Name: preparation and in vitro characterization of magnetized mir-modified endothelial cells
Uploaded: 2017-05-02T14:00:00.000+00:00
Duration: 9 min 58 s
Description: Watch this Scientific Journal Video about Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells at JoVE.com

우리는 필터링 된 초상 자성 나노 입자의 TEM 이미지를 획득과 자신의 X 선 분석을 수행하기에 기술 지원을위한 G. 풀다 (전자 현미경 센터, 로스 토크 대학, 독일)에 감사드립니다. RTC 로스 토크에서 수행 작업은 연방 교육 연구부 독일 (FKZ 0312138A, FKZ 316159 및 VIP + 03VP00241) 및 EU 구조 기금과 국가 메 클렌 부르크 - 서쪽 포메 라니아 (ESF / IV-WM-B34-에 의해 지원되었다 0030/10와 ESF / IV-BM-B35-0010 / 12) 및 DFG (DA 1296-1), 축축한 재단 및 독일 심장 재단 (F는 / 01 / 12)에 의해. 프랭크 위호스트 EU FP7 연구 프로그램 &quot;Nanomag&quot;FP7-NMP-2013-LARGE-7에 의해 지원되었다.

우리는 공개 경쟁 금융 관심 회원이 없습니다.

상기 자기 자신의 제어 지침 상자성 나노로드 유 전적으로 조작 된 세포의 제조는 현재의 프로토콜에 제공된다. 이 전략의 성공적인 응용 프로그램은 이식에 대한 타겟팅 전지 제품을 제공함으로써, 같은 부상 영역 2, 3, 4, 낮은 유지와 가난한 생착 등 세포 치료의 어려움의 해결을 위해 수 있습니다. 또한, 적절히 선택...

유전자 및 세포 치료는 CVD 처리에 현재의 문제를 해결할 가능성이있는 강력한 도구입니다. 이러한 접근 방법 모두 현재 임상 실험에서 테스트되고 있다는 사실에도 불구하고, 그들은 아직 다양한 임상 적 적용 일에 대한 준비가되지 않습니다. 특히, 유전자 및 세포 치료의 과제를 해결하는 일반적인 접근 방식은 임상 적 적용에 적합한 다기능 유전자 전달 벡터를 개발하는 것입니다. 안전하고 효율적인 유전자 전달 시스템의 부족은 유전자 치료의 주요 관심사입니다. 동시에, 세포 제품의 유전 공학 낮은 효율 (예를 들어, 심장 분야에서 기능 개선 만 ~ 5 % 달성 후 줄기 세포 이식 1과 세포 치료의 심각한 도전을 극복 할 수 이식에 앞서 시간 포 분 이내에 10 % -)와 가난한 유지 / 상해의 사이트에 생착이 (즉, 세포의 유지는 아래 5 방울세인트 애플리케이션, 투여 경로에 관계없이 2, 3, 4). 현재까지, 바이러스 벡터가 크게 임상 시험에서의 넓은 응용 가져왔다 효율의 관점에서 비 바이러스 시스템 (~ 67 %)를 초과 5. 그러나 바이러스 차량은 실시 유전 물질 (6)의 크기에 심각한 (심각한 합병증 및 후속 염증 반응) 등의 면역 원성 등의 위험, 관련한 종양 및 제한을 실시한다. 이러한 안전 문제 및 바이러스 벡터 생산의 높은 비용으로 인해, 비 바이러스 시스템의 사용은 어떤 경우 7, 8 바람직하다. 여기에는 (CVD 처리에 대한 예)를 제어 혈관 성장 인자의 발현 유전자로서 과도 보정을 필요 이상, 또는 대인 수수에 특히 적합백신의 스피. 우리 그룹에서, 전달 시스템은 지형 25 kDa의 폴리에틸렌 이민 (PEI)과 비오틴 - 스트렙 트 아비딘 상호 작용 (9)에 의해 함께 결합 초상 자성 산화철 나노 입자 (MNP)를 조합하여 설계되었다. 이 벡터는 이전의 이식에 대한 그들의 동시 자화를 허용 세포의 유전 공학에 대한 잠재적 인 도구입니다. 후자는 고급 자기 타겟팅 기술이 성공적으로 10을 개발하고 있습니다로, 요즘 특히 유망 자기 안내 / 보존을위한 기초를 제공한다. 또, 얻어진 자기 응답 세포가 될 가능성이있는 비 침습적으로 자기 공명 영상 (MRI) 또는 자기 입자 이미지 (11) (12)에 의해 모니터링. PEI는 / MNP 벡터의 경우에, 폴리아민은 분해 인자로부터 핵산 축합 따라서 보호를 보장<html> 의, 세포에서 벡터의 국제화 및 엔도 좀은 5 탈출. MNPS 자기 유도의 관점에서뿐만 아니라, 공지 된 PEI 중독 7, 13, 14을 감소시킴으로써뿐만 아니라, PEI의 특성을 보완. 이전 PEI / MNP 벡터 성질은 섬유 아세포와 인간 중간 엽 줄기 세포 (15, 16)를 사용하여 전달 효율 (즉,과의 pDNA의 miRNA) 및 안전성의 관점에서 조정 하였다. 이 논문에서 miRNA의 변성 세포의 발생에 대한 PEI / MNPS의 애플리케이션에 대한 상세한 프로토콜은 17을 설명한다. 이를 위해, HUVECs를 사용하고 체외 혈관 신생에 대한 확립 된 모델을 나타내고있다. 그들은 형질에 도전하고 독성 영향 (18), (19)에 취약엉덩이 = &quot;외부 참조&quot;&gt; 20. 또한, 우리는 그들의 타겟팅, 세포 간 통신 및 MRI 탐지를 포함하여 체외에서 이러한 세포를 평가하는 알고리즘을 제공한다.

<table><tbody><tr><td>PEI 25 kDa</td><td>Sigma Aldrich</td><td>408727</td><td></td></tr><tr><td>EZ-Link Sulfo-NHS-LC-Biotin</td><td>Thermo Scientific</td><td>21335</td><td></td></tr><tr><td>PD-10 Desalting Columns</td><td>GE Healthcare</td><td>17085101</td><td>Containing Sephadex G-25 Medium</td></tr><tr><td>Ninhydrin Reagent solution 2%</td><td>Sigma Aldrich</td><td>7285</td><td></td></tr><tr><td>Glycine</td><td>Sigma Aldrich</td><td>410225</td><td></td></tr><tr><td>Pierce Biotin Quantitation Kit</td><td>Thermo Scientific</td><td>28005</td><td></td></tr><tr><td>Microplate reader Model 680</td><td>Bio-Rad</td><td></td><td></td></tr><tr><td>Streptavidin MagneSphere Paramagnetic Particles</td><td>Promega</td><td>Z5481</td><td></td></tr><tr><td>Millex-HV PVDF Filter</td><td>Merck</td><td>SLHV013SL</td><td>0.45 &amp;micro;m</td></tr><tr><td>Libra 120 transmission electron microscope</td><td>Zeiss</td><td></td><td>Acceleration Voltage 120&amp;nbsp;kV</td></tr><tr><td>Sapphire X-ray detector</td><td>EDAX-Amatek</td><td></td><td></td></tr><tr><td>Cell culture plastic</td><td>TPP</td><td></td><td></td></tr><tr><td>NHS-Esther Atto 565</td><td>ATTO-TEC GmbH</td><td>AD 565-31</td><td></td></tr><tr><td>NHS-Esther Atto 488&amp;nbsp;</td><td>ATTO-TEC GmbH</td><td>AD 488-31</td><td></td></tr><tr><td>Cy5 miRNA Label IT kit</td><td>Mirus Bio</td><td>MIR 9650</td><td></td></tr><tr><td>Biotin Atto 565</td><td>ATTO-TEC GmbH</td><td>AD 565-71</td><td></td></tr><tr><td>Collagense Type IV Gibco</td><td>Thermo Scientific</td><td>17104019</td><td></td></tr><tr><td>Endothelial growth medium, EGM-2</td><td>Lonza</td><td>CC-3156 &amp;amp; CC-4176</td><td></td></tr><tr><td>Penicillin/Streptomycin</td><td>Thermo Scientific</td><td>15140122</td><td>100 U/mL, 100 &amp;micro;g/mL</td></tr><tr><td>Matrigel</td><td>BD Biosciences</td><td>356234</td><td></td></tr><tr><td>anti-PECAM-1 antibody</td><td>Santa Cruz</td><td>sc-1506</td><td></td></tr><tr><td>MS MACS columns</td><td>Miltenyi Biotec&amp;nbsp;</td><td>130-042-201</td><td></td></tr><tr><td>Near-IR Live/Dead Cell Stain Kit</td><td>Thermo Scientific</td><td>L10119</td><td></td></tr><tr><td>Cy3 Dye-Labeled Pre-miR Negative Control</td><td>Thermo Scientific</td><td>AM17120</td><td>&quot;Cy3-miR&quot; or &quot;Cyanine-miR3&quot; in the manuscript</td></tr><tr><td>Pre-miR miRNA Precursor Molecules - Negative Control&amp;nbsp;</td><td>Thermo Scientific</td><td>AM17110</td><td>&quot;scr-miR&quot; in the manuscript</td></tr><tr><td>Anti-hsa-miR92a-3p synthetic Inhibitor&amp;nbsp;</td><td>Thermo Scientific</td><td>AM10916</td><td></td></tr><tr><td>LSM 780 ELYRA PS.1 system</td><td>Zeiss</td><td></td><td></td></tr><tr><td>Paraformaldehyde</td><td>Sigma Aldrich</td><td>158127</td><td>4% solution in PBS</td></tr><tr><td>DAPI nuclear stain</td><td>Thermo Scientific</td><td>D1306</td><td></td></tr><tr><td>NucleoSpin RNA isolation Kit</td><td>Machery-Nagel</td><td>740955</td><td></td></tr><tr><td>mirVana miRNA Isolation Kit</td><td>Thermo Scientific</td><td>AM1560</td><td></td></tr><tr><td>TaqMan MicroRNA Reverse Transcription Kit</td><td>Thermo Scientific</td><td>4366596</td><td></td></tr><tr><td>StepOnePlus Real-Time PCR System</td><td>Applied Biosystems</td><td></td><td></td></tr><tr><td>High-Capacity cDNA Reverse Transcription Kit</td><td>Thermo Scientific</td><td>4368814</td><td></td></tr><tr><td>hsa-miR-92a TaqMan assay</td><td>Thermo Scientific</td><td>000431</td><td>Mature miRNA Sequence: UAUUGCACUUGUCCCGGCCUGU</td></tr><tr><td>FastGene Taq Ready Mix</td><td>Nippon Genetics</td><td>LS27</td><td></td></tr><tr><td>ITGA5 TaqMan assay</td><td>Thermo Scientific</td><td>Hs01547673_m1</td><td></td></tr><tr><td>RNU6B TaqMan assay</td><td>Thermo Scientific</td><td>001093</td><td></td></tr><tr><td>18S rRNA Endogenous Control</td><td>Thermo Scientific</td><td>4333760F</td><td></td></tr><tr><td>Gelatin</td><td>Sigma Aldrich</td><td>G7041</td><td></td></tr><tr><td>CellTrace Calcein Red-Orange</td><td>Thermo Scientific</td><td>C34851</td><td></td></tr><tr><td>PBS</td><td>Pan Biotech</td><td>P04-53500</td><td></td></tr><tr><td>BSA</td><td>Sigma Aldrich</td><td></td><td></td></tr><tr><td>MACS buffer</td><td>Miltenyi Biotec&amp;nbsp;</td><td>130-091-221</td><td></td></tr><tr><td>Agarose</td><td>Sigma Aldrich</td><td>A9539</td><td></td></tr><tr><td>7.1 Tesla animal MRI system</td><td>Bruker Corporation</td><td>A7906</td><td></td></tr><tr><td>ImageJ software</td><td>National Institutes of Health</td><td></td><td>upgraded with an AngiogenesisAnalyzer (NIH)</td></tr><tr><td>MPS device</td><td>Bruker Biospin</td><td></td><td></td></tr><tr><td>Matlab software</td><td>Mathworks</td><td></td><td></td></tr><tr><td>Ring Neodym Magnet&amp;nbsp;</td><td>magnets4you GmbH</td><td>RM-10x04x05-G</td><td>&amp;oslash; 10 mm; remanescence is ~ 1.3&amp;nbsp;T, coercivity &amp;ge; 955 kA/m</td></tr><tr><td>Click-iT EdU Alexa Fluor 647 Imaging Kit</td><td>Thermo Scientific</td><td>C10340</td><td></td></tr><tr><td>FluorSave Reagent</td><td>Merck</td><td>345789</td><td></td></tr><tr><td>Ultrasonic bath</td><td>Bandelin electronic</td><td>Type: RK 100 SH</td><td></td></tr></tbody></table>

preparation and in vitro characterization of magnetized mir-modified endothelial cells

현재까지, 심혈관 질환에 사용할 수있는 수술 및 약물 치료 (CVD)는 제한적이며 종종 완화. 동시에, 유전자 및 세포 치료는 CVD 치료에 매우 유망한 대안 적 방법을 제공합니다. 그러나, 유전자 치료의 다양한 임상 적 적용이 매우 적합 유전자 전달 시스템의 부족에 의해 제한된다. 적절한 유전자 전달 벡터의 개발은 세포 치료의 현재 문제점에 대한 해결책을 제공 할 수있다. 등 부상 기관에 제한 효율성과 낮은 세포 유지와 같은 특히, 기존의 단점에서, 적절한 세포 공학에 의해 (즉, 유전) 이전에 이식에 극복 할 수있다. 제시된 프로토콜은 폴리에틸렌 초상 자성 나노 입자 (PEI / MNP) 기반 전달 벡터를 사용하여 내피 세포의 효율적이고 안전한 과도 변형 례를 설명한다. 또한, 알고리즘과 셀 특성화 방법이 정의되어있다. 성공적인 intracellu마이크로 RNA 인간 제대 정맥 내피 세포로 (은 miR) (HUVEC를)의 경 전달 세포 생존, 기능, 또는 간 통신에 영향을주지 않고 달성되었다. 또한,이 방법은 소개 외생은 miR에서 강력한 기능 효과를 일으킬 것으로 입증되었다. 중요한 것은,이 MNP 기반 벡터의인가는 자기 타겟팅 및 비 침습성 MRI 추적 가능성을 수반 셀 자화를 보장한다. 이것은 MRI와 비 침습적 모니터링 할 수있는 자기 유도, 유 전적으로 조작 된 세포 치료제를위한 기초를 제공 할 수있다.

제안 된 프로토콜의 주요 목적은 자기 반응은 miR-수정 세포를 생산하기 위해 자신의 정확한 특성 (그림 1)을 수행하는 것입니다. 따라서, MRI 자기장으로 선택하고 안내 및 검출 응답을 효율적으로 형질 감염된 세포를 수득한다. 먼저, 절연 된 HUVEC의 신원은 내피 세포 마커 CD31 전형적인 염색 (PECAM) (도 2a)에</s...

Watch this Scientific Journal Video about Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells at JoVE.com

Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells

이 원고는 PEI / MNP 벡터와 자신의 자화에 의해 내피 세포 수 미르 효율적인 비 바이러스 성 전달을 설명합니다. 따라서, 유전자 변형뿐만 아니라,이 방법은 자기 세포 안내와 MRI의 검출 능력 수 있습니다. 이 기술은 치료 세포 제품의 특성을 개선하는 데 사용할 수 있습니다.

준비 및<em&gt; 체외</em&gt; 자화 특성의 내피 세포를 미르 변성

To date, the available surgical and pharmacological treatments for cardiovascular diseases (CVD) are limited and often palliative. At the same time, gene ...

preparation-vitro-characterization-magnetized-mir-modified

Universidad de Cartagena UDEC

Research

JoVE Journal

Medicine

Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells

7.6K 조회수.  University of Rostock.  이 원고는 PEI / MNP 벡터와 자신의 자화에 의해 내피 세포 수 미르 효율적인 비 바이러스 성 전달을 설명합니다. 따라서, 유전자 변형뿐만 아니라,이 방법은 자기 세포 안내와 MRI의 검출 능력 수 있습니다. 이 기술은 치료 세포 제품의 특성을 개선하는 데 사용할 수 있습니다. 

비디오: Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells

Generation of an Immortalized Murine Brain Microvascular Endothelial Cell Line as an In Vitro Blood Brain Barrier Model

Epithelial and endothelial cells (EC) are building paracellular barriers which protect the tissue from the external and internal environment. The blood-brain barrier (BBB) consisting of EC, astrocyte end-feet, pericytes and the basal membrane is responsible for the protection and homeostasis of the brain parenchyma. In vitro BBB models are common tools to study the structure and function of the BBB at the cellular level. A considerable number of different in vitro BBB models have been established for research in different laboratories to date. Usually, the cells are obtained from bovine, porcine, rat or mouse brain tissue (discussed in detail in the review by Wilhelm et al. 1). Human tissue samples are available only in a restricted number of laboratories or companies 2,3. While primary cell preparations are time consuming and the EC cultures can differ from batch to batch, the establishment of immortalized EC lines is the focus of scientific interest.
Here, we present a method for establishing an immortalized brain microvascular EC line from neonatal mouse brain. We describe the procedure step-by-step listing the reagents and solutions used. The method established by our lab allows the isolation of a homogenous immortalized endothelial cell line within four to five weeks. The brain microvascular endothelial cell lines termed cEND 4 (from cerebral cortex) and cerebEND 5 (from cerebellar cortex), were isolated according to this procedure in the F&ouml;rster laboratory and have been effectively used for explanation of different physiological and pathological processes at the BBB. Using cEND and cerebEND we have demonstrated that these cells respond to glucocorticoid- 4,6-9 and estrogen-treatment 10 as well as to pro-infammatory mediators, such as TNFalpha 5,8. Moreover, we have studied the pathology of multiple sclerosis 11 and hypoxia 12,13 on the EC-level. The cEND and cerebEND lines can be considered as a good tool for studying the structure and function of the BBB, cellular responses of ECs to different stimuli or interaction of the EC with lymphocytes or cancer cells.

Generation of an Immortalized Murine Brain Microvascular Endothelial Cell Line as an In Vitro Blood Brain Barrier Model

This method describes how to isolate and immortalize microvascular endothelial cells from mouse brain. We describe a step-by-step protocol starting from the homogenization of brain tissue, digestion steps, seeding and immortalization of the cells. Usually, it takes about five weeks to obtain a homogenous, immortalized microvascular endothelial cell line.

로 불후의 손쥐 뇌 Microvascular 내피 세포 라인의 생성<em&gt; 체외에서</em&gt; 혈액 뇌 장벽 모델

Epithelial and endothelial cells (EC) are building paracellular barriers which protect the tissue from the external and internal environment. The ...

연구

신경과학

Ferromagnetic Bare Metal Stent for Endothelial Cell Capture and Retention

Rapid endothelialization of cardiovascular stents is needed to reduce stent thrombosis and to avoid anti-platelet therapy which can reduce bleeding risk. The feasibility of using magnetic forces to capture and retain endothelial outgrowth cells (EOC) labeled with super paramagnetic iron oxide nanoparticles (SPION) has been shown previously. But this technique requires the development of a mechanically functional stent from a magnetic and biocompatible material followed by in-vitro and in-vivo testing to prove rapid endothelialization. We developed a weakly ferromagnetic stent from 2205 duplex stainless steel using computer aided design (CAD) and its design was further refined using finite element analysis (FEA). The final design of the stent exhibited a principal strain below the fracture limit of the material during mechanical crimping and expansion. One hundred stents were manufactured and a subset of them was used for mechanical testing, retained magnetic field measurements, in-vitro cell capture studies, and in-vivo implantation studies. Ten stents were tested for deployment to verify if they sustained crimping and expansion cycle without failure. Another 10 stents were magnetized using a strong neodymium magnet and their retained magnetic field was measured. The stents showed that the retained magnetism was sufficient to capture SPION-labeled EOC in our in-vitro studies. SPION-labeled EOC capture and retention was verified in large animal models by implanting 1 magnetized stent and 1 non-magnetized control stent in each of 4 pigs. The stented arteries were explanted after 7 days and analyzed histologically. The weakly magnetic stents developed in this study were capable of attracting and retaining SPION-labeled endothelial cells which can promote rapid healing.

Our goals were to design, manufacture and test ferromagnetic stents for endothelial cell capture. Ten stents were tested for fracture and 10 more stents were tested for retained magnetism. Finally, 10 stents were tested in-vitro and 8 more stents were implanted in 4 pigs to show cell capture and retention.

내피 세포 캡처 및 유지에 대한 강자성 베어 메탈 스텐트

Rapid endothelialization of cardiovascular stents is needed to reduce stent thrombosis and to avoid anti-platelet therapy which can reduce bleeding risk. ...

생체공학

Synthesis of Cationized Magnetoferritin for Ultra-fast Magnetization of Cells

Many important biomedical applications, such as cell imaging and remote manipulation, can be achieved by labeling cells with superparamagnetic iron oxide nanoparticles (SPIONs). Achieving sufficient cellular uptake of SPIONs is a challenge that has traditionally been met by exposing cells to elevated concentrations of SPIONs or by prolonging exposure times (up to 72 hr). However, these strategies are likely to mediate toxicity. Here, we present the synthesis of the protein-based SPION magnetoferritin as well as a facile surface functionalization protocol that enables rapid cell magnetization using low exposure concentrations. The SPION core of magnetoferritin consists of cobalt-doped iron oxide with an average particle diameter of 8.2 nm mineralized inside the cavity of horse spleen apo-ferritin. Chemical cationization of magnetoferritin produced a novel, highly membrane-active SPION that magnetized human mesenchymal stem cells (hMSCs) using incubation times as short as one minute and iron concentrations as lows as 0.2 mM.

A protocol for the synthesis and cationization of cobalt-doped magnetoferritin is presented, as well as a method to rapidly magnetize stem cells with cationized magnetoferritin.

세포의 초고속 자화에 대한 양이온 Magnetoferritin의 합성

Many important biomedical applications, such as cell imaging and remote manipulation, can be achieved by labeling cells with superparamagnetic iron oxide ...

A Patient-Derived Xenograft Model for Venous Malformation

Venous malformation (VM) is a vascular anomaly that arises from impaired development of the venous network resulting in dilated and often dysfunctional veins. The purpose of this article is to carefully describe the establishment of a murine xenograft model that mimics human VM and is able to reflect patient heterogeneity. Hyper-activating non-inherited (somatic) TEK (TIE2) and PIK3CA mutations in endothelial cells (EC) have been identified as the main drivers of pathological vessel enlargement in VM. The following protocol describes the isolation, purification and expansion of patient-derived EC expressing mutant TIE2 and/or PIK3CA. These EC are injected subcutaneously into the back of immunodeficient athymic mice to generate ectatic vascular channels. Lesions generated with TIE2 or PIK3CA-mutant EC are visibly vascularized within 7&#8210;9 days of injection and recapitulate histopathological features of VM patient tissue. This VM xenograft model provides a reliable platform to investigate the cellular and molecular mechanisms driving VM formation and expansion. In addition, this model will be instrumental for translational studies testing the efficacy of novel drug candidates in preventing the abnormal vessel enlargement seen in human VM.

We present a detailed protocol to generate a murine xenograft model of venous malformation. This model is based on the subcutaneous injection of patient-derived endothelial cells containing hyper-activating TIE2 and/or PIK3CA gene mutations. Xenograft lesions closely recapitulate the histopathological features of VM patient tissue.

정맥 기형에 대한 환자 유래 제노이식 모델

Venous malformation (VM) is a vascular anomaly that arises from impaired development of the venous network resulting in dilated and often dysfunctional ...

발생학

Isolation of Primary Murine Brain Microvascular Endothelial Cells

The blood-brain-barrier is ultrastructurally assembled by a monolayer of brain microvascular endothelial cells (BMEC) interconnected by a junctional complex of tight and adherens junctions. Together with other cell-types such as astrocytes or pericytes, they form the neurovascular unit (NVU), which specifically regulates the interchange of fluids, molecules and cells between the peripheral blood and the CNS. Through this complex and dynamic system BMECs are involved in various processes maintaining the homeostasis of the CNS. A dysfunction of the BBB is observed as an essential step in the pathogenesis of many severe CNS diseases. However, specific and targeted therapies are very limited, as the underlying mechanisms are still far from being understood. 
Animal and in vitro models have been extensively used to gain in-depth understanding of complex physiological and pathophysiological processes. By reduction and simplification it is possible to focus the investigation on the subject of interest and to exclude a variety of confounding factors. However, comparability and transferability are also reduced in model systems, which have to be taken into account for evaluation. The most common animal models are based on mice, among other reasons, mainly due to the constantly increasing possibilities of methodology. In vitro studies of isolated murine BMECs might enable an in-depth analysis of their properties and of the blood-brain-barrier under physiological and pathophysiological conditions. Further insights into the complex mechanisms at the BBB potentially provide the basis for new therapeutic strategies.
This protocol describes a method to isolate primary murine microvascular endothelial cells by a sequence of physical and chemical purification steps. Special considerations for purity and cultivation of MBMECs as well as quality control, potential applications and limitations are discussed.

Brain microvascular endothelial cells (BMEC) are interconnected by specific junctional proteins forming a highly regulated barrier separating blood and the central nervous system (CNS), the so-called blood-brain-barrier (BBB). The isolation of primary murine brain microvascular endothelial cells, as discussed in this protocol, enables detailed in vitro studies of the BBB.

차 설치류 뇌 미세 혈관 내피 세포의 분리

The blood-brain-barrier is ultrastructurally assembled by a monolayer of brain microvascular endothelial cells (BMEC) interconnected by a junctional ...

An In Vitro Model of the Blood-brain Barrier Using Impedance Spectroscopy: A Focus on T Cell-endothelial Cell Interaction

Breakdown of the blood-brain barrier (BBB) is a critical step in the development of autoimmune diseases such as multiple sclerosis (MS) and its animal model experimental autoimmune encephalomyelitis (EAE). This process is characterized by the transmigration of activated T cells across brain endothelial cells (ECs), the main constituents of the BBB. However, the consequences on brain EC function upon interaction with such T cells are largely unknown. Here we describe an assay that allows for the evaluation of primary mouse brain microvascular EC (MBMEC) function and barrier integrity during the interaction with T cells over time. The assay makes use of impedance cell spectroscopy, a powerful tool for studying EC monolayer integrity and permeability, by measuring changes in transendothelial electrical resistance (TEER) and cell layer capacitance (Ccl). In direct contact with ECs, stimulated but not na&#239;ve T cells are capable of inducing EC monolayer dysfunction, as visualized by a decrease in TEER and an increase in Ccl. The assay records changes in EC monolayer integrity in a continuous and automated fashion. It is sensitive enough to distinguish between different strengths of stimuli and levels of T cell activation and it enables the investigation of the consequences of a targeted modulation of T cell-EC interaction using a wide range of substances such as antibodies, pharmacological reagents and cytokines. The technique can also be used as a quality control for EC integrity in in vitro T-cell transmigration assays. These applications make it a versatile tool for studying BBB properties under physiological and pathophysiological conditions.

An In Vitro Model of the Blood-brain Barrier Using Impedance Spectroscopy: A Focus on T Cell-endothelial Cell Interaction

Here, we describe an in vitro murine model of the blood-brain barrier that makes use of impedance cell spectroscopy, with a focus on the consequences on endothelial cell integrity and permeability upon interaction with activated T cells.

<em&gt; 체외</em&gt; 임피던스 분광학을 사용하여 혈액 - 뇌 장벽 모델 : T 세포 - 내피 세포 상호 작용에 초점

Breakdown of the blood-brain barrier (BBB) is a critical step in the development of autoimmune diseases such as multiple sclerosis (MS) and its animal ...

면역학 및 감염병학

Protocol for MicroRNA Transfer into Adult Bone Marrow-derived Hematopoietic Stem Cells to Enable Cell Engineering Combined with Magnetic Targeting

While CD133+ hematopoietic stem cells (SCs) have been proven to provide high potential in the field of regenerative medicine, their low retention rates after injection into injured tissues as well as the observed massive cell death rates lead to very restricted therapeutic effects. To overcome these limitations, we sought to establish a non-viral based protocol for suitable cell engineering prior to their administration. The modification of human CD133+ expressing SCs using microRNA (miR) loaded magnetic polyplexes was addressed with respect to uptake efficiency and safety as well as the targeting potential of the cells. Relying on our protocol, we can achieve high miR uptake rates of 80&#8211;90% while the CD133+ stem cell properties remain unaffected. Moreover, these modified cells offer the option of magnetic targeting. We describe here a safe and highly efficient procedure for the modification of CD133+ SCs. We expect this approach to provide a standard technology for optimization of therapeutic stem cell effects and for monitoring of the administered cell product via magnetic resonance imaging (MRI).

This protocol illustrates a safe and efficient procedure to modify CD133+ hematopoietic stem cells. The presented non-viral, magnetic polyplex-based approach may provide a basis for the optimization of therapeutic stem cell effects as well as for monitoring the administered cell product via magnetic resonance imaging.

성인 골 수 유래 조 혈 줄기 세포로 세포 공학 자기 대상으로 함께 있도록 예측에 관한 전송을 위한 프로토콜

While CD133+ hematopoietic stem cells (SCs) have been proven to provide high potential in the field of regenerative medicine, their low retention rates ...

Isolation of Primary Murine Skeletal Muscle Microvascular Endothelial Cells

The endothelial cells of skeletal muscle capillaries (muscle microvascular endothelial cells, MMEC) build up the barrier between blood stream and skeletal muscles regulating the exchange of fluids and nutrients as well as the immune response against infectious agents by controlling immune cell migration. For these functions, MMEC form a functional &#34;myovascular unit&#34; (MVU), with further cell types, such as fibroblasts, pericytes and skeletal muscle cells. Consequently, a dysfunction of MMEC and therefore the MVU contributes to a vast variety of myopathies. However, regulatory mechanisms of MMEC in health and disease remain insufficiently understood and their elucidation precedes more specific treatments for myopathies. The isolation and in-depth investigation of primary MMEC functions in the context of the MVU might facilitate a better understanding of these processes.
This article provides a protocol to isolate primary murine MMEC of the skeletal muscle by mechanical and enzymatic dissociation including purification and culture maintenance steps.

Microvascular endothelial cells of skeletal muscles (MMEC) shape the inner wall of muscle capillaries and regulate both, exchange of fluids/molecules and migration of (immune) cells between muscle tissue and blood. Isolation of primary murine MMEC, as described here, enables comprehensive in vitro investigations of the &#34;myovascular unit&#34;.

기본 Murine 골격 근육 Microvascular 내 피 세포의 고립

The endothelial cells of skeletal muscle capillaries (muscle microvascular endothelial cells, MMEC) build up the barrier between blood stream and skeletal ...

Differentiation of Human Induced Pluripotent Stem Cells to Brain Microvascular Endothelial Cell-Like Cells with a Mature Immune Phenotype

Blood-brain barrier (BBB) dysfunction is a pathological hallmark of many neurodegenerative and neuroinflammatory diseases affecting the central nervous system (CNS). Due to the limited access to disease-related BBB samples, it is still not well understood whether BBB malfunction is causative for disease development or rather a consequence of the neuroinflammatory or neurodegenerative process. Human induced pluripotent stem cells (hiPSCs) therefore provide a novel opportunity to establish in vitro BBB models from healthy donors and patients, and thus to study disease-specific BBB characteristics from individual patients. Several differentiation protocols have been established for deriving brain microvascular endothelial cell (BMEC)-like cells from hiPSCs. Consideration of the specific research question is mandatory for the correct choice of the respective BMEC-differentiation protocol. Here, we describe the extended endothelial cell culture method (EECM), which is optimized to differentiate hiPSCs into BMEC-like cells with a mature immune phenotype, allowing the study of immune cell-BBB interactions. In this protocol, hiPSCs are first differentiated into endothelial progenitor cells (EPCs) by activating Wnt/&#946;-catenin signaling. The resulting culture, which contains smooth muscle-like cells (SMLCs), is then sequentially passaged to increase the purity of endothelial cells (ECs) and to induce BBB-specific properties. Co-culture of EECM-BMECs with these SMLCs or conditioned medium from SMLCs allows for the reproducible, constitutive, and cytokine-regulated expression of EC adhesion molecules. Importantly, EECM-BMEC-like cells establish barrier properties comparable to primary human BMECs, and due to their expression of all EC adhesion molecules, EECM-BMEC-like cells are different from other hiPSC-derived in vitro BBB models. EECM-BMEC-like cells are thus the model of choice for investigating the potential impact of disease processes at the level of the BBB, with an impact on immune cell interaction in a personalized fashion.

Here, we describe a protocol, the extended endothelial cell culture method (EECM), that allows differentiation of pluripotent stem cells to brain microvascular endothelial cell (BMEC)-like cells. These cells show endothelial cell adhesion molecule expression and are thus a human blood-brain barrier model suitable to study immune cell interactions in vitro.

인간 유도 만능 줄기 세포를 성숙한 면역 표현형을 가진 뇌 미세혈관 내피 세포 유사 세포로 분화

Blood-brain barrier (BBB) dysfunction is a pathological hallmark of many neurodegenerative and neuroinflammatory diseases affecting the central nervous ...

엔도솜 유래 나노소포의 최적화된 자기 고수율 생산

A Magnetic Separation-Assisted High-Speed Homogenization Method for Large-Scale Production of Endosome-Derived Vesicles

Extracellular vesicles (EVs) have attracted significant attention in physiological and pathological research, disease diagnosis, and treatment; however, their clinical translation has been limited by the lack of scale-up manufacturing approaches. Therefore, this protocol provides a magnetic separation-assisted high-speed homogenization method for the large-scale production of endosome-derived nanovesicles as a new type of exosome mimics (EMs) derived from the endosomes, which have about 100-time higher yield than conventional ultracentrifugation method. In this method, magnetic nanoparticles (MNPs) were internalized by parental cells via endocytosis and were subsequently accumulated within their endosomes. Then, MNPs-loaded endosomes were collected and purified by hypotonic treatment and magnetic separation. A high-speed homogenizer was utilized to break MNP-loaded endosomes into monodisperse nanovesicles. The resulting endosome-derived vesicles feature the same biological origin and structure, characterized by nanoparticle tracking analysis, transmission electron microscope, and western blotting. Their morphology and protein composition are similar to native EVs, indicating that EMs may potentially serve as a low-cost and high-yield surrogate of native EVs for clinical translations.

저자 스포트라이트: 자성 나노입자를 이용한 엑소좀 모방을 위한 대규모의 재현 가능한 생산 방법 개발 

Here, we describe a magnetic separation-assisted high-speed homogenization method for large-scale production of endosome-derived nanovesicles as a new type of exosome mimics (EMs) that share the same biological origin and similar structure, morphology, and protein composition of native extracellular vesicles (EVs).

엔도솜 유래 소포의 대규모 생산을 위한 자기 분리 보조 고속 균질화 방법

Extracellular vesicles (EVs) have attracted significant attention in physiological and pathological research, disease diagnosis, and treatment; however, ...

준비 및

요약

더 많은 비디오 탐색

이 비디오의 챕터

로 불후의 손쥐 뇌 Microvascular 내피 세포 라인의 생성