifen Immunphänotyp

Blood-brain barrier (BBB) dysfunction is a pathological hallmark of many neurodegenerative and neuroinflammatory diseases affecting the central nervous ...

Optimierte magnetische High-Yield-Produktion von Endosomen-abgeleiteten Nanovesikeln

A Magnetic Separation-Assisted High-Speed Homogenization Method for Large-Scale Production of Endosome-Derived Vesicles

Extracellular vesicles (EVs) have attracted significant attention in physiological and pathological research, disease diagnosis, and treatment; however, their clinical translation has been limited by the lack of scale-up manufacturing approaches. Therefore, this protocol provides a magnetic separation-assisted high-speed homogenization method for the large-scale production of endosome-derived nanovesicles as a new type of exosome mimics (EMs) derived from the endosomes, which have about 100-time higher yield than conventional ultracentrifugation method. In this method, magnetic nanoparticles (MNPs) were internalized by parental cells via endocytosis and were subsequently accumulated within their endosomes. Then, MNPs-loaded endosomes were collected and purified by hypotonic treatment and magnetic separation. A high-speed homogenizer was utilized to break MNP-loaded endosomes into monodisperse nanovesicles. The resulting endosome-derived vesicles feature the same biological origin and structure, characterized by nanoparticle tracking analysis, transmission electron microscope, and western blotting. Their morphology and protein composition are similar to native EVs, indicating that EMs may potentially serve as a low-cost and high-yield surrogate of native EVs for clinical translations.

Autor im Rampenlicht: Entwicklung eines großflächigen, reproduzierbaren Herstellungsverfahrens für Exosomenmimetika unter Verwendung magnetischer Nanopartikel 

Here, we describe a magnetic separation-assisted high-speed homogenization method for large-scale production of endosome-derived nanovesicles as a new type of exosome mimics (EMs) that share the same biological origin and similar structure, morphology, and protein composition of native extracellular vesicles (EVs).

Ein magnetabscheidungsunterstütztes Hochgeschwindigkeits-Homogenisierungsverfahren für die großtechnische Herstellung von Endosomen-abgeleiteten Vesikeln

Extracellular vesicles (EVs) have attracted significant attention in physiological and pathological research, disease diagnosis, and treatment; however, ...

Vorbereitung und

Zusammenfassung

Weitere Videos entdecken

Kapitel in diesem Video

Erzeugung eines Immortalisierte Murine Gehirn mikrovaskulären Endothelzellen Zelllinie als