This work is supported by the Topsector Life Sciences &#38; Health - Topconsortium voor Kennis en Innovatie Health~Holland (LSH-TKI) public-private partnerships (PPP) allowance of the Dutch LSH sector with Project number LSHM16021 Organoids as novel tool for toxicology modelling to Hubrecht Organoid Technology (HUB) and HUB internal funding to Disease Modeling and Toxicology department. We thank the laboratories of Sabine Middendorp (Division of Pediatric Gastroenterology, Wilhelmina Children&#39;s Hospital, UMC, Utrecht) and Hugo R. de Jonge and Marcel J.C. Bijvelds (Department of Gastroenterology and Hepatology, Erasmus MC, Rotterdam) for providing initial technical support to set up monolayers on membrane inserts.

<ol>
	<li>Haegebarth, A., Clevers, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wnt+signaling,+lgr5,+and+stem+cells+in+the+intestine+and+skin.">Wnt signaling, lgr5, and stem cells in the intestine and skin.</a> The American Journal of Pathology. 174 (3), 715-721 (2009).</li><li>Schoultz, I., Keita, &. #. 1. 9. 7. ;. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+intestinal+barrier+and+current+techniques+for+the+assessment+of+gut+permeability.">The intestinal barrier and current techniques for the assessment of gut permeability.</a> Cells. 9 (8), 1909 (2020).</li><li>Mart&#237;nez-Maqueda, D., Miralles, B., Recio, I., Verhoeckx, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HT29+Cell+Line.">HT29 Cell Line.</a> The Impact of Food Bio-Actives on Gut Health: In Vitro and Ex Vivo Models. , 113-124 (2015).</li><li>Sato, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+Lgr5+stem+cells+build+crypt-villus+structures+in+vitro+without+a+mesenchymal+niche.">Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche.</a> Nature. 459 (7244), 262-265 (2009).</li><li>Sato, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+expansion+of+epithelial+organoids+from+human+colon,+adenoma,+adenocarcinoma,+and+Barrett's+epithelium.">Long-term expansion of epithelial organoids from human colon, adenoma, adenocarcinoma, and Barrett's epithelium.</a> Gastroenterology. 141 (5), 1762-1772 (2011).</li><li>Huch, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+expansion+of+single+Lgr5(+)+liver+stem+cells+induced+by+Wnt-driven+regeneration.">In vitro expansion of single Lgr5(+) liver stem cells induced by Wnt-driven regeneration.</a> Nature. 11 (2), 179-194 (2013).</li><li>Sachs, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+expanding+human+airway+organoids+for+disease+modeling.">Long-term expanding human airway organoids for disease modeling.</a> The EMBO Journal. 38 (4), 1-20 (2019).</li><li>Karthaus, W. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+multipotent+luminal+progenitor+cells+in+human+prostate+organoid+cultures.">Identification of multipotent luminal progenitor cells in human prostate organoid cultures.</a> Cell. 159 (1), 163-175 (2014).</li><li>Boj, S. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organoid+models+of+human+and+mouse+ductal+pancreatic+cancer.">Organoid models of human and mouse ductal pancreatic cancer.</a> Cell. 160 (1-2), 324-338 (2015).</li><li>Sachs, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+living+biobank+of+breast+cancer+organoids+captures+disease+heterogeneity.">A living biobank of breast cancer organoids captures disease heterogeneity.</a> Cell. 172 (1-2), 373-386 (2018).</li><li>Vlachogiannis, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Patient-derived+organoids+model+treatment+response+of+metastatic+gastrointestinal+cancers.">Patient-derived organoids model treatment response of metastatic gastrointestinal cancers.</a> Science. 359 (6378), 920-926 (2018).</li><li>Van De Wetering, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prospective+derivation+of+a+living+organoid+biobank+of+colorectal+cancer+patients.">Prospective derivation of a living organoid biobank of colorectal cancer patients.</a> Cell. 161 (4), 933-945 (2015).</li><li>Driehuis, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pancreatic+cancer+organoids+recapitulate+disease+and+allow+personalized+drug+screening.">Pancreatic cancer organoids recapitulate disease and allow personalized drug screening.</a> Proceedings of the National Academy of Sciences of the United States of America. 116 (52), 26580-26590 (2019).</li><li>Tiriac, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organoid+profiling+identifies+common+responders+to+chemotherapy+in+pancreatic+cancer.">Organoid profiling identifies common responders to chemotherapy in pancreatic cancer.</a> Cancer Discovery. 8 (9), 1112-1129 (2018).</li><li>d'Aldebert, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+human+colon+organoids+from+inflammatory+bowel+disease+patients.">Characterization of human colon organoids from inflammatory bowel disease patients.</a> Frontiers in Cell and Developmental Biology. 8, 363 (2020).</li><li>Dotti, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alterations+in+the+epithelial+stem+cell+compartment+could+contribute+to+permanent+changes+in+the+mucosa+of+patients+with+ulcerative+colitis.">Alterations in the epithelial stem cell compartment could contribute to permanent changes in the mucosa of patients with ulcerative colitis.</a> Gut. 66 (12), 2069-2079 (2017).</li><li>VanDussen, K. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+an+enhanced+human+gastrointestinal+epithelial+culture+system+to+facilitate+patient-based+assays.">Development of an enhanced human gastrointestinal epithelial culture system to facilitate patient-based assays.</a> Gut. 64 (6), 911-920 (2015).</li><li>Noel, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+primary+human+macrophage-enteroid+co-culture+model+to+investigate+mucosal+gut+physiology+and+host-pathogen+interactions.">A primary human macrophage-enteroid co-culture model to investigate mucosal gut physiology and host-pathogen interactions.</a> Scientific Reports. 7, 45270 (2017).</li><li>Bartfeld, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+expansion+of+human+gastric+epithelial+stem+cells+and+their+responses+to+bacterial+infection.">In vitro expansion of human gastric epithelial stem cells and their responses to bacterial infection.</a> Gastroenterology. 148 (1), 126-136 (2015).</li><li>van Es, J. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wnt+signalling+induces+maturation+of+Paneth+cells+in+intestinal+crypts.">Wnt signalling induces maturation of Paneth cells in intestinal crypts.</a> Nature Cell Biology. 7 (4), 381-386 (2005).</li><li>van Es, J. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dll1+marks+early+secretory+progenitors+in+gut+crypts+that+can+revert+to+stem+cells+upon+tissue+damage.">Dll1 marks early secretory progenitors in gut crypts that can revert to stem cells upon tissue damage.</a> Nature Cell Biology. 14 (10), 1099-1104 (2012).</li><li>de Lau, W. B. M., Snel, B., Clevers, H. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+R-spondin+protein+family.">The R-spondin protein family.</a> Genome Biology. 13 (3), 1-10 (2012).</li><li>Basak, O., Beumer, J., Wiebrands, K., Seno, H., van Oudenaarden, A., Clevers, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induced+quiescence+of+Lgr5++stem+cells+in+intestinal+organoids+enables+differentiation+of+hormone-producing+enteroendocrine+cells.">Induced quiescence of Lgr5+ stem cells in intestinal organoids enables differentiation of hormone-producing enteroendocrine cells.</a> Cell Stem Cell. 20 (2), 177-190 (2017).</li><li>Beumer, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enteroendocrine+cells+switch+hormone+expression+along+the+crypt-to-villus+BMP+signalling+gradient.">Enteroendocrine cells switch hormone expression along the crypt-to-villus BMP signalling gradient.</a> Nature Cell Biology. 20 (8), 909-916 (2018).</li><li>Yin, X., Farin, H. F., van Es, J. H., Clevers, H., Langer, R., Karp, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Niche-independent+high-purity+cultures+of+Lgr5++intestinal+stem+cells+and+their+progeny.">Niche-independent high-purity cultures of Lgr5+ intestinal stem cells and their progeny.</a> Nature Methods. 11 (1), 106-112 (2014).</li><li>Boj, S. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Forskolin-induced+swelling+in+intestinal+organoids:+An+in+vitro+assay+for+assessing+drug+response+in+cystic+fibrosis+patients.">Forskolin-induced swelling in intestinal organoids: An in vitro assay for assessing drug response in cystic fibrosis patients.</a> Journal of Visualized Experiments. (120), (2017).</li><li>Miao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Next-generation+surrogate+Wnts+support+organoid+growth+and+deconvolute+Frizzled+pleiotropy+in+vivo.">Next-generation surrogate Wnts support organoid growth and deconvolute Frizzled pleiotropy in vivo.</a> Cell Stem Cell. 27 (5), 840-851 (2020).</li><li>Srinivasan, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TEER+measurement+techniques+for+in+vitro+barrier+model+systems.">TEER measurement techniques for in vitro barrier model systems.</a> Journal of Laboratory Automation. 20 (2), 107-126 (2015).</li><li>Blume, L. -. F., Denker, M., Gieseler, F., Kunze, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Temperature+corrected+transepithelial+electrical+resistance+(TEER)+measurement+to+quantify+rapid+changes+in+paracellular+permeability.">Temperature corrected transepithelial electrical resistance (TEER) measurement to quantify rapid changes in paracellular permeability.</a> Die Pharmazie. 65 (1), 19-24 (2010).</li><li>Lea, T., Verhoeckx, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Caco-2+cell+line.">Caco-2 cell line.</a> The Impact of Food Bio-Actives on Gut Health: In Vitro and Ex Vivo Models. , 103-111 (2015).</li><li>Heo, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modelling+Cryptosporidium+infection+in+human+small+intestinal+and+lung+organoids.">Modelling Cryptosporidium infection in human small intestinal and lung organoids.</a> Nature Microbiology. 3 (7), 814-823 (2018).</li><li>Watanabe, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+ROCK+inhibitor+permits+survival+of+dissociated+human+embryonic+stem+cells.">A ROCK inhibitor permits survival of dissociated human embryonic stem cells.</a> Nature Biotechnology. 25 (6), 681-686 (2007).</li></ol>

The authors declare no conflict of interest.

This protocol describes the general manipulation and maintenance of intestinal organoids as well as the preparation and possible applications of epithelial monolayers derived from these organoids. To date, monolayers have been successfully prepared from the duodenum, ileum, and different regions of colon organoids derived from normal as well as previously and actively inflamed intestinal tissue (unpublished data). The application of patient-derived organoid monolayers facilitates the study of barrier function in a diseas...

The intestinal epithelium acts as a physical barrier between the luminal content of the intestines and the underlying tissue. This barrier comprises a single epithelial layer of mainly absorptive enterocytes that are connected by tight junctions, which establish strong intercellular connections between adjacent cells. These cells form a polarized epithelial lining that separates the apical (lumen) and basolateral sides of the intestine, while simultaneously regulating paracellular transport of digested nutrients and metabolites. In addition to enterocytes, other important epithelial cells such as goblet, Paneth, and enteroendocrine cells also contribute to intestinal homeostasis by producing mucus, antimicrobial peptides, and hormones, respectively. The intestinal epithelium is constantly replenished by dividing leucine-rich repeat-containing G-protein-coupled receptor 5-positive (LGR5+) stem cells in the bottom of intestinal crypts producing transit-amplifying (TA) cells that migrate upwards and differentiate into other cell types1. Disruption of intestinal epithelial homeostasis by genetic and environmental factors, such as exposure to food allergens, medicinal compounds, and microbial pathogens, leads to disruption of intestinal barrier function. These conditions cause several intestinal diseases including inflammatory bowel disease (IBD), celiac disease, and drug-induced GI toxicity2.
Studies on the intestinal epithelium are performed using several in vitro platform systems such as membrane inserts, organs-on-a-chip systems, Ussing chambers, and intestinal rings.These platforms are suitable for establishing polarized epithelial monolayers with access to both apical and basolateral sides of the membrane, using transformed cell lines or primary tissue as models. Although transformed cell lines, such as the colorectal (adeno)carcinoma cell lines Caco-2, T84, and HT-29, are able to differentiate into polarized intestinal enterocytes or mucus-producing cells to some extent, they are not representative of the in vivo&#160;epithelium as several cell types are missing, and various receptors and transporters are aberrantly expressed3. In addition, as cell lines are derived from a single donor, they do not represent interpatient heterogeneity and suffer from reduced complexity and physiological relevance. Although primary tissues used in Ussing chambers and as intestinal rings are more representative of the in vivo&#160;situation, their limited availability, short-term viability, and lack of expandability make them unsuitable as a medium for high-throughput (HT) studies.
Organoids are in vitro epithelial cultures established from different organs such as the intestine, kidney, liver, pancreas, and lung. They are proven to have long-term, stable expandability as well as genetic and phenotypic stability and therefore are representative biological miniatures of the epithelium of the original organ with faithful responses to external stimuli4,5,6,7,8,9. Organoids are efficiently established from either resected or biopsied normal, diseased, inflamed, or cancerous tissue, representing heterogeneous patient-specific responses10,11,12,13,14,15,16. This paper demonstrates how to establish intestinal epithelial monolayers derived from organoid cultures. Monolayers have been successfully established from small intestinal as well as colonic and rectal organoid cultures. This model creates an opportunity to study the transport and permeability of the epithelial cells to drugs as well as their toxicological effects on the epithelium. Moreover, the model allows co-culture with immune cells and bacteria to study their interactions with the intestinal epithelium17,18,19. Furthermore, this model can be used to study responses to therapies in a patient-specific manner and initiate screening efforts to look for the next wave of epithelial barrier-focused therapeutics. Such an approach could be extended to the clinic and pave the way toward personalized treatments.
Although the epithelial monolayers in this protocol are prepared from human normal intestinal organoids, the protocol can be applied and optimized for other organoid models. Epithelial organoid monolayers are cultured in intestinal organoid expansion medium containing Wnt to support stem cell proliferation and represent intestinal crypt cellular composition. Intestinal organoids can be enriched to have different intestinal epithelial fates, such as enterocytes, Paneth, goblet, and enteroendocrine cells, by modulating Wnt, Notch, and epidermal growth factor (EGF) pathways. Here, after the establishment of monolayers in expansion medium, they are driven toward more differentiated intestinal epithelial cells, as described previously20,21,22,23,24,25. For screening purposes, depending on the mode of action of the compound of interest, its target cells, and the experimental conditions, the monolayers can be driven toward the cellular composition of choice to measure the effects of the compound with relevant functional readouts.

<table><tbody><tr><td>100% ethanol</td><td>Fisher Emergo</td><td>10644795</td><td></td></tr><tr><td>1250, 300, and 20 &amp;micro;L low-retention filter-tips</td><td>Greiner bio-one</td><td>732-1432 / 732-1434 / 732-2383</td><td></td></tr><tr><td>15 mL conical tubes</td><td>Greiner bio-one</td><td>188271</td><td></td></tr><tr><td>24-well cell culture plates</td><td>Greiner bio-one</td><td>662160</td><td></td></tr><tr><td>24-well HTS Fluoroblok Transwell plate (light-tight)</td><td>Corning</td><td>351156</td><td></td></tr><tr><td>24-well HTS Transwell plates (Table 1)</td><td>Corning</td><td>3378</td><td></td></tr><tr><td>24-well plate with Transwell inserts</td><td>Corning</td><td>3470</td><td></td></tr><tr><td>40 &amp;micro;m cell strainer</td><td>PluriSelect</td><td>43-50040-01</td><td></td></tr><tr><td>50 mL conical tubes</td><td>Greiner bio-one</td><td>227261</td><td></td></tr><tr><td>6-well cell culture plates</td><td>Greiner bio-one</td><td>657160</td><td></td></tr><tr><td>96-well black plate transparent bottom</td><td>Greiner bio-one</td><td>655090</td><td></td></tr><tr><td>96-well fast thermal cycling plates</td><td>Life Technologies Europe BV</td><td>4346907</td><td></td></tr><tr><td>96-well HTS Fluoroblok Transwell plate</td><td>Corning</td><td>351162</td><td></td></tr><tr><td>96-well HTS Transwell plates (Table 1)</td><td>Corning</td><td>7369</td><td></td></tr><tr><td>96-well transparent culture plate</td><td>Greiner bio-one</td><td>655180</td><td></td></tr><tr><td>A83-01</td><td>Bio-Techne Ltd</td><td>2939</td><td></td></tr><tr><td>Accutase Cell Dissociation Reagent</td><td>Life Technologies Europe BV</td><td>A11105-01</td><td>Cell dissociation reagent 2</td></tr><tr><td>Advanced DMEM/F-12</td><td>Life Technologies Europe BV</td><td>12634028</td><td></td></tr><tr><td>B27 supplement</td><td>Life Technologies Europe BV</td><td>17504001</td><td></td></tr><tr><td>Cell culture microscope (light / optical microscope)</td><td>Leica</td><td></td><td></td></tr><tr><td>CellTiter-Glo</td><td>Promega</td><td>G9683</td><td></td></tr><tr><td>Centrifuge</td><td>Eppendorf</td><td></td><td></td></tr><tr><td>CO&lt;sub&gt;2&lt;/sub&gt; incubator</td><td>PHCBI</td><td></td><td></td></tr><tr><td>DAPT</td><td>Sigma-Aldrich</td><td>D5942</td><td></td></tr><tr><td>DEPC treated H&lt;sub&gt;2&lt;/sub&gt;O</td><td>Life Technologies Europe BV</td><td>750024</td><td></td></tr><tr><td>Dulbecco&#039;s phosphate-buffered saline (DPBS) with Ca&lt;sup&gt;2+&lt;/sup&gt; and Mg&lt;sup&gt;2+&lt;/sup&gt;</td><td>Life Technologies Europe BV</td><td>14040091</td><td></td></tr><tr><td>DPBS, powder, no calcium, no magnesium</td><td>Life Technologies Europe BV</td><td>21600069</td><td></td></tr><tr><td>EnzChek Lysozyme Assay Kit</td><td>Life Technologies Europe BV</td><td>E22013</td><td></td></tr><tr><td>EVOM2 meter with STX electrode</td><td>WTI</td><td></td><td></td></tr><tr><td>Gastrin</td><td>Bio-Techne Ltd</td><td>3006</td><td></td></tr><tr><td>Glass pipettes</td><td>Volac</td><td></td><td></td></tr><tr><td>GlutaMAX</td><td>Life Technologies Europe BV</td><td>35050038</td><td></td></tr><tr><td>hEGF</td><td>Peprotech</td><td>AF-100-15</td><td></td></tr><tr><td>HEPES</td><td>Life Technologies Europe BV</td><td>15630056</td><td></td></tr><tr><td>Human Noggin</td><td>Peprotech</td><td>120-10C</td><td></td></tr><tr><td>Human Rspo3</td><td>Bio-Techne Ltd</td><td>3500-RS/CF</td><td></td></tr><tr><td>IWP-2</td><td>Miltenyi Biotec</td><td>130-105-335</td><td></td></tr><tr><td>Ki67 primary antibody</td><td>Sanbio</td><td>BSH-7302-100</td><td></td></tr><tr><td>Ki67 secondary antibody</td><td>Agilent</td><td>K400111-2</td><td></td></tr><tr><td>Kova International Glasstic Slide with Counting grids</td><td>Fisher Emergo</td><td>10298483</td><td></td></tr><tr><td>Laminar flow hood</td><td>Thermo scientific</td><td></td><td></td></tr><tr><td>Lucifer Yellow CH dilithium salt</td><td>Sigma-Aldrich</td><td>L0259</td><td></td></tr><tr><td>Matrigel, Growth Factor Reduced (GFR)</td><td>Corning</td><td>356231</td><td>extracellular matrix (ECM)</td></tr><tr><td>MicroAmp Fast 8-Tube Strip, 0.1 mL</td><td>Life Technologies Europe BV</td><td>4358293</td><td></td></tr><tr><td>MicroAmp Optical 8-Cap Strips</td><td>Life Technologies Europe BV</td><td>4323032</td><td></td></tr><tr><td>Microcentrifuge tubes</td><td>Eppendorf</td><td>0030 120 086</td><td></td></tr><tr><td>Micropipettes (1000, 200, and 20 &amp;micro;L)</td><td>Gilson</td><td></td><td></td></tr><tr><td>Microtome</td><td>Leica</td><td></td><td></td></tr><tr><td>MUC2 primary antibody</td><td>Santa Cruz Biotechnology</td><td>sc-15334</td><td></td></tr><tr><td>MUC2 secondary antibody</td><td>VWR</td><td>VWRKS/DPVR-HRP</td><td></td></tr><tr><td>Multichannel pipette (200 &amp;micro;L)</td><td>Gilson</td><td></td><td></td></tr><tr><td>N-acetylcysteine</td><td>Sigma-Aldrich</td><td>A9165</td><td></td></tr><tr><td>NGS Wnt</td><td>U-Protein Express</td><td>N001-0.5mg</td><td></td></tr><tr><td>Nicotinamide</td><td>Sigma-Aldrich</td><td>N0636</td><td></td></tr><tr><td>Oligonucleotide ALPI1/Forward</td><td>Custom-made</td><td>GGAGTTATCCTGCTCCCCAC</td><td></td></tr><tr><td>Oligonucleotide ALPI1/Reverse</td><td>Custom-made</td><td>CTAGGAGGTGAAGGTCCAACG</td><td></td></tr><tr><td>Oligonucleotide LGR5/Forward</td><td>Custom-made</td><td>ACACGTACCCACAGAAGCTC</td><td></td></tr><tr><td>Oligonucleotide LGR5/Reverse</td><td>Custom-made</td><td>GGAATGCAGGCCACTGAAAC</td><td></td></tr><tr><td>Oligonucleotide MUC2/Forward</td><td>Custom-made</td><td>AGGATCTGAAGAAGTGTGTCACTG</td><td></td></tr><tr><td>Oligonucleotide MUC2/Reverse</td><td>Custom-made</td><td>TAATGGAACAGATGTTGAAGTGCT</td><td></td></tr><tr><td>Oligonucleotide TBP/Forward</td><td>Custom-made</td><td>ACGCCGAATATAATCCCAAGCG</td><td></td></tr><tr><td>Oligonucleotide TBP/Reverse</td><td>Custom-made</td><td>AAATCAGTGCCGTGGTTCGTG</td><td></td></tr><tr><td>Optical adhesive covers</td><td>Life Technologies Europe BV</td><td>4311971</td><td></td></tr><tr><td>PD0325901</td><td>Stemcell Technologies</td><td>72184</td><td></td></tr><tr><td>Penicillin/streptomycin</td><td>Life Technologies Europe BV</td><td>15140122</td><td></td></tr><tr><td>Plate shaker</td><td>Panasonic</td><td></td><td></td></tr><tr><td>PowerUp SYBR Green Master Mix</td><td>Fisher Emergo</td><td>A25776</td><td></td></tr><tr><td>Primocin</td><td>InvivoGen</td><td>ANT-PM-2</td><td>antimicrobial formulation for primary cells</td></tr><tr><td>Qubit RNA HS Assay Kit</td><td>Life Technologies Europe BV</td><td>Q32852</td><td></td></tr><tr><td>Reagent reservoir for multichannel pipet</td><td>Sigma-Aldrich</td><td>CLS4870</td><td></td></tr><tr><td>REMS AutoSampler with 24-probe or 96C-probe</td><td>WTI</td><td></td><td></td></tr><tr><td>Richard-Allan Scientific Alcian Blue/PAS Special Stain Kit</td><td>Thermo scientific</td><td>87023</td><td></td></tr><tr><td>RNase-Free DNase Set</td><td>Qiagen</td><td>79254</td><td></td></tr><tr><td>RNeasy Mini Kit</td><td>Qiagen</td><td>74106</td><td></td></tr><tr><td>SB202190</td><td>Sigma-Aldrich</td><td>S7076</td><td></td></tr><tr><td>Serological pipettes</td><td>Greiner bio-one</td><td>606180 / 607180 / 760180</td><td></td></tr><tr><td>Serological pipettor (Pipet-Aid)</td><td>Drummond</td><td></td><td></td></tr><tr><td>Single edge razor blade</td><td>GEM Scientific</td><td></td><td></td></tr><tr><td>Superscript 1st strand system for RT-PCR</td><td>Life Technologies Europe BV</td><td>11904018</td><td></td></tr><tr><td>Tecan Spark 10M plate reader</td><td>Tecan</td><td></td><td></td></tr><tr><td>Trypan Blue Solution, 0.4%</td><td>Life Technologies Europe BV</td><td>15250-061</td><td></td></tr><tr><td>TrypLE Express Enzyme (1x)</td><td>Life Technologies Europe BV</td><td>12605-010</td><td>Cell dissociation reagent 1</td></tr><tr><td>Water bath</td><td>Grant</td><td></td><td></td></tr><tr><td>Y27632 (ROCK inhibitor)</td><td>AbMole</td><td>M1817</td><td></td></tr></tbody></table>

organoid-derived epithelial monolayer: a clinically relevant in vitro model for intestinal barrier function

In the past, intestinal epithelial model systems were limited to transformed cell lines and primary tissue. These model systems have inherent limitations as the former do not faithfully represent original tissue physiology, and the availability of the latter is limited. Hence, their application hampers fundamental and drug development research. Adult stem-cell-based organoids (henceforth referred to as organoids) are miniatures of normal or diseased epithelial tissue from which they are derived. They can be established very efficiently from different gastrointestinal (GI) tract regions, have long-term expandability, and simulate tissue- and patient-specific responses to treatments in vitro. Here, the establishment of intestinal organoid-derived epithelial monolayers has been demonstrated along with methods to measure epithelial barrier integrity, permeability and transport,&#160;antimicrobial protein secretion, as well as histology. Moreover, intestinal organoid-derived monolayers can be enriched with proliferating stem and transit-amplifying cells as well as with key differentiated epithelial cells. Therefore, they represent a model system that can be tailored to study the effects of compounds on target cells and their mode of action. Although organoid cultures are technically more demanding than cell lines, once established, they can reduce failures in the later stages of drug development as they truly represent in vivo epithelium complexity and interpatient heterogeneity.

Figure 1A shows a representative brightfield image of intestinal organoids after thawing them from a cryovial. It is important to thaw organoids at a high density to ensure optimal recovery. Organoids are plated in 24- or 6-well plates in ECM domes of approximately 10 &#181;L (Figure 1B). Most normal intestinal organoids have a cystic morphology. After recovering from the thawing process, the organoids grow to a bigger size and are ready to be passaged after 3-7...

Watch this Scientific Journal Video about Organoid-Derived Epithelial Monolayer: A Clinically Relevant In Vitro Model for Intestinal Barrier Function at JoVE.com

Organoid-Derived Epithelial Monolayer: A Clinically Relevant In Vitro Model for Intestinal Barrier Function

Here, we describe the preparation of human organoid-derived intestinal epithelial monolayers for studying intestinal barrier function, permeability, and transport. As organoids represent original epithelial tissue response to external stimuli, these models combine the advantages of expandability of cell lines and the relevance and complexity of primary tissue.

In the past, intestinal epithelial model systems were limited to transformed cell lines and primary tissue. These model systems have inherent limitations ...

organoid-derived-epithelial-monolayer-clinically-relevant-vitro-model

Universidad de Cartagena UDEC

Research

JoVE Journal

Biology

5.9K Views.  Foundation Hubrecht Organoid Technology (HUB). Here, we describe the preparation of human organoid-derived intestinal epithelial monolayers for studying intestinal barrier function, permeability, and transport. As organoids represent original epithelial tissue response to external stimuli, these models combine the advantages of expandability of cell lines and the relevance and complexity of primary tissue.

Video: Organoid-Derived Epithelial Monolayer: A Clinically Relevant In Vitro Model for Intestinal Barrier Function

Real-time Measurement of Epithelial Barrier Permeability in Human Intestinal Organoids

Advances in 3D culture of intestinal tissues obtained through biopsy or generated from pluripotent stem cells via directed differentiation, have resulted in sophisticated in vitro models of the intestinal mucosa. Leveraging these emerging model systems will require adaptation of tools and techniques developed for 2D culture systems and animals. Here, we describe a technique for measuring epithelial barrier permeability in human intestinal organoids in real-time. This is accomplished by microinjection of fluorescently-labeled dextran and imaging on an inverted microscope fitted with epifluorescent filters. Real-time measurement of the barrier permeability in intestinal organoids facilitates the generation of high-resolution temporal data in human intestinal epithelial tissue, although this technique can also be applied to fixed timepoint imaging approaches. This protocol is readily adaptable for the measurement of epithelial barrier permeability following exposure to pharmacologic agents, bacterial products or toxins, or live microorganisms. With minor modifications, this protocol can also serve as a general primer on microinjection of intestinal organoids and users may choose to supplement this protocol with additional or alternative downstream applications following microinjection.

This protocol describes the measurement of epithelial barrier permeability in real-time following pharmacologic treatment in human intestinal organoids using fluorescent microscopy and live cell microscopy.

Advances in 3D culture of intestinal tissues obtained through biopsy or generated from pluripotent stem cells via directed differentiation, have resulted ...

Developmental Biology

Human Colonoid Monolayers to Study Interactions Between Pathogens, Commensals, and Host Intestinal Epithelium

Human 3-dimensional (3D) enteroid or colonoid cultures derived from crypt base stem cells are currently the most advanced ex vivo model of the intestinal epithelium. Due to their closed structures and significant supporting extracellular matrix, 3D cultures are not ideal for host-pathogen studies. Enteroids or colonoids can be grown as epithelial monolayers on permeable tissue culture membranes to allow manipulation of both luminal and basolateral cell surfaces and accompanying fluids. This enhanced luminal surface accessibility facilitates modeling bacterial-host epithelial interactions such as the mucus-degrading ability of enterohemorrhagic E. coli (EHEC) on colonic epithelium. A method for 3D culture fragmentation, monolayer seeding, and transepithelial electrical resistance (TER) measurements to monitor the progress towards confluency and differentiation are described. Colonoid monolayer differentiation yields secreted mucus that can be studied by the immunofluorescence or immunoblotting techniques. More generally, enteroid or colonoid monolayers enable a physiologically-relevant platform to evaluate specific cell populations that may be targeted by pathogenic or commensal microbiota.

Here, we present a protocol to culture human enteroid or colonoid monolayers that have intact barrier function to study host epithelial-microbiota interactions at the cellular and biochemical level.

Human 3-dimensional (3D) enteroid or colonoid cultures derived from crypt base stem cells are currently the most advanced ex vivo model of the intestinal ...

Immunology and Infection

Investigating Intestinal Barrier Breakdown in Living Organoids

Organoids and three-dimensional (3D) cell cultures allow the investigation of complex biological mechanisms and regulations in vitro, which previously was not possible in classical cell culture monolayers. Moreover, monolayer cell cultures are good in vitro model systems but do not represent the complex cellular differentiation processes and functions that rely on 3D structure. This has so far only been possible in animal experiments, which are laborious, time consuming, and hard to assess by optical techniques. Here we describe an assay to quantitatively determine the barrier integrity over time in living small intestinal mouse organoids. To validate our model, we applied interferon gamma (IFN-&#947;) as a positive control for barrier destruction and organoids derived from IFN-&#947; receptor 2 knock out mice as a negative control. The assay allowed us to determine the impact of IFN-&#947; on the intestinal barrier integrity and the IFN-&#947; induced degradation of the tight junction proteins claudin-2, -7, and -15. This assay could also be used to investigate the impact of chemical compounds, proteins, toxins, bacteria, or patient-derived probes on the intestinal barrier integrity.

Here we describe a technique to quantify the barrier integrity of small intestinal organoids. The fact that the method is based on living organoids enables the sequential investigation of different barrier integrity modulating substances or combinations thereof in a time-resolved manner.

Organoids and three-dimensional (3D) cell cultures allow the investigation of complex biological mechanisms and regulations in vitro, which previously was ...

Medicine

Establishment of a 2D Monolayer from 3D Bovine Ileal Enteroid Culture

Generation of a Bovine Primary Enteroid-Derived Two-Dimensional Monolayer Culture System for Applications in Translational Biomedical Research

Organoid cell culture systems can recapitulate the complexity observed in tissues, making them useful in studying host-pathogen interactions, evaluating drug efficacy and toxicity, and tissue bioengineering. However, applying these models for the described reasons may be limited because of the three-dimensional (3D) nature of these models. For example, using 3D enteroid culture systems to study digestive diseases is challenging due to the inaccessibility of the intestinal lumen and its secreted substances. Indeed, stimulation of 3D organoids with pathogens requires either luminal microinjection, mechanical disruption of the 3D structure, or generation of apical-out enteroids. Moreover, these organoids cannot be co-cultured with immune and stromal cells, limiting in-depth mechanistic analysis into pathophysiological dynamics. To circumvent this, we optimized a bovine primary cell two-dimensional (2D) enteroid-derived monolayer culture system, allowing co-culture with other relevant cell types. Ileal crypts isolated from healthy adult cattle were cultured to generate 3D organoids that were cryopreserved for future use. A 2D monolayer was created using revived 3D enteroids that were passaged and disrupted to yield single cells, which were seeded on basement membrane extract-coated transwell cell culture inserts, thereby exposing their apical surface. The intestinal monolayer polarity, cellular differentiation, and barrier function were characterized using immunofluorescence microscopy and measuring transepithelial electrical resistance. Stimulation of the apical surface of the monolayer revealed the expected functionality of the monolayer, as demonstrated by cytokine secretion from both apical and basal compartments. The described 2D enteroid-derived monolayer model holds great promise in investigating host-pathogen interactions and intestinal physiology, drug development, and regenerative medicine.

Author Spotlight: Advanced Enteroid Model for Studying Host-Pathogen Interactions 

Enteroids are emerging as a novel model for studying tissue physiology and pathophysiology, drug development, and regenerative medicine. Here, we describe a bovine primary cell 2D enteroid-derived culture system that permits co-culture with relevant tissue cell types. This model offers a translational advantage for gastrointestinal research modeling.

Organoid cell culture systems can recapitulate the complexity observed in tissues, making them useful in studying host-pathogen interactions, evaluating ...

Human Esophageal Organoids and Air-Liquid Interface Culture Protocols

Three-Dimensional Cell Culture Models to Investigate the Epithelial Barrier in Eosinophilic Esophagitis

The squamous epithelium of the esophagus is directly exposed to the environment, continuously facing foreign antigens, including food antigens and microbes. Maintaining the integrity of the epithelial barrier is critical for preventing infections and avoiding inflammation caused by harmless food-derived antigens. This article provides simplified protocols for generating human esophageal organoids and air-liquid interface cultures from patient biopsies to study the epithelial compartment of the esophagus in the context of tissue homeostasis and disease. These protocols have been significant scientific milestones in the last decade, describing three-dimensional organ-like structures from patient-derived primary cells, organoids, and air-liquid interface cultures. They offer the possibility to investigate the function of specific cytokines, growth factors, and signaling pathways in the esophageal epithelium within a three-dimensional framework while maintaining the phenotypic and genetic properties of the donor. Organoids provide information on tissue microarchitecture by assessing the transcriptome and proteome after cytokine stimulation. In contrast, air-liquid interface cultures allow the assessment of the epithelial barrier integrity through transepithelial resistance (TEER) or macromolecule flux measurements. Combining these organoids and air-liquid interface cultures is a powerful tool to advance research in impaired esophageal epithelial barrier conditions.

Author Spotlight: Investigating the Pathophysiology of Eosinophilic Esophagitis

Here, a protocol for the culture of human esophageal organoids and air-liquid interface culture is provided. Esophageal organoids' air-liquid interface culture can be used to study the impact of cytokines on the esophageal epithelial barrier.

The squamous epithelium of the esophagus is directly exposed to the environment, continuously facing foreign antigens, including food antigens and ...

Generation of Murine Primary Colon Epithelial Monolayers from Intestinal Crypts

The intestinal epithelium is comprised of a single layer of cells that act as a barrier between the gut lumen and the interior of the body. Disruption in the continuity of this barrier can result in inflammatory disorders such as inflammatory bowel disease. One of the limitations in the study of intestinal epithelial biology has been the lack of primary cell culture models, which has obliged researchers to use model cell lines derived from carcinomas. The advent of three dimensional (3D) enteroids has given epithelial biologists a powerful tool to generate primary cell cultures, nevertheless, these structures are embedded in extracellular matrix and lack the maturity characteristic of differentiated intestinal epithelial cells. Several techniques to generate intestinal epithelial monolayers have been published, but most are derived from established 3D enteroids making the process laborious and expensive. Here we describe a protocol to generate primary epithelial colon monolayers directly from murine intestinal crypts. We also detail experimental approaches that can be used with this model such as the generation of confluent cultures on permeable filters, confluent monolayer for scratch wound healing studies and sparse and confluent monolayers for immunofluorescence analysis.

In this protocol, we describe how to generate murine primary epithelial colon monolayers directly from intestinal crypts. We provide experimental approaches to generate confluent monolayers on permeable filters, confluent monolayers for scratch wound healing and biochemical studies, and sparse and confluent monolayers for immunofluorescence analysis.

The intestinal epithelium is comprised of a single layer of cells that act as a barrier between the gut lumen and the interior of the body. Disruption in ...

Culture Methods to Study Apical-Specific Interactions using Intestinal Organoid Models

The lining of the gut epithelium is made up of a simple layer of specialized epithelial cells that expose their apical side to the lumen and respond to external cues. Recent optimization of in vitro culture conditions allows for the re-creation of the intestinal stem cell niche and the development of advanced 3-dimensional (3D) culture systems that recapitulate the cell composition and the organization of the epithelium. Intestinal organoids embedded in an extracellular matrix (ECM) can be maintained for long-term and self-organize to generate a well-defined, polarized epithelium that encompasses an internal lumen and an external exposed basal side. This restrictive nature of the intestinal organoids presents challenges in accessing the apical surface of the epithelium in vitro and limits the investigation of biological mechanisms such as nutrient uptake and host-microbiota/host-pathogen interactions. Here, we describe two methods that facilitate access to the apical side of the organoid epithelium and support the differentiation of specific intestinal cell types. First, we show how ECM removal induces an inversion of the epithelial cell polarity and allows for the generation of apical-out 3D organoids. Second, we describe how to generate 2-dimensional (2D) monolayers from single cell suspensions derived from intestinal organoids, comprised of&#160;mature and differentiated cell types. These techniques provide novel tools to study apical-specific interactions of the epithelium with external cues in vitro and promote the use of organoids as a platform to facilitate precision medicine.

Here we present two protocols that allow the modeling of intestinal apical-specific interactions. Organoid-derived intestinal monolayers and Air-Liquid Interface (ALI) cultures facilitate the generation of well-differentiated epithelia accessible from both luminal and basolateral sides, whereas polarity-inverted intestinal organoids expose their apical side and are amenable to high throughput assays.

The lining of the gut epithelium is made up of a simple layer of specialized epithelial cells that expose their apical side to the lumen and respond to ...

Developing 2D Monolayer Cultures from Bovine Intestinal Organoids

Advancements in Bovine Organoid Technology Using Small and Large Intestinal Monolayer Interfaces

Advancing knowledge of gastrointestinal physiology and its diseases critically depends on the development of precise, species-specific in vitro models that faithfully mimic in vivo intestinal tissues. This is particularly vital for investigating host-pathogen interactions in bovines, which are significant reservoirs for pathogens that pose serious public health risks. Traditional 3D organoids offer limited access to the intestinal epithelium's apical surface, a hurdle overcome by the advent of 2D monolayer cultures. These cultures, derived from organoid cells, provide an exposed luminal surface for more accessible study. In this research, a detailed protocol is introduced for creating and sustaining 2D monolayer cultures from cells of bovine small and large intestinal organoids. This method includes protocols for assessing membrane integrity through transepithelial electrical resistance and paracellular permeability alongside immunocytochemistry staining techniques. These protocols lay the groundwork for establishing and characterizing a 2D bovine monolayer culture system, pushing the boundaries of these method applications in biomedical and translational research of public health importance. Employing this innovative approach enables the development of physiologically pertinent in vitro models for exploring both normal and diseased states of cattle intestinal physiology. The implications for biomedical and agricultural advancements are profound, paving the way for more effective treatments for intestinal ailments in cattle, thereby enhancing both animal welfare and food safety.

Author Spotlight: Development and Characterization of 2D Intestinal Monolayer Models from Bovine Organoids for Pathogen Interaction Studies

This study presents a protocol for generating bovine intestinal 2D monolayers from organoids, offering improved access for studying host-pathogen interactions. It includes methods for assessing membrane integrity and functionality, advancing in vitro models that mimic cattle's gastrointestinal physiology. This approach promises significant biomedical and agricultural benefits, including enhanced treatment strategies.

Advancing knowledge of gastrointestinal physiology and its diseases critically depends on the development of precise, species-specific in vitro models ...

Epithelial Effects of Intestinal Inflammation on Established Murine Colonoids

Studying the Epithelial Effects of Intestinal Inflammation In Vitro on Established Murine Colonoids

The intestinal epithelium plays an essential role in human health, providing a barrier between the host and the external environment. This highly dynamic cell layer provides the first line of defense between microbial and immune populations and helps to modulate the intestinal immune response. Disruption of the epithelial barrier is a hallmark of inflammatory bowel disease (IBD) and is of interest for therapeutic targeting. The 3-dimensional colonoid culture system is an extremely useful in vitro model for studying intestinal stem cell dynamics and epithelial cell physiology in IBD pathogenesis. Ideally, establishing colonoids from the inflamed epithelial tissue of animals would be most beneficial in assessing the genetic and molecular influences on disease. However, we have shown that in vivo epithelial changes are not necessarily retained in colonoids established from mice with acute inflammation. To address this limitation, we have developed a protocol to treat colonoids with a cocktail of inflammatory mediators that are typically elevated during IBD. While this system can be applied ubiquitously to various culture conditions, this protocol emphasizes treatment on both differentiated colonoids and 2-dimensional monolayers derived from established colonoids. In a traditional culture setting, colonoids are enriched with intestinal stem cells, providing an ideal environment to study the stem cell niche. However, this system does not allow for an analysis of the features of intestinal physiology, such as barrier function. Further, traditional colonoids do not offer the opportunity to study the cellular response of terminally differentiated epithelial cells to proinflammatory stimuli. The methods presented here provide an alternative experimental framework to address these limitations. The 2-dimensional monolayer culture system also offers an opportunity for therapeutic drug screening ex vivo. This polarized layer of cells can be treated with inflammatory mediators on the basal side of the cell and concomitantly with putative therapeutics apically to determine their utility in IBD treatment.

Author Spotlight: Studying the Epithelial Effects of Intestinal Inflammation In Vitro on Established Murine Colonoids  

We describe a protocol detailing the isolation of murine colonic crypts for the development of 3-dimensional colonoids. The established colonoids can then be terminally differentiated to reflect the cellular composition of the host epithelium prior to receiving an inflammatory challenge or being directed to establish an epithelial monolayer.

The intestinal epithelium plays an essential role in human health, providing a barrier between the host and the external environment. This highly dynamic ...

Construction of a 3D Intestinal Mucosa Model with Paraffin Embedding

Basic Three-Dimensional (3D) Intestinal Model System with an Immune Component

There has been an increase in the use of in vivo and in vitro intestinal models to study the pathophysiology of inflammatory intestinal diseases, for the pharmacological screening of potentially beneficial substances, and for toxicity studies on potentially harmful food components. Of relevance, there is a current demand for the development of cell-based in vitro models to substitute animal models. Here, a protocol for a basic, &#8220;healthy tissue&#8221; three-dimensional (3D) intestinal equivalent model using cell lines is presented with the dual benefit of providing both experimental simplicity (standardized and easily repeatable system) and physiological complexity (Caco-2 enterocytes with a supporting immune component of U937 monocytes and L929 fibroblasts). The protocol also includes paraffin embedding for light microscopic evaluation of fixed intestinal equivalents, thereby providing the advantage of analyzing multiple visual parameters from a single experiment. Hematoxylin and eosin (H&#38;E) stained sections showing the Caco-2 columnar cells forming a tight and regular monolayer in control treatments are used to verify the efficacy of the model as an experimental system. Using gluten as a pro-inflammatory food component, parameters analyzed from sections include reduced monolayer thickness, as well as disruption and detachment from the underlying matrix (H&#38;E), decreased tight junction protein expression as shown from occludin staining (quantifiable statistically), and immune-activation of migrating U937 cells as evidenced from the cluster of differentiation 14 (CD14) staining and CD11b-related differentiation into macrophages. As shown by using lipopolysaccharide to simulate intestinal inflammation, additional parameters that can be measured are increased mucus staining and cytokine expression (such as midkine) that can be extracted from the medium prior to fixation. The basic three-dimensional (3D) intestinal mucosa model and fixed sections can be recommended for inflammatory status and barrier integrity studies with the possibility of analyzing multiple visual quantifiable parameters.

Author Spotlight: Investigating the Effects of Compounds on Intestinal Tissue Using 3D Human Cell Line Models 

Here we describe constructing a basic three-dimensional (3D) intestinal cell line model system and a paraffin embedding protocol for light microscopic evaluation of fixed intestinal equivalents. Staining of selected proteins permits the analysis of multiple visual parameters from a single experiment for potential use in preclinical drug screening studies.

There has been an increase in the use of in vivo and in vitro intestinal models to study the pathophysiology of inflammatory intestinal diseases, for the ...