We would like to thank Harry B. Gristick and Pamela Bjorkman for providing the RC1 antigen and the entire Nussenzweig and Martin laboratories for critical discussion. This work was supported by The Bill and Melinda Gates Foundation grant INV-002777 (to M.C.N.) and the Intramural Research Program of the National Institute of Allergy and Infectious Diseases, National Institutes of Health. (R.G. and M.A.M). M.C.N. is an HHMI Investigator.

<ol>
	<li>Victora, G. D., Nussenzweig, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Germinal+centers.">Germinal centers.</a> Annual Review of Immunology. 40, 413-442 (2022).</li><li>Plotkin, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Correlates+of+protection+induced+by+vaccination.">Correlates of protection induced by vaccination.</a> Clinical and Vaccine Immunology. 17 (7), 1055-1065 (2010).</li><li>Brinkmann, V., Heusser, C. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=T+cell-dependent+differentiation+of+human+B+cells+into+IgM,+IgG,+IgA,+or+IgE+plasma+cells:+High+rate+of+antibody+production+by+IgE+plasma+cells,+but+limited+clonal+expansion+of+IgE+precursors.">T cell-dependent differentiation of human B cells into IgM, IgG, IgA, or IgE plasma cells: High rate of antibody production by IgE plasma cells, but limited clonal expansion of IgE precursors.</a> Cellular Immunology. 152 (2), 323-332 (1993).</li><li>Chernecky, C. C., Berger, B. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Protein Electrophoresis - Serum., 6th edition. , 917-920 (2013).</li><li>Balazs, A. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antibody-based+protection+against+HIV+infection+by+vectored+immunoprophylaxis.">Antibody-based protection against HIV infection by vectored immunoprophylaxis.</a> Nature. 481 (7379), 81-84 (2011).</li><li>Greiner, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-mediated+editing+of+the+B+cell+receptor+in+primary+human+B+cells.">CRISPR-mediated editing of the B cell receptor in primary human B cells.</a> iScience. 12, 369-378 (2019).</li><li>Hartweger, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HIV-specific+humoral+immune+responses+by+CRISPR/Cas9-edited+B+cells.">HIV-specific humoral immune responses by CRISPR/Cas9-edited B cells.</a> Journal of Experimental Medicine. 216 (6), 1301-1310 (2019).</li><li>Huang, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vaccine+elicitation+of+HIV+broadly+neutralizing+antibodies+from+engineered+B+cells.">Vaccine elicitation of HIV broadly neutralizing antibodies from engineered B cells.</a> Nature Communications. 11, 5850 (2020).</li><li>Jeske, A. M., Boucher, P., Curiel, D. T., Voss, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vector+strategies+to+actualize+B+cell-based+gene+therapies.">Vector strategies to actualize B cell-based gene therapies.</a> Journal of Immunology. 207 (3), 755-764 (2021).</li><li>Nahmad, A. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+engineered+B+cells+secrete+high+titers+of+broadly+neutralizing+anti-HIV+antibodies+in+mice.">In vivo engineered B cells secrete high titers of broadly neutralizing anti-HIV antibodies in mice.</a> Nature Biotechnology. 40 (8), 1241-1249 (2022).</li><li>Nahmad, A. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineered+B+cells+expressing+an+anti-HIV+antibody+enable+memory+retention,+isotype+switching+and+clonal+expansion.">Engineered B cells expressing an anti-HIV antibody enable memory retention, isotype switching and clonal expansion.</a> Nature Communications. 11, 5851 (2020).</li><li>Voss, J. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reprogramming+the+antigen+specificity+of+B+cells+using+genome-editing+technologies.">Reprogramming the antigen specificity of B cells using genome-editing technologies.</a> eLife. 8, 42995 (2019).</li><li>Pesch, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+design,+optimization,+and+genomic+integration+of+chimeric+B+cell+receptors+in+murine+B+cells.">Molecular design, optimization, and genomic integration of chimeric B cell receptors in murine B cells.</a> Frontiers in Immunology. 10, 2630 (2019).</li><li>Cheong, T. C., Compagno, M., Chiarle, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Editing+of+mouse+and+human+immunoglobulin+genes+by+CRISPR-Cas9+system.">Editing of mouse and human immunoglobulin genes by CRISPR-Cas9 system.</a> Nature Communications. 7, 10934 (2016).</li><li>Rogers, G. L., Cannon, P. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+edited+B+cells:+A+new+frontier+in+immune+cell+therapies.">Genome edited B cells: A new frontier in immune cell therapies.</a> Molecular Therapy. 29 (11), 3192-3204 (2021).</li><li>Hung, K. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+protein-secreting+plasma+cells+by+homology-directed+repair+in+primary+human+B+cells.">Engineering protein-secreting plasma cells by homology-directed repair in primary human B cells.</a> Molecular Therapy. 26 (2), 456-467 (2018).</li><li>Johnson, M. J., Laoharawee, K., Lahr, W. S., Webber, B. R., Moriarity, B. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+of+primary+human+B+cells+with+CRISPR/Cas9+targeted+nuclease.">Engineering of primary human B cells with CRISPR/Cas9 targeted nuclease.</a> Scientific Reports. 8, 12144 (2018).</li><li>Wu, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+engineering+in+primary+human+B+cells+with+CRISPR-Cas9+ribonucleoproteins.">Genetic engineering in primary human B cells with CRISPR-Cas9 ribonucleoproteins.</a> Journal of Immunological Methods. 457, 33-40 (2018).</li><li>Luo, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+of+alpha-PD-1+antibody-expressing+long-lived+plasma+cells+by+CRISPR/Cas9-mediated+targeted+gene+integration.">Engineering of alpha-PD-1 antibody-expressing long-lived plasma cells by CRISPR/Cas9-mediated targeted gene integration.</a> Cell Death and Disease. 11 (11), 973 (2020).</li><li>Laoharawee, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+engineering+of+primary+human+B+cells+using+CRISPR/Cas9.">Genome engineering of primary human B cells using CRISPR/Cas9.</a> Journal of Visualized Experiments. (165), e61855 (2020).</li><li>Laoharawee, K., Johnson, M. J., Moriarity, B. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cas9-mediated+genome+engineering+of+primary+human+B+cells.">CRISPR/Cas9-mediated genome engineering of primary human B cells.</a> Methods in Molecular Biology. 2115, 435-444 (2020).</li><li>Moffett, H. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=B+cells+engineered+to+express+pathogen-specific+antibodies+protect+against+infection.">B cells engineered to express pathogen-specific antibodies protect against infection.</a> Science Immunology. 4 (35), (2019).</li><li>Hartweger, H., Nussenzweig, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR+comes+a-knock-in+to+reprogram+antibodies+in+vivo.">CRISPR comes a-knock-in to reprogram antibodies in vivo.</a> Nature Biotechnology. 40 (8), 1183-1184 (2022).</li><li>Nishimura, Y., Martin, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Of+mice,+macaques,+and+men:+Broadly+neutralizing+antibody+immunotherapy+for+HIV-1.">Of mice, macaques, and men: Broadly neutralizing antibody immunotherapy for HIV-1.</a> Cell Host &amp; Microbe. 22 (2), 207-216 (2017).</li><li>Shedlock, D. J., Silvestri, G., Weiner, D. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monkeying+around+with+HIV+vaccines:+Using+rhesus+macaques+to+define+'gatekeepers'+for+clinical+trials.">Monkeying around with HIV vaccines: Using rhesus macaques to define 'gatekeepers' for clinical trials.</a> Nature Reviews Immunology. 9 (10), 717-728 (2009).</li><li>Kreuser, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+methods+for+generation+and+expansion+of,+and+gene+delivery+to+rhesus+macaque+plasma+B+cells.">Efficient methods for generation and expansion of, and gene delivery to rhesus macaque plasma B cells.</a> bioRxiv. , (2021).</li><li>Gujer, C., Sundling, C., Seder, R. A., Karlsson Hedestam, G. B., Lore, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+and+rhesus+plasmacytoid+dendritic+cell+and+B-cell+responses+to+Toll-like+receptor+stimulation.">Human and rhesus plasmacytoid dendritic cell and B-cell responses to Toll-like receptor stimulation.</a> Immunology. 134 (3), 257-269 (2011).</li><li>Kim, J. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+enrichment-free+massive+ex-vivo+expansion+of+peripheral+CD20(+)+B+cells+via+CD40-CD40L+signals+in+non-human+primates.">Cell enrichment-free massive ex-vivo expansion of peripheral CD20(+) B cells via CD40-CD40L signals in non-human primates.</a> Biochemical and Biophysical Research Communications. 473 (1), 92-98 (2016).</li><li>Su, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Self-attenuating+adenovirus+enables+production+of+recombinant+adeno-associated+virus+for+high+manufacturing+yield+without+contamination.">Self-attenuating adenovirus enables production of recombinant adeno-associated virus for high manufacturing yield without contamination.</a> Nature Communications. 13, 1182 (2022).</li><li>Endo, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Short-+and+long-term+clinical+outcomes+in+rhesus+monkeys+inoculated+with+a+highly+pathogenic+chimeric+simian/human+immunodeficiency+virus.">Short- and long-term clinical outcomes in rhesus monkeys inoculated with a highly pathogenic chimeric simian/human immunodeficiency virus.</a> Journal of Virology. 74 (15), 6935-6945 (2000).</li><li>Balaphas, A., Buchs, N. C., Meyer, J., Hagen, M. E., Morel, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Partial+splenectomy+in+the+era+of+minimally+invasive+surgery:+The+current+laparoscopic+and+robotic+experiences.">Partial splenectomy in the era of minimally invasive surgery: The current laparoscopic and robotic experiences.</a> Surgical Endoscopy. 29 (12), 3618-3627 (2015).</li><li>Gibson, D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+assembly+of+DNA+molecules+up+to+several+hundred+kilobases.">Enzymatic assembly of DNA molecules up to several hundred kilobases.</a> Nature Methods. 6 (5), 343-345 (2009).</li><li>Labun, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CHOPCHOP+v3:+Expanding+the+CRISPR+web+toolbox+beyond+genome+editing.">CHOPCHOP v3: Expanding the CRISPR web toolbox beyond genome editing.</a> Nucleic Acids Research. 47, 171-174 (2019).</li><li>Strobel, B., Miller, F. D., Rist, W., Lamla, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+analysis+of+cesium+chloride-+and+iodixanol-based+purification+of+recombinant+adeno-associated+viral+vectors+for+preclinical+applications.">Comparative analysis of cesium chloride- and iodixanol-based purification of recombinant adeno-associated viral vectors for preclinical applications.</a> Human Gene Therapy Methods. 26 (4), 147-157 (2015).</li><li>Guo, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+and+simplified+purification+of+recombinant+adeno-associated+virus.">Rapid and simplified purification of recombinant adeno-associated virus.</a> Journal of Virological Methods. 183 (2), 139-146 (2012).</li><li>Vandenberghe, L. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+serotype-dependent+release+of+functional+vector+into+the+culture+medium+during+adeno-associated+virus+manufacturing.">Efficient serotype-dependent release of functional vector into the culture medium during adeno-associated virus manufacturing.</a> Human Gene Therapy. 21 (10), 1251-1257 (2010).</li><li>Brinkman, E. K., Chen, T., Amendola, M., van Steensel, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Easy+quantitative+assessment+of+genome+editing+by+sequence+trace+decomposition.">Easy quantitative assessment of genome editing by sequence trace decomposition.</a> Nucleic Acids Research. 42 (22), 168 (2014).</li><li>Conant, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inference+of+CRISPR+edits+from+Sanger+trace+data.">Inference of CRISPR edits from Sanger trace data.</a> The CRISPR Journal. 5 (1), 123-130 (2022).</li><li>Wilkinson, A. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cas9-AAV6+gene+correction+of+beta-globin+in+autologous+HSCs+improves+sickle+cell+disease+erythropoiesis+in+mice.">Cas9-AAV6 gene correction of beta-globin in autologous HSCs improves sickle cell disease erythropoiesis in mice.</a> Nature Communications. 12, 686 (2021).</li><li>Wang, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+broadly+neutralizing+macaque+monoclonal+antibody+against+the+HIV-1+V3-Glycan+patch.">A broadly neutralizing macaque monoclonal antibody against the HIV-1 V3-Glycan patch.</a> eLife. 9, 61991 (2020).</li><li>Escolano, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immunization+expands+B+cells+specific+to+HIV-1+V3+glycan+in+mice+and+macaques.">Immunization expands B cells specific to HIV-1 V3 glycan in mice and macaques.</a> Nature. 570 (7762), 468-473 (2019).</li><li>Pathiraja, V., Matar, A. J., Gusha, A., Huang, C. A., Duran-Struuck, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Leukapheresis+protocol+for+nonhuman+primates+weighing+less+than+10+kg.">Leukapheresis protocol for nonhuman primates weighing less than 10 kg.</a> Journal of the American Association for Laboratory Animal Science. 52 (1), 70-77 (2013).</li><li>Stratigopoulos, G., De Rosa, M. C., LeDuc, C. A., Leibel, R. L., Doege, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DMSO+increases+efficiency+of+genome+editing+at+two+non-coding+loci.">DMSO increases efficiency of genome editing at two non-coding loci.</a> PLoS One. 13 (6), 0198637 (2018).</li></ol>

No competing interests are declared.

The protocols presented here provide a fast and efficient method to generate high yields and titers of rAAV6s as HDRTs and novel methods to efficiently gene-edit primary rhesus macaque B cells in vitro.
The rAAV6 production protocol is comparatively simple and fast, allowing the production and testing of many different constructs simultaneously without excessive labor. If desired, rAAV6 can be further purified using established protocols such as iodixanol gradient ultracentrifugation34 or aqueous two phase partitioning35 before buffer exchange and concentration.
Although it reduced the overall yield, we opted to only use serum-reduced cell culture medium for the rAAV6 purification instead of purification from the cell pellet, since the majority of rAAV6 is released into the medium36, and purification from the cell pellet adds more cost and labor. The use of the self-inactivating adenoviral helper increased the yields 30-40-fold on average, allowing the testing of constructs packaged into AAV6 in a single 15 cm dish. Although our purification method is basic, using this method, we obtain relatively little batch-to-batch variation in gene editing efficiency or cell viability after transduction using various cell lines or other primary cells (data not shown).
We developed a rhesus macaque B cell purification protocol to obtain untouched primary B cells using the negative depletion of undesired populations. Although not necessary for gene editing these cells, it provides a way to obtain a relatively pure population of primary rhesus macaque B cells for this or other applications should other cell types interfere with the experimental goals. However, purity comes at the cost of reduced overall B cell yields. Notably, for both the enriched and unenriched B cell cultures, the fraction of B cells in the initial PBMC or splenocyte preparations is crucial. For PBMCs in particular, we recommend screening different macaques for individuals with a high percentage of B cells in peripheral blood to obtain high numbers of B cells for experiments, as this value can differ dramatically between individuals27. PBMCs may be obtained by regular bleeding or leukapheresis42.
The gene editing protocol leads to efficient gene editing, typically between 60%-80% of knock-out and 5%-20% of knock-in B cells, although we have achieved up to 90% BCR knock-out and 40% BCR knock-in B cells (Figure 5 and Figure 6).
The major parameters for the efficient editing of rhesus macaque B cells are the cutting efficiency of the sgRNA, the electroporation parameters, the MOI, and the quality of the rAAV6 preparation. The cutting efficiencies of candidate sgRNAs should be determined empirically to allow for optimal editing and design of the HDRT. The electroporation parameters presented here balance efficiency with viability to obtain the maximum total number of edited B cells rather than the highest percentage of edited B cells. If a higher percentage of edited cells is required, increased voltages (up to 1,750 V) or altered pulse lengths (10-30 ms) are recommended, though more cell death may be observed. We also noted slightly higher editing efficiencies in splenic B cells compared to B cells from PBMCs from the same individual (Figure 5); however, the underlying reason for this is currently unknown.
We found that the addition of 1% DMSO after electroporation significantly increased the gene editing efficiency by ~40% in rhesus macaque B cells without affecting the cell viability (Figure 6A-C), in line with reports in other cells43. However, extended culture in 1% DMSO should be avoided and may affect cell viability. DMSO may be completely omitted if desired.
The culture of the cells in a small volume after electroporation for several hours together with the rAAV6 leads to higher editing efficiencies, probably due to the better transduction of HDRT by the rAAV6 and, thus, the higher intracellular concentration of HDRT at the relevant time when Cas9 is active. We found that culturing the cells this way for up to 8 h did not affect the cell viability, but the editing efficiencies did not increase dramatically beyond 5 h (Figure 6). If only knock-out instead of knock-in is required, this step may be omitted.
In conclusion, we present comprehensive protocols for the gene editing of rhesus macaque B cells in vitro and the production of rAAV6 HDRT necessary for the efficient knock-in of desired constructs. These protocols enable the rapid, cost-effective testing of many constructs packaged as rAAV6 and enable the preclinical testing of the feasibility and scalability of B cell therapies in a more relevant non-human primate model.

B cells are the foundation of humoral immunity. Upon activation by cognate antigen and secondary signals, na&#239;ve B cells give rise to germinal center B cells, memory B cells, and plasma cells1. The latter is the source of the secreted antibodies that mediate the protective functions of most currently available vaccines2. Plasma cells have been described as antibody factories as they secrete vast amounts of antibodies into the serum-about 2 ng/day/cell3, amounting to 7-16 g/L serum, making antibodies one of the three most abundant proteins in serum4. B cells are abundant in blood and can, thus, be easily obtained and infused back into an individual.
These traits have made B cells a target of cell therapy efforts to gene-edit the B cell receptor (BCR) and express broadly neutralizing antibodies (bNAbs) to the human immunodeficiency virus (HIV)5,6,7,8,9,10,11,12,13,14,15 and other proteins16,17,18,19,20,21. Such approaches have shown potential in numerous mouse studies in vivo7,8,10,11,16,22. However, several hurdles still must be overcome for clinical translation9,15,23, among them safety, duration, and magnitude of the therapeutic efficacy, as well as scaling to larger animals such as non-human primates (NHPs). Indeed, NHPs, and in particular rhesus macaques, which have a long history in antibody and HIV research24,25, are the most suitable model to test these parameters.
Here, we developed protocols that enable these issues to be addressed. To date, few studies have attempted to culture rhesus macaque B cells ex vivo,&#160;and only positive selection using CD20 has been reported for the purification of rhesus macaque B cells26,27,28. We have established a protocol for the isolation of untouched rhesus macaque B cells by the negative depletion of other cell types. Furthermore, culturing conditions are defined for the targeted gene editing of rhesus macaque B cells. This protocol outlines the use of CRISPR/Cas9 ribonucleoproteins (RNPs) and recombinant adeno-associated virus serotype 6 (rAAV6) as homology-directed repair template (HDRT) to gene edit cultured rhesus macaque B cells. Using&#160;this protocol, editing efficiencies up to 40% with large (~1.5 kb) inserts were achieved. We also present a fast and cost-effective method to produce rAAV6 using a tetracycline-enabled, self-silencing adenoviral helper29 to enable the fast testing of HDRTs in this format. Combined, these protocols describe an efficient workflow for the gene editing of rhesus macaque B cells (Figure 1), enabling the evaluation of B cell therapies in an NHP model.
To start the experiments, donor material can be ordered from commercial sources or obtained by phlebotomies or splenectomy. In this study, the phlebotomies and blood collections were performed as previously described30 using the anticoagulant EDTA. To obtain splenic, primary rhesus macaque B cells, partial (25%-50%) or total splenectomies were performed using techniques reported earlier31. The animals were fasted overnight before the surgery. Briefly, during the surgery, the abdomen was clipped and prepared with alternating scrubs of chlorhexidine and 70% isopropyl alcohol three times. An incision (5-10 cm) was made in the abdomen to identify and isolate the spleen. The vasculature of the spleen was ligated with either sutures or vascular clamps. The incision was closed in two layers with 4-0 PDS polydioxanone sutures. Splenectomy was performed a single time for an individual animal. Single-cell suspensions were prepared from macaque spleens by maceration through cell strainers. Mononuclear cells from blood and splenic cell suspensions were prepared using density gradient centrifugation and stored in liquid nitrogen.

<table><tbody><tr><td>1.5 mL tube sterile, Dnase, Rnase and purogen free</td><td>Stellar Scientific</td><td>T17-125</td><td>or similar</td></tr><tr><td>10 mL serological pipette, polystyrene, sterile, nonpyrogenic, DNase-/RNase-free, and Human DNA-free</td><td>Corning</td><td>4488</td><td>or similar</td></tr><tr><td>15 cm tissue culture dish</td><td>Falcon</td><td>353025</td><td>or similar</td></tr><tr><td>15 mL polypropylene conical tybe</td><td>Falcon</td><td>352097</td><td>or similar</td></tr><tr><td>25 mL serological pipette, polystyrene, sterile, nonpyrogenic, DNase-/RNase-free, and Human DNA-free</td><td>Corning</td><td>4489</td><td>or similar</td></tr><tr><td>250 mL polypropylene conical tybe</td><td>Corning</td><td>430776</td><td>or similar</td></tr><tr><td>293AAV cell line</td><td>Cell Biolabs</td><td>AAV-100</td><td></td></tr><tr><td>2-B-mercapto-ethanol, 55mM (1000x)</td><td>Gibco</td><td>21985-023</td><td></td></tr><tr><td>48-well tissue culture plate</td><td>Corning</td><td>3548</td><td>or similar</td></tr><tr><td>5 mL serological pipette, polystyrene, sterile, nonpyrogenic, DNase-/RNase-free, and Human DNA-free</td><td>Corning</td><td>4487</td><td>or similar</td></tr><tr><td>5 mL syringes with Luer-Lok Tip</td><td>BD</td><td>309646</td><td>or similar</td></tr><tr><td>50 mL polypropylene conical tybe</td><td>Falcon</td><td>352070</td><td>or similar</td></tr><tr><td>50 mL serological pipette, polystyrene, sterile, nonpyrogenic, DNase-/RNase-free, and Human DNA-free</td><td>Corning</td><td>4490</td><td>or similar</td></tr><tr><td>6-well tissue culture plate</td><td>Falcon</td><td>353046</td><td>or similar</td></tr><tr><td>AAV-6 Packaging System (plasmids)</td><td>Cell Biolabs</td><td>VPK-406</td><td></td></tr><tr><td>AAV6 Reference Materials (full capsids)</td><td>Charles River</td><td>RS-AAV6-FL</td><td></td></tr><tr><td>Accu-jet S Pipette Controller</td><td>Brand</td><td>26350</td><td>or similar pipette controller</td></tr><tr><td>Antibiotic/Antimycotic 100x</td><td>Gibco</td><td>15260-062</td><td></td></tr><tr><td>anti-human CD14 AlexaFluor647</td><td>Biolegend</td><td>301812</td><td></td></tr><tr><td>anti-human CD14 biotin</td><td>BioLegend</td><td>301826</td><td></td></tr><tr><td>anti-human CD16 AlexaFluor700</td><td>BD Biosciences</td><td>557920</td><td></td></tr><tr><td>anti-human CD16 biotin</td><td>BioLegend</td><td>302004</td><td></td></tr><tr><td>anti-human CD20 PECy7</td><td>Biolegend</td><td>302312</td><td></td></tr><tr><td>anti-human CD3 biotin</td><td>Thermo Fisher</td><td>APS0309</td><td></td></tr><tr><td>anti-human CD3 PE</td><td>BD Biosciences</td><td>552127</td><td></td></tr><tr><td>anti-human CD33 biotin</td><td>Miltenyi</td><td>130-113-347</td><td></td></tr><tr><td>anti-human CD64 biotin</td><td>BioLegend</td><td>305004</td><td></td></tr><tr><td>anti-human CD66 biotin</td><td>Miltenyi</td><td>130-100-143</td><td></td></tr><tr><td>anti-human CD89 biotin</td><td>BioLegend</td><td>354112</td><td></td></tr><tr><td>anti-human CD8a biotin</td><td>BioLegend</td><td>301004</td><td></td></tr><tr><td>anti-human HLA-DR BV605</td><td>Biolegend</td><td>307640</td><td></td></tr><tr><td>anti-human Ig light chain lambda APC</td><td>Biolegend</td><td>316610</td><td></td></tr><tr><td>anti-human IgM BV421</td><td>Biolegend</td><td>314516</td><td></td></tr><tr><td>anti-Human Kappa Light Chain FITC</td><td>Fisher Scientific</td><td>A18854</td><td></td></tr><tr><td>Autoclave</td><td>Steris</td><td>Amsco Lab 250</td><td>or similar</td></tr><tr><td>Cell culture CO2 incubator</td><td>Fisher Scientific</td><td>51026331</td><td>or similar</td></tr><tr><td>Centrifugal Filter Unit (Amicon Ultra - 4, 100 kDa)</td><td>Millipore</td><td>UFC810024</td><td></td></tr><tr><td>Centrifuge 5920 R</td><td>Eppendorf</td><td>EP022628188</td><td>or any other, coolable swinging bucket centrifuge with inserts for 96-well plates, 15, 50 and 250 mL size tubes</td></tr><tr><td>Chloroform</td><td>Fisher Scientific</td><td>C298SK-4</td><td></td></tr><tr><td>Cpg ODN</td><td>Invivogen</td><td>tlrl-2395</td><td></td></tr><tr><td>Dimethyl sulfoxide (DMSO)</td><td>Sigma-Aldrich</td><td>34869-500ML</td><td></td></tr><tr><td>DMEM, High Glucose</td><td>Gibco</td><td>11965092</td><td></td></tr><tr><td>DNaseI (RNase-free)</td><td>New England Biolabs</td><td>M0303L</td><td></td></tr><tr><td>DPBS, no calcium, no magnesium</td><td>Gibco</td><td>14190144</td><td></td></tr><tr><td>Electroporation kit (Neon Transfection System 10 &amp;micro;L)</td><td>Fisher Scientific</td><td>MPK1096</td><td>or other sizes or 100 uL transfection kit MPK 10096</td></tr><tr><td>Electroporation system (Neon Transfection System)</td><td>Fisher Scientific</td><td>MPK5000</td><td></td></tr><tr><td>FCS</td><td>Hyclone</td><td>SH30910.03*</td><td></td></tr><tr><td>Ficoll-PM400 (Ficoll-Paque PLUS)</td><td>Cytiva</td><td>17144002</td><td>or similar</td></tr><tr><td>Fume Hood</td><td>Fisher Scientific</td><td>FH3943810244</td><td>or similar</td></tr><tr><td>Glutamine 200 mM</td><td>Gibco</td><td>25030-081</td><td></td></tr><tr><td>Graduated Cylinder 1L</td><td>Corning</td><td>3022-1L</td><td>or similar</td></tr><tr><td>Hemocytometer</td><td>Sigma-Aldrich</td><td>Z375357-1EA</td><td>or similar</td></tr><tr><td>HEPES 1M</td><td>Gibco</td><td>15630-080</td><td></td></tr><tr><td>HEPES 1M</td><td>Gibco</td><td>15630-080</td><td></td></tr><tr><td>Hot Plate Magnetic Stirrer</td><td>Fisher Scientific</td><td>SP88857200</td><td>or similar</td></tr><tr><td>Human BAFF</td><td>Peprotech&amp;nbsp;</td><td>310-13</td><td></td></tr><tr><td>Human BD Fc Block</td><td>BD</td><td>564220</td><td></td></tr><tr><td>Human IL-10</td><td>Peprotech&amp;nbsp;</td><td>200-10</td><td></td></tr><tr><td>Human IL-2</td><td>Peprotech&amp;nbsp;</td><td>200-02</td><td></td></tr><tr><td>Hydrochloric acid</td><td>Fisher Scientific</td><td>A144S-500</td><td></td></tr><tr><td>Hydrophilic Polyethersulfone Syringe Filters, (Supor membrane), Sterile - 0.2 &amp;micro;m, 25 mm&amp;nbsp;</td><td>Pall</td><td>4612</td><td></td></tr><tr><td>Insulin-Transferin-Selenium, 100x</td><td>Gibco</td><td>41400-045</td><td></td></tr><tr><td>ITR primer forward: GGAACCCCTAGTGATGGAGTT</td><td>Integrated DNA Technologies</td><td>custom</td><td></td></tr><tr><td>ITR primer reverse: CGGCCTCAGTGAGCGA</td><td>Integrated DNA Technologies</td><td>custom</td><td></td></tr><tr><td>Laminar flow biosafety cabinet</td><td>The Baker Company</td><td>SG403A</td><td>or similar</td></tr><tr><td>Large magnetic depletion (LD) Column</td><td>Miltenyi Biotec</td><td>130-042-901</td><td></td></tr><tr><td>Magentic seperator (MidiMACS separator and multistand)</td><td>Miltenyi Biotec</td><td>130-090-329</td><td></td></tr><tr><td>Magnetic stir bar</td><td>Fisher Scientific</td><td>14-512-127</td><td>or similar</td></tr><tr><td>Magnetic streptavidin beads (Streptavidin MicroBeads)</td><td>Miltenyi Biotec</td><td>130-048-101</td><td></td></tr><tr><td>Maxiprep kit</td><td>Machery-Nagel</td><td>740414.5</td><td>or similar</td></tr><tr><td>Media Bottles 2L with cap</td><td>Cole-Parmer</td><td>UX-34514-26</td><td>or similar</td></tr><tr><td>MegaCD40L</td><td>Enzo</td><td>ALX-522-110-C010</td><td></td></tr><tr><td>MicroAmp Optical 384-well Reaction Plate</td><td>Fisher Scientific</td><td>4309849</td><td></td></tr><tr><td>MicroAmp Optical Adhesive Film</td><td>Fisher Scientific</td><td>4311971</td><td></td></tr><tr><td>Microcentrifuge 5424 R</td><td>Eppendorf</td><td>5404000014</td><td>or any other table top centrifuge for 1.5 mL tubes</td></tr><tr><td>Microwave oven</td><td>Panasonic</td><td>NN-SD987SA</td><td>or similar</td></tr><tr><td>Nikon TMS Inverted Phase Contrast Microscope</td><td>Nikon</td><td>TMS</td><td>or any other Inverted phase-contrast microscope for cell culture</td></tr><tr><td>Non-essential amino acids, 100x</td><td>Gibco</td><td>11140-050</td><td></td></tr><tr><td>Nuclease-free Duplex buffer</td><td>Integrated DNA Technologies</td><td>11-01-03-01</td><td></td></tr><tr><td>Nuclease-free Water</td><td>Qiagen</td><td>129115</td><td></td></tr><tr><td>pH meter</td><td>Mettler Toledo</td><td>30019028</td><td>or similar</td></tr><tr><td>Pipetman Classic Starter Kit, 4 Pipette Kit, P2, P20, P200, P1000 and tips</td><td>Gilson</td><td>F167380</td><td>or similar set of pipettes and tips</td></tr><tr><td>Pluronic F-68 10 %</td><td>Gibco</td><td>24040-032</td><td></td></tr><tr><td>Polyethylene Glycol 8000</td><td>Fisher Scientific</td><td>BP233-1</td><td></td></tr><tr><td>Polyethylenimine, Linear, MW 25000, Transfection Grade (PEI 25K</td><td>Polysciences</td><td>23966-100</td><td></td></tr><tr><td>Precision Balance</td><td>Mettler Toledo</td><td>ME4001TE</td><td>or similar</td></tr><tr><td>Pre-Separation Filters (30 &amp;micro;m)</td><td>Miltenyi Biotec</td><td>130-041-407</td><td></td></tr><tr><td>Pyrex glass beaker 2 L</td><td>Cole-Parmer</td><td>UX-34502-13</td><td>or similar</td></tr><tr><td>Pyrex glass beaker 250 mL</td><td>Millipore Sigma</td><td>CLS1000250</td><td>or similar</td></tr><tr><td>qPCR Instrument</td><td>Fisher Scientific</td><td>4485691</td><td>or similar</td></tr><tr><td>RC1 antigen randomly biotinylated</td><td>Bjorkman lab, CalTech</td><td>in house</td><td></td></tr><tr><td>RPMI-1640</td><td>Gibco</td><td>11875-093</td><td></td></tr><tr><td>S.p. Cas9 Nuclease</td><td>Integrated DNA Technologies</td><td>1081059</td><td></td></tr><tr><td>Scientific 1203 Water Bath</td><td>VWR</td><td>24118</td><td>or any water bath set to&amp;nbsp; 37 &amp;deg;C</td></tr><tr><td>Sodium chloride</td><td>Sigma-Aldrich</td><td>S7653-5KG</td><td></td></tr><tr><td>Sodium hydroxide</td><td>Sigma-Aldrich</td><td>S8045-500G</td><td></td></tr><tr><td>Sodium Pyruvate 100 mM</td><td>Gibco</td><td>11360-070</td><td></td></tr><tr><td>Sterile Disposable Filter Units with PES Membranes</td><td>Thermo&amp;nbsp;Scientific Nalgene&amp;nbsp;</td><td>567-0020&amp;nbsp;</td><td></td></tr><tr><td>Streptavidin-PE</td><td>BD Biosciences</td><td>554061</td><td></td></tr><tr><td>SYBR Green Master Mix&amp;nbsp;</td><td>Fisher Scientific</td><td>A25742</td><td></td></tr><tr><td>Tetracycline-enabled, self-silencing adenoviral vector RepCap6&amp;nbsp;</td><td>Oxgene</td><td>TESSA-RepCap6</td><td></td></tr><tr><td>Trypan Blue Solution, 0.4%</td><td>Gibco</td><td>15250061</td><td></td></tr><tr><td>Trypsin-EDTA (0.05%), phenol red</td><td>Gibco</td><td>25300054</td><td></td></tr><tr><td>Water Purification System</td><td>Millipore Sigma</td><td>ZEQ7000TR</td><td>or similar</td></tr><tr><td>Zombie-NIR</td><td>Biolegend</td><td>423106</td><td></td></tr></tbody></table>

gene editing of primary rhesus macaque b cells

B cells and their progeny are the sources of highly expressed antibodies. Their high protein expression capabilities together with their abundance, easy accessibility via peripheral blood, and amenability to simple adoptive transfers have made them an attractive target for gene editing approaches to express recombinant antibodies or other therapeutic proteins. The gene editing of mouse and human primary B cells is efficient, and mouse models for in vivo studies have shown promise, but feasibility and scalability for larger animal models have so far not been demonstrated. We, therefore, developed a protocol to edit rhesus macaque primary B cells in vitro to enable such studies. We report conditions for in vitro culture and gene-editing of primary rhesus macaque B cells from peripheral blood mononuclear cells or splenocytes using CRISPR/Cas9. To achieve the targeted integration of large (&#60;4.5 kb) cassettes, a fast and efficient protocol was included for preparing recombinant adeno-associated virus serotype 6 as a homology-directed repair template using a tetracycline-enabled self-silencing adenoviral helper vector. These protocols enable the study of prospective B cell therapeutics in rhesus macaques.

Watch this Scientific Journal Video about Gene Editing of Primary Rhesus Macaque B Cells at JoVE.com

Gene Editing of Primary Rhesus Macaque B Cells

We present a method for culturing and gene editing primary rhesus macaque B cells using CRISPR/Cas9 and recombinant adeno-associated virus serotype 6 for the study of B cell therapies.

B cells and their progeny are the sources of highly expressed antibodies. Their high protein expression capabilities together with their abundance, easy ...

gene-editing-of-primary-rhesus-macaque-b-cells

Research

JoVE Journal

Immunology and Infection

2.3K Views.  The Rockefeller University. We present a method for culturing and gene editing primary rhesus macaque B cells using CRISPR/Cas9 and recombinant adeno-associated virus serotype 6 for the study of B cell therapies.

Video: Gene Editing of Primary Rhesus Macaque B Cells

Multicolor Flow Cytometry Analyses of Cellular Immune Response in Rhesus Macaques

The rhesus macaque model is currently the best available model for HIV-AIDS with respect to understanding the pathogenesis as well as for the development of vaccines and therapeutics1,2,3. Here, we describe a method for the detailed phenotypic and functional analyses of cellular immune responses, specifically intracellular cytokine production by CD4+ and CD8+ T cells as well as the individual memory subsets. We obtained precise quantitative and qualitative measures for the production of interferon gamma (INF-) and interleukin (IL) -2 in both CD4+ and CD8+ T cells from the rhesus macaque PBMC stimulated with PMA plus ionomycin (PMA+I). The cytokine profiles were different in the different subsets of memory cells. Furthermore, this protocol provided us the sensitivity to demonstrate even minor fractions of antigen specific CD4+ and CD8+ T cell subsets within the PBMC samples from rhesus macaques immunized with an HIV envelope peptide cocktail vaccine developed in our laboratory. The multicolor flow cytometry technique is a powerful tool to precisely identify different populations of T cells 4,5 with cytokine-producing capability6 following non-specific or antigen-specific stimulation 5,7.

We demonstrate the utility of multicolor flow cytometry for detailed phenotypic and functional characterization of total as well as memory subsets of CD4+ and CD8+ T cells in rhesus macaques, the ideal model for HIV/AIDS vaccine studies.

The rhesus macaque model is currently the best available model for HIV-AIDS with respect to understanding the pathogenesis as well as for the development ...

Enhanced Genome Editing with Cas9 Ribonucleoprotein in Diverse Cells and Organisms

Site-specific eukaryotic genome editing with CRISPR (clustered regularly interspaced short palindromic repeats)-Cas (CRISPR-associated) systems has quickly become a commonplace amongst researchers pursuing a wide variety of biological questions. Users most often employ the Cas9 protein derived from Streptococcus pyogenes in a complex with an easily reprogrammed guide RNA (gRNA). These components are introduced into cells, and through a base pairing with a complementary region of the double-stranded DNA (dsDNA) genome, the enzyme cleaves both strands to generate a double-strand break (DSB). Subsequent repair leads to either random insertion or deletion events (indels) or the incorporation of experimenter-provided DNA at the site of the break.
The use of a purified single-guide RNA and Cas9 protein, preassembled to form an RNP and delivered directly to cells, is a potent approach for achieving highly efficient gene editing. RNP editing particularly enhances the rate of gene insertion, an outcome that is often challenging to achieve. Compared to the delivery via a plasmid, the shorter persistence of the Cas9 RNP within the cell leads to fewer off-target events. 
Despite its advantages, many casual users of CRISPR gene editing are less familiar with this technique. To lower the barrier to entry, we outline detailed protocols for implementing the RNP strategy in a range of contexts, highlighting its distinct benefits and diverse applications. We cover editing in two types of primary human cells, T cells and hematopoietic stem/progenitor cells (HSPCs). We also show how Cas9 RNP editing enables the facile genetic manipulation of entire organisms, including the classic model roundworm Caenorhabditis elegans and the more recently introduced model crustacean, Parhyale hawaiensis.

Utilizing a preassembled Cas9 ribonucleoprotein complex (RNP) is a powerful method for precise, efficient genome editing. Here, we highlight its utility across a broad range of cells and organisms, including primary human cells and both classic and emerging model organisms.

Site-specific eukaryotic genome editing with CRISPR (clustered regularly interspaced short palindromic repeats)-Cas (CRISPR-associated) systems has ...

Genetics

Preparation and Gene Modification of Nonhuman Primate Hematopoietic Stem and Progenitor Cells

Hematopoietic stem and progenitor cell (HSPC) transplantation has been a cornerstone therapy for leukemia and other cancers for nearly half a century, underlies the only known cure of human immunodeficiency virus (HIV-1) infection, and shows immense promise in the treatment of genetic diseases such as beta thalassemia. Our group has developed a protocol to model HSPC gene therapy in nonhuman primates (NHPs), allowing scientists to optimize many of the same reagents and techniques that are applied in the clinic. Here, we describe methods for purifying CD34+ HSPCs and long-term persisting hematopoietic stem cell (HSC) subsets from primed bone marrow (BM). Identical techniques can be employed for the purification of other HSPC sources (e.g., mobilized peripheral blood stem cells [PBSCs]). Outlined is a 2 day protocol in which cells are purified, cultured, modified with lentivirus (LV), and prepared for infusion back into the autologous host. Key readouts of success include the purity of the CD34+ HSPC population, the ability of purified HSPCs to form morphologically distinct colonies in semisolid media, and, most importantly, gene modification efficiency. The key advantage to HSPC gene therapy is the ability to provide a source of long-lived cells that give rise to all hematopoietic cell types. As such, these methods have been used to model therapies for cancer, genetic diseases, and infectious diseases. In each case, therapeutic efficacy is established by enhancing the function of distinct HSPC progeny, including red blood cells, T cells, B cells, and/or myeloid subsets. The methods to isolate, modify, and prepare HSPC products are directly applicable and translatable to multiple diseases in human patients.

The goal of this protocol is to isolate nonhuman primate CD34+ cells from primed bone marrow, to gene-modify these cells with lentiviral vectors, and to prepare a product for infusion into the autologous host. The total protocol length is approximately 48 h.

Hematopoietic stem and progenitor cell (HSPC) transplantation has been a cornerstone therapy for leukemia and other cancers for nearly half a century, ...

CRISPR/Cas9 Ribonucleoprotein-mediated Precise Gene Editing by Tube Electroporation

Gene editing nucleases, represented by CRISPR-associated protein 9 (Cas9), are becoming mainstream tools in biomedical research. Successful delivery of CRISPR/Cas9 elements into the target cells by transfection is a prerequisite for efficient gene editing. This protocol demonstrates that tube electroporation (TE) machine-mediated delivery of CRISPR/Cas9 ribonucleoprotein (RNP), along with single-stranded oligodeoxynucleotide (ssODN) donor templates to different types of mammalian cells, leads to robust precise gene editing events. First, TE was applied to deliver CRISPR/Cas9 RNP and ssODNs to induce disease-causing mutations in the interleukin 2 receptor subunit gamma (IL2RG) gene and sepiapterin reductase (SPR) gene in rabbit fibroblast cells. Precise mutation rates of 3.57%-20% were achieved as determined by bacterial TA cloning sequencing. The same strategy was then used in human iPSCs on several clinically relevant genes including epidermal growth factor receptor (EGFR), myosin binding protein C, cardiac (Mybpc3), and hemoglobin subunit beta (HBB). Consistently, highly precise mutation rates were achieved (11.65%-37.92%) as determined by deep sequencing (DeepSeq). The present work demonstrates that tube electroporation of CRISPR/Cas9 RNP represents an efficient transfection protocol for gene editing in mammalian cells.

Presented here is a protocol for efficient CRISPR/Cas9 ribonucleoprotein-mediated gene editing in mammalian cells using tube electroporation.

Gene editing nucleases, represented by CRISPR-associated protein 9 (Cas9), are becoming mainstream tools in biomedical research. Successful delivery of ...

piggyBac Transposon System Modification of Primary Human T Cells

The piggyBac transposon system is naturally active, originally derived from the cabbage looper moth1,2. This non-viral system is plasmid based, most commonly utilizing two plasmids with one expressing the piggyBac transposase enzyme and a transposon plasmid harboring the gene(s) of interest between inverted repeat elements which are required for gene transfer activity. PiggyBac mediates gene transfer through a "cut and paste" mechanism whereby the transposase integrates the transposon segment into the genome of the target cell(s) of interest. PiggyBac has demonstrated efficient gene delivery activity in a wide variety of insect1,2, mammalian3-5, and human cells6 including primary human T cells7,8. Recently, a hyperactive piggyBac transposase was generated improving gene transfer efficiency9,10.
Human T lymphocytes are of clinical interest for adoptive immunotherapy of cancer11. Of note, the first clinical trial involving transposon modification of human T cells using the Sleeping beauty transposon system has been approved12. We have previously evaluated the utility of piggyBac as a non-viral methodology for genetic modification of human T cells. We found piggyBac to be efficient in genetic modification of human T cells with a reporter gene and a non-immunogenic inducible suicide gene7. Analysis of genomic integration sites revealed a lack of preference for integration into or near known proto-oncogenes13. We used piggyBac to gene-modify cytotoxic T lymphocytes to carry a chimeric antigen receptor directed against the tumor antigen HER2, and found that gene-modified T cells mediated targeted killing of HER2-positive tumor cells in vitro and in vivo in an orthotopic mouse model14. We have also used piggyBac to generate human T cells resistant to rapamycin, which should be useful in cancer therapies where rapamycin is utilized15.
Herein, we describe a method for using piggyBac to genetically modify primary human T cells. This includes isolation of peripheral blood mononuclear cells (PBMCs) from human blood followed by culture, gene modification, and activation of T cells. For the purpose of this report, T cells were modified with a reporter gene (eGFP) for analysis and quantification of gene expression by flow cytometry.
PiggyBac can be used to modify human T cells with a variety of genes of interest. Although we have used piggyBac to direct T cells to tumor antigens14, we have also used piggyBac to add an inducible safety switch in order to eliminate gene modified cells if needed7. The large cargo capacity of piggyBac has also enabled gene transfer of a large rapamycin resistant mTOR molecule (15 kb)15. Therefore, we present a non-viral methodology for stable gene-modification of primary human T cells for a wide variety of purposes.

piggyBac Transposon System Modification of Primary Human T Cells

We describe a method to genetically modify primary human T cells with a transgene using the non-viral piggyBac transposon system. T cells modified to using the piggyBac transposon system exhibit stable transgene expression.

The piggyBac transposon system is naturally active, originally derived from the cabbage looper moth1,2. This non-viral system is plasmid based, most ...

Introducing Point Mutations into Human Pluripotent Stem Cells Using Seamless Genome Editing

Custom designed endonucleases, such as RNA-guided Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas9, enable efficient genome editing in mammalian cells. Here we describe detailed procedures to seamlessly genome edit the hepatocyte nuclear factor 4 alpha (HNF4&#945;) locus as an example in human pluripotent stem cells. Combining a piggyBac-based donor plasmid and the CRISPR-Cas9 nickase mutant in a two-step genetic selection, we demonstrate correct and efficient targeting of the HNF4&#945; locus.

Here, we describe a detailed method for seamless gene editing in human pluripotent stem cells using a piggyBac-based donor plasmid and the Cas9 nickase mutant. Two point mutations were introduced into exon 8 of the hepatocyte nuclear factor 4 alpha (HNF4&#945;) locus in human embryonic stem cells (hESCs).

Custom designed endonucleases, such as RNA-guided Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas9, enable efficient genome editing ...

A Guide to Precise Gene Disruption in Primary Bone Marrow-Derived Macrophages

High-Efficiency Gene Disruption in Primary Bone Marrow-Derived Macrophages Using Electroporated Cas9-sgRNA Complexes

Bone marrow-derived macrophages (BMDMs) from mice are a key tool for studying the complex biology of tissue macrophages. As primary cells, they model the physiology of macrophages in vivo more closely than immortalized macrophage cell lines and can be derived from mice already carrying defined genetic changes. However, disrupting gene function in BMDMs remains technically challenging. Here, we provide a protocol for efficient CRISPR/Cas9 genome editing in BMDMs, which allows for the introduction of small insertions and deletions (indels) that result in frameshift mutations that disrupt gene function. The protocol describes how to synthesize single-guide RNAs (sgRNA-Cas9) and form purified sgRNA-Cas9 ribonucleoprotein complexes (RNPs) that can be delivered by electroporation. It also provides an efficient method for monitoring editing efficiency using routine Sanger sequencing and a freely available online analysis program. The protocol can be performed within 1 week and does not require plasmid construction; it typically results in 85% to 95% editing efficiency.

Author Spotlight: Efficient CRISPR/Cas9 Genome Editing in Bone Marrow-Derived Macrophages for Precise Gene Disruption

This protocol describes the procedure for genome editing in mouse bone marrow-derived macrophages using Cas9-sgRNA ribonucleoprotein complexes assembled in vitro and delivered by electroporation.

Bone marrow-derived macrophages (BMDMs) from mice are a key tool for studying the complex biology of tissue macrophages. As primary cells, they model the ...

Analysis of Simian Immunodeficiency Virus-specific CD8+ T-cells in Rhesus Macaques by Peptide-MHC-I Tetramer Staining

Peptide-major histocompatibility complex class I (pMHC-I) tetramers have been an invaluable tool to study CD8+ T-cell responses. Because these reagents directly bind to T-cell receptors on the surface of CD8+ T-lymphocytes, fluorochrome-labeled pMHC-I tetramers enable the accurate detection of antigen (Ag)-specific CD8+ T-cells without the need for in vitro re-stimulation. Moreover, when combined with multi-color flow cytometry, pMHC-I tetramer staining can reveal key aspects of Ag-specific CD8+ T-cells, including differentiation stage, memory phenotype, and activation status. These types of analyses have been especially useful in the field of HIV immunology where CD8+ T-cells can affect progression to AIDS. Experimental infection of rhesus macaques with simian immunodeficiency virus (SIV) provides an invaluable tool to study cellular immunity against the AIDS virus. As a result, considerable progress has been made in defining and characterizing T-cell responses in this animal model. Here we present an optimized protocol for enumerating SIV-specific CD8+ T-cells in rhesus macaques by pMHC-I tetramer staining. Our assay permits the simultaneous quantification and memory phenotyping of two pMHC-I tetramer+ CD8+ T-cell populations per test, which might be useful for tracking SIV-specific CD8+ T-cell responses generated by vaccination or SIV infection. Considering the relevance of nonhuman primates in biomedical research, this methodology is applicable for studying CD8+ T-cell responses in multiple disease settings.

Analysis of Simian Immunodeficiency Virus-specific CD8+ T-cells in Rhesus Macaques by Peptide-MHC-I Tetramer Staining

Here, we present an optimized protocol for enumerating and characterizing rhesus macaque CD8+ T cells against the AIDS virus. This article is useful not only to the field of HIV immunology, but also to other areas of biomedical research where CD8+ T cell responses are known to affect disease outcome.

Peptide-major histocompatibility complex class I (pMHC-I) tetramers have been an invaluable tool to study CD8+ T-cell responses. Because these reagents ...

Transduction and Expansion of Primary T Cells in Nine Days with Maintenance of Central Memory Phenotype

Emerging immunotherapies to treat infectious diseases and cancers often involve transduction of cellular populations with genes encoding disease-targeting proteins. For example, chimeric antigen receptor (CAR)-T cells to treat cancers and viral infections involve the transduction of T cells with synthetic genes encoding CAR molecules. The CAR molecules make the T cells specifically recognize and kill cancer or virally infected cells. Cells can also be co-transduced with other genes of interest. For example, cells can be co-transduced with genes encoding proteins that target cells to specific locations. Here, we present a protocol to transduce primary peripheral blood mononuclear cells (PBMCs) with genes encoding a virus-specific CAR and the B cell follicle homing molecule chemokine receptor type 5 (CXCR5). This procedure takes nine days and results in transduced T cell populations that maintain a central memory phenotype. Maintenance of a central memory or less differentiated phenotype has been shown to associate with persistence of cells post-infusion. Furthermore, cells produced with this method show high levels of viability, high levels of co-expression of the two transduced genes, and large enough quantities of cells for immunotherapeutic infusion. This nine-day protocol may be broadly used for CAR-T cell and other T cell immunotherapy approaches. The methods described here are based on studies presented in our previous publications.

We outline a 9-day protocol for the transduction and expansion of rhesus macaque peripheral blood mononuclear cells which yields cells with excellent co-expression of the genes of interest in sufficient number for infusion studies of cell efficacy.

Emerging immunotherapies to treat infectious diseases and cancers often involve transduction of cellular populations with genes encoding disease-targeting ...

Bioengineering

Lentiviral CRISPR/Cas9-Mediated Genome Editing for the Study of Hematopoietic Cells in Disease Models

Manipulating genes in hematopoietic stem cells using conventional transgenesis approaches can be time-consuming, expensive, and challenging. Benefiting from advances in genome editing technology and lentivirus-mediated transgene delivery systems, an efficient and economical method is described here that establishes mice in which genes are manipulated specifically in hematopoietic stem cells. Lentiviruses are used to transduce Cas9-expressing lineage-negative bone marrow cells with a guide RNA (gRNA) targeting specific genes and a red fluorescence reporter gene (RFP), then these cells are transplanted into lethally-irradiated C57BL/6 mice. Mice transplanted with lentivirus expressing non-targeting gRNA are used as controls. Engraftment of transduced hematopoietic stem cells are evaluated by flow cytometric analysis of RFP-positive leukocytes of peripheral blood. Using this method, ~90% transduction of myeloid cells and ~70% of lymphoid cells at 4 weeks after transplantation can be achieved. Genomic DNA is isolated from RFP-positive blood cells, and portions of the targeted site DNA are amplified by PCR to validate the genome editing. This protocol provides a high-throughput evaluation of hematopoiesis-regulatory genes and can be extended to a variety of mouse disease models with hematopoietic cell involvement.

Described are protocols for the highly efficient genome editing of murine hematopoietic stem and progenitor cells (HSPC) by the CRISPR/Cas9 system to rapidly develop mouse model systems with hematopoietic system-specific gene modifications.

Manipulating genes in hematopoietic stem cells using conventional transgenesis approaches can be time-consuming, expensive, and challenging. Benefiting ...

Gene Editing of Primary Rhesus Macaque B Cells

Summary

Explore More Videos

Chapters in this video

Multicolor Flow Cytometry Analyses of Cellular Immune Response in Rhesus Macaques

Enhanced Genome Editing with Cas9 Ribonucleoprotein in Diverse Cells and Organisms

Preparation and Gene Modification of Nonhuman Primate Hematopoietic Stem and Progenitor Cells

CRISPR/Cas9 Ribonucleoprotein-mediated Precise Gene Editing by Tube Electroporation

piggyBac Transposon System Modification of Primary Human T Cells

Introducing Point Mutations into Human Pluripotent Stem Cells Using Seamless Genome Editing

High-Efficiency Gene Disruption in Primary Bone Marrow-Derived Macrophages Using Electroporated Cas9-sgRNA Complexes

Analysis of Simian Immunodeficiency Virus-specific CD8⁺ T-cells in Rhesus Macaques by Peptide-MHC-I Tetramer Staining

Transduction and Expansion of Primary T Cells in Nine Days with Maintenance of Central Memory Phenotype

Lentiviral CRISPR/Cas9-Mediated Genome Editing for the Study of Hematopoietic Cells in Disease Models