The authors thank Dr.&#160;Brian Armstrong at City of Hope, and Mindy Rodriguez at University of California, Riverside for technical assistance. This study was funded in part by grants from the NIH (R01 HL145170 to ZBC), Ella Fitzgerald Foundation (to ZBC), City of Hope (Arthur Riggs Diabetes Metabolism and Research Institute Innovation Award), and California Institute of Regenerative Medicine grant EDU4-12772 (to AT). Research reported in this publication included work performed in the Light Microscopy and Digital Imaging supported by the National Cancer Institute of the NIH under award number P30CA033572. Figure 1 and Figure 2 were made with BioRender.

Tissue isolation was performed under the approved study protocol #17010 by the Institutional Animal Care and Use Committee (IACUC) of Beckman Research Institute, City of Hope (Duarte, California, USA). Here, we use Tie-2CreERT2;Rosa26-TdTomato mouse line in C57BL/6 background at 8 - 12 weeks of age. In this line, ECs are labeled with TdTomato when induced with tamoxifen as previously described34. However, this protocol can be adapted for all ages of adult mice with different genotypes and genetic backgrounds.
1. Tissue collection (estimated time: 1-2 h)
NOTE: The time estimate is 15 min/animal, recommended maximum 3 animals pooled per dissociation samples.
<ol>
	<li>Euthanize animals by carbon dioxide (CO2) overdose, followed by secondary confirmation of death. Before dissection, spray the whole body with 70% ethanol (EtOH), completely disinfecting the operating area.</li>
	<li>Stretch out and secure limbs using pins. Using surgical scissors, make a small midline incision through the skin and peritoneum starting from the lower abdominal area and extending toward the thoracic region.</li>
	<li>Expose the ribcage by cutting through the diaphragm and lift the ribcage to expose the heart.</li>
	<li>Insert a needle (25G-30G) connected to a syringe containing ice-cold sterile PBS, into the left ventricle of the heart.</li>
	<li>Start the perfusion by injecting the PBS through the heart at a rate of 5 - 10 mL/min. Stop after injecting 10 mL, or until the liver and kidneys become discolored.</li>
	<li>After perfusion, locate the pancreas (below the stomach and attached to the duodenum)35 (Figure 3A) and carefully remove it using dissecting scissors and forceps.</li>
	<li>Once isolated, transfer pancreas to a 50 mL tube containing 10 mL of ice-cold PBS + 0.2 mg/mL trypsin inhibitor, keep on ice (Figure 3B). 
	NOTE: Pancreas from a maximum of 3 mice can be pooled at this step and transferred into 1 tube. Samples can be kept on ice for a maximum time of 2 h.</li>
</ol>
2. Collagenase preparation (estimated time: 15-30 min)
<ol>
	<li>Prepare solutions and buffers as described below.
	<ol>
		<li>Dissociation solution: Add collagenase Type I into 50 mL tube to a final concentration of 1 mg/mL in Dulbecco&#39;s phosphate buffered saline (DPBS 1x (Ca2+, Mg2+; see Table of Materials) and 0.001 U/mL DNase I + 0.2 mg/mL Trypsin inhibitor.</li>
		<li>Dissociation stop solution: Add phosphate buffered saline (PBS 1x, without Ca2+, Mg2+; same for all the rest PBS in this protocol; see Table of Materials), 5% Bovine Serum Albumin (BSA), 0.001 U/mL DNase I or DMEM + 10% FBS + 0.001 MU/mL DNase I.</li>
		<li>Wash buffer: Add PBS 1x, 0.5% Bovine Serum Albumin (BSA), 0.001 U/mL DNase I + 0.05&#160;mg/mL Trypsin Inhibitor.</li>
	</ol>
	</li>
	<li>Dissolve buffers completely and filter through a 0.22 &#181;m filter. Set aside and keep on ice.</li>
</ol>
3. Digestion (estimated time: 40 min-1 h)
<ol>
	<li>Remove pancreas from ice-cold PBS and place on Petri dish on top of ice. Carefully remove excess tissue (e.g., spleen, fat, debris) with surgical scissors and tweezers (Figure 3C). 
	NOTE: It is crucial to remove fat, as excess of lipids can interfere with tissue digestion.</li>
	<li>Transfer the trimmed mouse pancreas to a 5 mL tube containing 1 mL of dissociation solution.</li>
	<li>Keep tube on ice and mince the pancreatic tissues with dissecting scissors into fine pipettable pieces, e.g. 0.5 mm or 1 mm. Transfer lysate into a 50 mL tube and keep on ice.</li>
	<li>Add additional pancreas to the 5 mL tube used to initially mince the pancreatic tissue and add additional 1 mL of collagenase. Repeat as necessary for multiple pancreas preparations.</li>
	<li>Add 2 mL of collagenase solution to the 5 mL tube to remove any residual pancreas tissue and transfer to 50 mL tube. Total collagenase volume should be 5 mL for 3 pancreas or 3 mL for a single pancreas.</li>
	<li>Once all samples have undergone mechanical dissociation, transfer the 50 mL tubes containing the homogenized tissue lysates to a 37 &#176;C water bath and incubate for 10 min. 
	NOTE: Do not vigorously agitate or vortex the tissue mixture during this process as this can cause rupture of acinar tissues and the release of abundant endogenous enzymes and DNA.</li>
	<li>Remove the tubes from water bath and gently swirl to mix well, and leave in water bath for another 10 min. (Total time: 20 min). 
	NOTE: Do not exceed 30 min in 37 &#176;C water bath to avoid over-digestion.</li>
	<li>Place tubes on ice, and let the homogenate settle by gravity. Once settled, transfer supernatant through a 70 &#181;m filter, and add 5 mL of dissociation stop solution.</li>
	<li>Add an additional 1 mL of dissociation solution to the remaining pellet and triturate with a 18G needle.</li>
	<li>Pass the remaining homogenate through the filter and wash with an additional 5 mL of dissociation stop solution.</li>
	<li>Spin cell suspension at 300 x g for 10 min, at 4 &#176;C. Remove supernatant completely by aspiration and keep cell pellet on ice.</li>
	<li>Resuspend cell pellet with 1 mL of wash buffer and transfer to a 1.5 mL microcentrifuge tube.</li>
	<li>Take a small aliquot from the resuspended cell pellet (10 &#181;L) and mix with trypan blue at a 1:1 ratio to count cells using a cell counter and measure viability.</li>
</ol>
4. Endothelial cell (EC) enrichment (estimated time: 2-3 h)
<ol>
	<li>Add 1 &#181;L of anti-CD31-biotin antibody for every 1 x 107 cells counted and incubate for 30 min at 4 &#176;C on a rotator (about 5 &#181;L per 3 pancreas).</li>
	<li>Add 20 &#181;L of anti-biotin microbeads and incubate for 40 min at 4 &#176;C on a tube rotator.</li>
	<li>Set up a magnetic stand with the column separator holder and apply the column. Equilibrate column with 3 mL of wash buffer.</li>
	<li>Add sample to the column and wash with a total of 9 mL wash buffer. 
	NOTE: If cell concentration is high, dilute cells with an additional 2 mL of wash buffer in a separate tube. Add 1 mL of sample at a time into the column to prevent the column from clogging.</li>
	<li>Remove column from column holder and place in a 15 mL tube. Add 5 mL of wash buffer, to the column. Use plunger to push down cells in the column and collect elution (which contains enriched EC).</li>
	<li>Spin down flow-through and elution/EC fraction at 300 x g for 10 min at 4 &#176;C. Count cells and measure viability as in step 3.13.</li>
	<li>Validate EC-enrichment via qPCR of flow-through and EC-fractions. Use NK6 Homeobox 1 (Nkx6.1) as a general marker for endocrine cells and platelet and endothelial cell adhesion molecule (Pecam1) as a marker for EC33. Use 36B4 (Rplp0, acidic ribosomal phosphoprotein p0) as an internal control for gene expression normalization. 
	NOTE: Collected samples can be used for protein or RNA analyses at this step.</li>
</ol>
5. Culturing pECs
<ol>
	<li>Prepare M199 medium. Supplement M199 medium to a final concentration of 20% fetal bovine serum (FBS) and 0.1% Penicillin-Streptomycin.</li>
	<li>Coat a 60 mm cell culture plate with collagen Type I (1 mg/mL in 0.1 M acetic acid) and allow to sit for 30 min at room temperature.</li>
	<li>Remove collagen Type I and rinse the plate with 1X PBS, twice. Add 2 mL of prepared M199 Media and place cell culture plate in standard cell culture incubator (5% CO2, 37 &#176;C) for 5 min.</li>
	<li>Once cells have been isolated, add isolated cells to pre-warmed M199 cell culture plate. Keep cells in culture conditions for approximately 14 days and change media every 2-3 days.</li>
</ol>

Streamlining Mouse Pancreatic Endothelial Cell Extraction for Disease Studies

The authors have nothing to disclose.

In this article, we present a protocol for enrichment and isolation of the pECs. Similar to previous EC isolation protocols from other tissues or organs, this protocol consists of three major processes, namely, physical dissociation, enzymatic digestion, and antibody-based EC enrichment. To address the unique challenges in processing the pancreas, we introduced several key adaptations and critical steps within our protocol: 1) a gentle one-step collagenase digestion with a short incubation time, 2) supplementation of hig...

The pancreas, key to metabolic control and homeostasis, is a highly vascularized organ. The pancreas has both endocrine and exocrine functions, controlling the regulation of blood glucose and digestive enzymes, respectively. These two compartments are linked together by the extensive network of pancreatic blood vessels, facilitating the exchange and transport of oxygen, hormones, and enzymes. Critically, this dense capillary network penetrates the Islet of Langerhans, a cluster of hormone-regulating cells within the pancreas responsible for its endocrine function, consisting of the glucagon-secreting alpha (&#945;) cells, the insulin-secreting beta (&#946;) cells and the somatostatin-secreting delta (&#948;) cells1,2. Although the islets only make up 1-2% of the pancreatic mass, they receive 20% of total blood flow3, highlighting the importance of islet vasculature. The pancreatic capillaries are primarily made up of highly fenestrated endothelial cells (ECs), which are surrounded by mural pericytes. These capillary ECs play a vital role in the islet development, maturation, and (dys)function and form intimate crosstalks with various endo- and exocrine cells4 (Figure 1).
Endothelial dysfunction has been observed in both Type 1 and Type 2 diabetes, the most common conditions caused by pancreatic islet dysfunction5,6. Both islet microvascular density and morphology can be altered in diabetes7. Moreover, pancreatic cancer, a highly aggressive tumor that can also be manifested as diabetes, is characterized by high microvascular density with poor perfusion8. Given the pivotal structural and functional roles of ECs in both normal and diseased pancreatic tissue, there is a pertinent need to study the pECs in development, physiology, and pathology to unveil the mechanisms that drive health or diseases.
Numerous protocols have been developed for the isolation of ECs from different murine (e.g., brain9,10, lung11, heart12, liver13, skeletal muscles14, and adipose tissues15) and human (e.g., brain16, visceral adipose tissue17,18, peripheral nerves19, lung20,21,22, and mesenteric artery23) tissues. These protocols typically involve the use of enzymatic digestions (e.g., by collagenase, trypsin24, dispase24,25, and liberase26), followed by an antibody-based enrichment step. Moreover, these protocols tend to rely on extended durations of digestions in high concentrations of enzymes with vigorous agitation at 37 &#176;C (Table 1). Due to the unique features of the pancreas, including that it houses a plethora of endogenous digestive enzymes, these existing protocols cannot be directly applied to isolate pECs. First, the extracellular matrix (ECM) composition of the pancreas is different from other tissues. While collagenase is commonly used for EC isolation, there are multiple subtypes with different tissue-specific dissociation capabilities, thus requiring optimization. Second, and crucial to pEC isolation, the release and activation of pancreatic endogenous enzymes can significantly hinder the isolation process. To this end, caution needs to be taken to minimize the rupture of the exocrine acinar cells (the primary source of zymogens, proteases, and RNase27), which can induce further cell damage and result in low cell viability and overall affect recovery27,28,29.
To address these challenges, we have adapted methods from existing EC isolation protocols and established a new protocol&#160;suitable for EC isolation from mouse pancreases. Specifically, we describe here a workflow (Figure 2) using collagenase Type I (typically implemented for lung EC isolation), lower digestion temperatures and no agitation (to prevent activation of pancreatic zymogens), and DNase30,31,32 supplementation (to prevent DNA-induced apoptosis and improve cell viability, and an antibody for CD3133 (PECAM1, a pan-EC marker). The described protocol produces EC populations isolated from mouse pancreas that can be used for gene expression profiling and protein assays.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>1.5 mL eppendorf</td>
			<td>USA Scientific</td>
			<td>1615-5500</td>
			<td></td>
		</tr>
		<tr>
			<td>10 cm dish</td>
			<td>Genesee Scientific</td>
			<td>25-202</td>
			<td></td>
		</tr>
		<tr>
			<td>25G needles</td>
			<td>BD</td>
			<td>305145</td>
			<td></td>
		</tr>
		<tr>
			<td>2X Taq Pro Universal SYBR qPCR Master Mix</td>
			<td>Vazyme</td>
			<td>Q712-03-AA</td>
			<td></td>
		</tr>
		<tr>
			<td>5 mL eppendorf</td>
			<td>Thermo Fisher&#160;</td>
			<td>14282300</td>
			<td></td>
		</tr>
		<tr>
			<td>6-well plate</td>
			<td>Greiner Bio-One</td>
			<td>07-000-208</td>
			<td></td>
		</tr>
		<tr>
			<td>70 &#181;m strainer</td>
			<td>Fisher</td>
			<td>22-363-548</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-CD31-biotin</td>
			<td>Miltenyi Biotech</td>
			<td>REA784</td>
			<td></td>
		</tr>
		<tr>
			<td>Bovine serum albumin heat shock treated</td>
			<td>Fisher</td>
			<td>BP1600-100</td>
			<td></td>
		</tr>
		<tr>
			<td>CaCl2</td>
			<td>Fisher</td>
			<td>BP510</td>
			<td></td>
		</tr>
		<tr>
			<td>Centrifuge</td>
			<td>Eppendorf</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Collagen Type 1, from calf skin</td>
			<td>Sigma Aldrich&#160;</td>
			<td>C9791</td>
			<td>Attachment reagent in the protocol</td>
		</tr>
		<tr>
			<td>Collagenase Type 1&#160;</td>
			<td>Worthington Bio</td>
			<td>LS004197</td>
			<td></td>
		</tr>
		<tr>
			<td>Countess Automatic Cell Counter</td>
			<td>Thermo Fisher&#160;</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>DAPI</td>
			<td>Thermo Fisher&#160;</td>
			<td>D1306</td>
			<td>immunofluorescence</td>
		</tr>
		<tr>
			<td>Disposable Safety Scalpels</td>
			<td>Myco Instrumentation</td>
			<td>6008TR-10</td>
			<td></td>
		</tr>
		<tr>
			<td>DNAse I&#160;</td>
			<td>Roche</td>
			<td>260913&#160;</td>
			<td></td>
		</tr>
		<tr>
			<td>D-PBS (Ca2+,Mg2+)</td>
			<td>Thermo Fisher&#160;</td>
			<td>14080055</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethanol</td>
			<td>Fisher</td>
			<td>BP2818-4</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal bovine serum</td>
			<td>Fisher</td>
			<td>10437028</td>
			<td></td>
		</tr>
		<tr>
			<td>Incubator</td>
			<td></td>
			<td></td>
			<td>Kept at 37 &#176;C 5% CO2</td>
		</tr>
		<tr>
			<td>LS Columns</td>
			<td>Miltenyi Biotech</td>
			<td>130-042-401</td>
			<td></td>
		</tr>
		<tr>
			<td>M199</td>
			<td>Sigma</td>
			<td>M2520-1L</td>
			<td></td>
		</tr>
		<tr>
			<td>MACS MultiStand with the QuadroMACS Separator&#160;</td>
			<td>Miltenyi Biotech</td>
			<td>130-042-303</td>
			<td></td>
		</tr>
		<tr>
			<td>Medium 199</td>
			<td>Sigma Aldrich&#160;</td>
			<td>M2520-10X</td>
			<td></td>
		</tr>
		<tr>
			<td>Microbeads anti-biotin</td>
			<td>Miltenyi Biotech</td>
			<td>130-090-485</td>
			<td></td>
		</tr>
		<tr>
			<td>Microscope</td>
			<td>Leica</td>
			<td></td>
			<td>To assess cell morphology</td>
		</tr>
		<tr>
			<td>Molecular Grade Water</td>
			<td>Corning</td>
			<td>46-000-CM</td>
			<td></td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>Fisher</td>
			<td>S271-1</td>
			<td></td>
		</tr>
		<tr>
			<td>New Brunswick Innova 44/44R Orbital shaker&#160;</td>
			<td>Eppendorf</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>PECAM1 (CD31) Antibody</td>
			<td>Abcam</td>
			<td>ab56299</td>
			<td>immunofluorescence</td>
		</tr>
		<tr>
			<td>PECAM1 (CD31) Antibody</td>
			<td>R&#38;D Systems</td>
			<td>AF3628</td>
			<td></td>
		</tr>
		<tr>
			<td>Phosphate Buffered Saline (10X) (no Ca2+,no Mg2+)</td>
			<td>Genesee Scientific</td>
			<td>25-507-XB</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer 36B4 Forward mouse</td>
			<td>IDT</td>
			<td></td>
			<td>AGATTCGGGATATGCTGTTGGC</td>
		</tr>
		<tr>
			<td>Primer 36B4 Revese mouse&#160;</td>
			<td>IDT</td>
			<td></td>
			<td>TCGGGTCCTAGACCAGTGTTC</td>
		</tr>
		<tr>
			<td>Primer Kdr Forward mouse&#160;</td>
			<td>IDT</td>
			<td></td>
			<td>TCCAGAATCCTCTTCCATGC</td>
		</tr>
		<tr>
			<td>Primer Kdr Reverse mouse</td>
			<td>IDT</td>
			<td></td>
			<td>AAACCTCCTGCAAGCAAATG</td>
		</tr>
		<tr>
			<td>Primer Nkx6.1 Reverse mouse&#160;</td>
			<td>IDT</td>
			<td></td>
			<td>CACGGCGGACTCTGCATCACTC</td>
		</tr>
		<tr>
			<td>Primer Nxk6.1 Forward mouse</td>
			<td>IDT</td>
			<td></td>
			<td>CTCTACTTTAGCCCCAGCG</td>
		</tr>
		<tr>
			<td>Primer PECAM1 Forward mouse</td>
			<td>IDT</td>
			<td></td>
			<td>ACGCTGGTGCTCTATGCAAG</td>
		</tr>
		<tr>
			<td>Primer PECAM1 Reverse mouse</td>
			<td>IDT</td>
			<td></td>
			<td>TCAGTTGCTGCCCATTCATCA</td>
		</tr>
		<tr>
			<td>RNase ZAP</td>
			<td>Thermo Fisher&#160;</td>
			<td>AM9780</td>
			<td></td>
		</tr>
		<tr>
			<td>RNase-free water</td>
			<td>Takara</td>
			<td>RR036B</td>
			<td></td>
		</tr>
		<tr>
			<td>Sterile 12&#34; long forceps</td>
			<td>F.S.T</td>
			<td>91100-16</td>
			<td></td>
		</tr>
		<tr>
			<td>Sterile fine forceps</td>
			<td>F.S.T</td>
			<td>11050-10</td>
			<td></td>
		</tr>
		<tr>
			<td>Sterile fine scissors</td>
			<td>F.S.T</td>
			<td>14061-11</td>
			<td></td>
		</tr>
		<tr>
			<td>Tissue Culture Dishes 2cm</td>
			<td>Genesee Scientific</td>
			<td>25-260</td>
			<td></td>
		</tr>
		<tr>
			<td>TRIzol reagent</td>
			<td>Fisher</td>
			<td>15596018</td>
			<td></td>
		</tr>
		<tr>
			<td>Trypan Blue</td>
			<td>Corning</td>
			<td>MT25900CI</td>
			<td></td>
		</tr>
		<tr>
			<td>Trypsin Inhibitor&#160;</td>
			<td>Roche</td>
			<td>10109886001</td>
			<td></td>
		</tr>
		<tr>
			<td>Tween-20</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>VE-Cadherin Antibody</td>
			<td>Abcam</td>
			<td>ab33168</td>
			<td>immunofluorescence</td>
		</tr>
		<tr>
			<td>Waterbath</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

isolation of mouse pancreatic endothelial cells

The pancreas is a vital organ for maintaining metabolic balance within the body, in part due to its production of metabolic hormones such as insulin and glucagon, as well as digestive enzymes. The pancreas is also a highly vascularized organ, a feature facilitated by the intricate network of pancreatic capillaries. This extensive capillary network is made up of highly fenestrated endothelial cells (ECs) important for pancreas development and function. Accordingly, the dysfunction of ECs can contribute to that of the pancreas in diseases like diabetes and cancer. Thus, researching the function of pancreatic ECs (pECs) is important not only for understanding pancreas biology but also for developing its pathologies. Mouse models are valuable tools to study metabolic and cardiovascular diseases. However, there has not been an established protocol with sufficient details described for the isolation of mouse pECs due to the relatively small population of ECs and the abundant digestive enzymes potentially released from the acinar tissue that can lead to cell damage and, thus, low yield. To address these challenges, we devised a protocol to enrich and recover mouse pECs, combining gentle physical and chemical dissociation and antibody-mediated selection. The protocol presented here provides a robust method to extract intact and viable ECs from the whole mouse pancreas. This protocol is suitable for multiple downstream assays and may be applied to various mouse models.

Following this protocol, approximately 2 x 106 live cells can be obtained when pooling 3 mouse pancreases, and 750,000 cells from a single mouse pancreas. To validate the enrichment of EC, we performed the following analyses: 1) quantitative PCR: compared to the flow-through (FT) samples (i.e., the non-CD31 antibody-bound fractions), the EC fractions had significantly higher levels of Pecam1 (encoding CD31) and Kdr (encoding VEGFR2), two EC marker genes33, and lower le...

Isolation of Mouse Pancreatic Endothelial Cells

This protocol describes the isolation of mouse endothelial cells from whole pancreas.

The pancreas is a vital organ for maintaining metabolic balance within the body, in part due to its production of metabolic hormones such as insulin and ...

isolation-of-mouse-pancreatic-endothelial-cells

Universidad de Cartagena UDEC

Research

JoVE Journal

Biology

796 Views.  City of Hope. This protocol describes the isolation of mouse endothelial cells from whole pancreas.

Video: Isolation of Mouse Pancreatic Endothelial Cells

Isolation of Human Umbilical Vein Endothelial Cells (HUVEC)

Angiogenesis is a complex multi-step process, where in response to angiogenic stimuli, new vessels are created from the existing vasculature. These steps include: degradation of the basement membrane, proliferation and migration (sprouting) of endothelial cells (EC) into the extracellular matrix, alignment of EC into cords, lumen formation, anastomosis, and formation of a new basement membrane. Many in vitro assays have been developed to study this process, but most only mimic certain stages of angiogenesis, and morphologically the vessels often do not resemble vessels in vivo. Here we demonstrate an optimized in vitro angiogenesis assay that utilizes human umbilical vein EC and fibroblasts. This model recapitulates all of the key early stages of angiogenesis, and importantly the vessels display patent intercellular lumens surrounded by polarized EC. Vessels can be easily observed by phase-contrast and time-lapse microscopy, and recovered in pure form for downstream applications.

Isolation of Human Umbilical Vein Endothelial Cells HUVEC

This video protocol illustrates the isolation and culture of human umbilical vein endothelial cells (HUVEC) from human umbilical cord. Once isolated these cells can be used for in vitro angiogenesis assays like the Optimized Fibrin Gel Bead Assay also demonstrated by the Hughes lab.

Angiogenesis is a complex multi-step process, where in response to angiogenic stimuli, new vessels are created from the existing vasculature. These steps ...

Murine Pancreatic Islet Isolation

Isolation of Valvular Endothelial Cells

Heart valves are solely responsible for maintaining unidirectional blood flow through the cardiovascular system. These thin, fibrous tissues are subjected to significant mechanical stresses as they open and close several billion times over a lifespan. The incredible endurance of these tissues is due to the resident valvular endothelial (VEC) and interstitial cells (VIC) that constantly repair and remodel in response to local mechanical and biological signals. Only recently have we begun to understand the unique behaviors of these cells, for which in vitro experimentation has played a key role. Particularly challenging is the isolation and culture of VEC. Special care must be used from the moment the tissue is removed from the host through final plating. Here we present protocols for direct isolation, side specific isolation, culture, and verification of pure populations of VEC. We use enzymatic digestion followed by a gentle swab scraping technique to dislodge only surface cells. These cells are then collected into a tube and centrifuged into a pellet. The pellet is then resuspended and plated into culture flasks pre-coated with collagen I matrix. VEC phenotype is confirmed by contact inhibited growth and the expression of endothelial specific markers such as PECAM1 (CD31), Von Willebrand Factor (vWF), and negative expression of alpha-smooth muscle actin (&alpha;-SMA). The functional characteristics of VEC are associated with high levels of acetylated LDL. Unlike vascular endothelial cells, VEC have the unique capacity to transform into mesenchyme, which normally occurs during embryonic valve formation1. This can also occur during significantly prolonged post confluent in vitro culture, so care should be made to passage at or near confluence. After VEC isolation, pure populations of VIC can then be easily acquired.

We provide a method for isolating and culturing pure populations of heart valve endothelial cells (VEC). VEC can be isolated from either side of the cusp or leaflet and immediately following, underlying interstitial cell (VIC) isolation is straightforward.

Heart valves are solely responsible for maintaining unidirectional blood flow through the cardiovascular system.  These thin, fibrous tissues are ...

Isolation of Stem Cells from Human Pancreatic Cancer Xenografts

Cancer stem cells (CSCs) have been identified in a growing number of malignancies and are functionally defined by their ability to undergo self-renewal and produce differentiated progeny1. These properties allow CSCs to recapitulate the original tumor when injected into immunocompromised mice. CSCs within an epithelial malignancy were first described in breast cancer and found to display specific cell surface antigen expression (CD44+CD24low/-)2. Since then, CSCs have been identified in an increasing number of other human malignancies using CD44 and CD24 as well as a number of other surface antigens. Physiologic properties, including aldehyde dehydrogenase (ALDH) activity, have also been used to isolate CSCs from malignant tissues3-5.
Recently, we and others identified CSCs from pancreatic adenocarcinoma based on
ALDH activity and the expression of the cell surface antigens CD44 and CD24, and CD1336-8. These highly tumorigenic populations may or may not be overlapping and display other functions. We found that ALDH+ and CD44+CD24+ pancreatic CSCs are similarly tumorigenic, but ALDH+ cells are relatively more invasive8. In this protocol we describe a method to isolate viable pancreatic CSCs from low-passage human
xenografts9. Xenografted tumors are harvested from mice and made into a single-cell suspension. Tissue debris and dead cells are separated from live cells and then stained using antibodies against CD44 and CD24 and using the ALDEFLUOR reagent,
a fluorescent substrate of ALDH10. CSCs are then isolated by fluorescence activated cell sorting. Isolated CSCs can then be used for analytical or functional assays requiring viable cells.

Cancer stem cells (CSCs) have been identified in a number of malignancies. In this protocol we describe a flow cytometric method utilizing aldehyde dehydrogenase activity and CD44 and CD24 expression to isolate CSCs from human pancreatic adenocarcinoma xenografts. These viable cells can then be used in functional and analytical studies.

Cancer stem cells (CSCs) have been identified in a growing number of malignancies and are functionally defined by their ability to undergo self-renewal ...

Isolation and Culture of Pulmonary Endothelial Cells from Neonatal Mice

Endothelial cells provide a useful research model in many areas of vascular biology. Since its first isolation 1, human umbilical vein endothelial cells (HUVECs) have shown to be convenient, easy to obtain and culture, and thus are the most widely studied endothelial cells. However, for research focused on processes like angiogenesis, permeability or many others, microvascular endothelial cells (ECs) are a much more physiologically relevant model to study 2. Furthermore, ECs isolated from knockout mice provide a useful tool for analysis of protein function ex vivo. Several approaches to isolate and culture microvascular ECs of different origin have been reported to date 3-7, but consistent isolation and culture of pure ECs is still a major technical problem in many laboratories. Here, we provide a step-by-step protocol on a reliable and relatively simple method of isolating and culturing mouse lung endothelial cells (MLECs). In this approach, lung tissue obtained from 6- to 8-day old pups is first cut into pieces, digested with collagenase/dispase (C/D) solution and dispersed mechanically into single-cell suspension. MLECS are purified from cell suspension using positive selection with anti-PECAM-1 antibody conjugated to Dynabeads using a Magnetic Particle Concentrator (MPC). Such purified cells are cultured on gelatin-coated tissue culture (TC) dishes until they become confluent. At that point, cells are further purified using Dynabeads coupled to anti-ICAM-2 antibody. MLECs obtained with this protocol exhibit a cobblestone phenotype, as visualized by phase-contrast light microscopy, and their endothelial phenotype has been confirmed using FACS analysis with anti-VE-cadherin 8 and anti-VEGFR2 9 antibodies and immunofluorescent staining of VE-cadherin. In our hands, this two-step isolation procedure consistently and reliably yields a pure population of MLECs, which can be further cultured. This method will enable researchers to take advantage of the growing number of knockout and transgenic mice to directly correlate in vivo studies with results of in vitro experiments performed on isolated MLECs and thus help to reveal molecular mechanisms of vascular phenotypes observed in vivo.

Here, we describe a protocol for isolation and culture of murine pulmonary endothelial cells. This method comprises mechanic and enzymatic lung tissue dissociation as well as a 2-step purification process using anti-PECAM-1 and anti-ICAM-2 antibodies conjugated to magnetic beads, which produces a pure endothelial cell population of mostly microvascular origin.

Endothelial cells provide a useful research model in many areas of vascular biology. Since its first isolation 1, human umbilical vein endothelial cells ...

A Method for Mouse Pancreatic Islet Isolation and Intracellular cAMP Determination

Uncontrolled glycemia is a hallmark of diabetes mellitus and promotes morbidities like neuropathy, nephropathy, and retinopathy. With the increasing prevalence of diabetes, both immune-mediated type 1 and obesity-linked type 2, studies aimed at delineating diabetes pathophysiology and therapeutic mechanisms are of critical importance. The &#946;-cells of the pancreatic islets of Langerhans are responsible for appropriately secreting insulin in response to elevated blood glucose concentrations. In addition to glucose and other nutrients, the &#946;-cells are also stimulated by specific hormones, termed incretins, which are secreted from the gut in response to a meal and act on &#946;-cell receptors that increase the production of intracellular cyclic adenosine monophosphate (cAMP). Decreased &#946;-cell function, mass, and incretin responsiveness are well-understood to contribute to the pathophysiology of type 2 diabetes, and are also being increasingly linked with type 1 diabetes. The present mouse islet isolation and cAMP determination protocol can be a tool to help delineate mechanisms promoting disease progression and therapeutic interventions, particularly those that are mediated by the incretin receptors or related receptors that act through modulation of intracellular cAMP production. While only cAMP measurements will be described, the described islet isolation protocol creates a clean preparation that also allows for many other downstream applications, including glucose stimulated insulin secretion, [3H]-thymidine incorporation, protein abundance, and mRNA expression.

Assaying in vitro &#946;-cell function using isolated mouse islets of Langerhans is an important component in the study of diabetes pathophysiology and therapeutics. While many&#160;downstream applications are available, this protocol specifically describes the measurement of intracellular cyclic adenosine monophosphate (cAMP) as an essential parameter determining &#946;-cell function.

Uncontrolled glycemia is a hallmark of diabetes mellitus and promotes morbidities like neuropathy, nephropathy, and retinopathy. With the increasing ...

Isolation of Embryonic Ventricular Endothelial Cells

Cell culture has greatly enhanced our ability to assess individual populations of cells under myriad culture conditions. While immortalized cell lines offer significant advantages for their ease of use, these cell lines are unavailable for all potential cell types. By isolating primary cells from a specific region of interest, particularly from a transgenic mouse, more nuanced studies can be performed. The basic technique involves dissecting the organ or partial organ of interest (e.g. the heart or a specific region of the heart) and dissociating the organ to single cells. These cells are then incubated with magnetic beads conjugated to an antibody that recognizes the cell type of interest. The cells of interest can then be isolated with the use of a magnet, with a short trypsin incubation dissociating the cells from the beads. These isolated cells can then be cultured and analyzed as desired. This technique was originally designed for adult mouse organs but can be easily scaled down for use with embryonic organs, as demonstrated herein. Because our interest is in the developing coronary vasculature, we wanted to study this population of cells during specific embryonic stages. Thus, the original protocol had to be modified to be compatible with the small size of the embryonic ventricles and the low potential yield of endothelial cells at these developmental stages. Utilizing this scaled-down approach, we have assessed coronary plexus remodeling in transgenic embryonic ventricular endothelial cells.

Primary cell culture is a useful technique for analyzing specific populations of cells, particularly from transgenic mouse embryos at specific developmental stages. Herein, embryonic ventricles are dissected and dissociated, and antibody-conjugated beads recognize and separate out the endothelial cells for further analysis.

Cell culture has greatly enhanced our ability to assess individual populations of cells under myriad culture conditions. While immortalized cell lines ...

Isolation and Culture of Mouse Primary Pancreatic Acinar Cells

This protocol permits rapid isolation (in less than 1 hr) of murine pancreatic acini, making it possible to maintain them in culture for more than one week. More than 20 x 106 acinar cells can be obtained from a single murine pancreas. This protocol offers the possibility to independently process as many as 10 pancreases in parallel. Because it preserves acinar architecture, this model is well suited for studying the physiology of the exocrine pancreas in vitro in contrast to cell lines established from pancreatic tumors, which display many genetic alterations resulting in partial or total loss of their acinar differentiation.

In this publication, we describe a rapid and convenient procedure for isolating and culturing primary pancreatic acinar cells from the murine pancreas. This method constitutes a valuable approach to study the physiology of fresh primary normal/untransformed exocrine pancreatic cells.

This protocol permits rapid isolation (in less than 1 hr) of murine pancreatic acini, making it possible to maintain them in culture for more than one ...

Isolation of Microvascular Endothelial Tubes from Mouse Resistance Arteries

The control of blood flow by the resistance vasculature regulates the supply of oxygen and nutrients concomitant with the removal of metabolic by-products, as exemplified by exercising skeletal muscle. Endothelial cells (ECs) line the intima of all resistance vessels and serve a key role in controlling diameter (e.g.&#160;endothelium-dependent vasodilation) and, thereby, the magnitude and distribution of tissue blood flow. The regulation of vascular resistance by ECs is effected by intracellular Ca2+ signaling, which leads to production of diffusible autacoids (e.g.&#160;nitric oxide and arachidonic acid metabolites)1-3 and hyperpolarization4,5 that elicit smooth muscle cell relaxation. Thus understanding the dynamics of endothelial Ca2+ signaling is a key step towards understanding mechanisms governing blood flow control. Isolating endothelial tubes eliminates confounding variables associated with blood in the vessel lumen and with surrounding smooth muscle cells and perivascular nerves, which otherwise influence EC structure and function. Here we present the isolation of endothelial tubes from the superior epigastric artery (SEA) using a protocol optimized for this vessel.
To isolate endothelial tubes from an anesthetized mouse, the SEA is ligated in situ to maintain blood within the vessel lumen (to facilitate visualizing it during dissection), and the entire sheet of abdominal muscle is excised. The SEA is dissected free from surrounding skeletal muscle fibers and connective tissue, blood is flushed from the lumen, and mild enzymatic digestion is performed to enable removal of adventitia, nerves and smooth muscle cells using gentle trituration. These freshly-isolated preparations of intact endothelium retain their native morphology, with individual ECs remaining functionally coupled to one another, able to transfer chemical and electrical signals intercellularly through gap junctions6,7. In addition to providing new insight into calcium signaling and membrane biophysics, these preparations enable molecular studies of gene expression and protein localization within native microvascular endothelium.

We present a preparation for visualizing and manipulating calcium signaling in native, intact microvascular endothelium. Endothelial tubes freshly isolated from mouse resistance arteries supplying skeletal muscle retain in vivo morphology and dynamic signaling within and between neighboring cells. Endothelial tubes can be prepared from microvessels of other tissues and organs.

The control of blood flow by the resistance vasculature regulates the supply of oxygen and nutrients concomitant with the removal of metabolic ...

Isolation of Murine Valve Endothelial Cells

Normal valve structures consist of stratified layers of specialized extracellular matrix (ECM) interspersed with valve interstitial cells (VICs) and surrounded by a monolayer of valve endothelial cells (VECs). VECs play essential roles in establishing the valve structures during embryonic development, and are important for maintaining life-long valve integrity and function. In contrast to a continuous endothelium over the surface of healthy valve leaflets, VEC disruption is commonly observed in malfunctioning valves and is associated with pathological processes that promote valve disease and dysfunction. Despite the clinical relevance, focused studies determining the contribution of VECs to development and disease processes are limited. The isolation of VECs from animal models would allow for cell-specific experimentation. VECs have been isolated from large animal adult models but due to their small population size, fragileness, and lack of specific markers, no reports of VEC isolations in embryos or adult small animal models have been reported. Here we describe a novel method that allows for the direct isolation of VECs from mice at embryonic and adult stages. Utilizing the Tie2-GFP reporter model that labels all endothelial cells with Green Fluorescent Protein (GFP), we have been successful in isolating GFP-positive (and negative) cells from the semilunar and atrioventricular valve regions using fluorescence activated cell sorting (FACS). Isolated GFP-positive VECs are enriched for endothelial markers, including CD31 and von Willebrand Factor (vWF), and retain endothelial cell expression when cultured; while, GFP-negative cells exhibit molecular profiles and cell shapes consistent with VIC phenotypes. The ability to isolate embryonic and adult murine VECs allows for previously unattainable molecular and functional studies to be carried out on a specific valve cell population, which will greatly improve our understanding of valve development and disease mechanisms.

The ability to isolate heart valve endothelial cells (VECs) is critical for understanding mechanisms of valve development, maintenance, and disease. Here we describe the isolation of VECs from embryonic and adult Tie2-GFP mice using FACS that will allow for studies determining the contribution of VECs in developmental and disease processes.

Normal valve structures consist of stratified layers of specialized extracellular matrix (ECM) interspersed with valve interstitial cells (VICs) and ...