We would like to thank the entire Pan lab in IPS. CAS. We thank Dr. Lanfeng Wang (IPS, CAS) for experimental assistance and Dr. Gonalo Cordova Steger (Springer nature), Dr. Jessica VARGAS (IPS, Paris) and Dr. Seng Zhu (IPS, Paris) for comments. This work was supported by grants from the Strategic Priority Research Program of the Chinese Academy of Sciences to L.P (XDA13010500) and H.T (XDB29030300), the National Natural Science Foundation of China to L.P (31870887 and 31570897) and J.Y (31670909). L.P is a fellow of CAS Youth Innovation Promotion Association (2012083).

NOTE: Before starting experiment, the cell lines and fly stocks used must not be contaminated by other pathogens, especially for viruses such as DCV, FHV, Drosophila X virus (DXV), and Avian nephritis virus (ANV). Ideally, RNA sequencing or a simpler PCR-based identification are used to detect the contamination10,45. If contamination occurred, the cell lines and fly stocks should not be used any more until they are decontaminated completely46.
1. Virus and Fly Preparation
<ol>
	<li>Virus propagation and collection 
	NOTE: Drosophila S2* cells are used for DCV propagation and titration. The S2* cell line is derived from a primary culture of late stage D. melanogaster embryos. This cell line has been well described previously47.
	<ol>
		<li>Grow S2* cells in Schneider&#8217;s Drosophila Medium at 25 &#176;C without additional CO2, as a loose, semi-adherent monolayer in a 10 cm cell culture dish, at a density of 1 x 107 viable cells/mL. Use complete medium for S2* cells: Schneider&#8217;s Drosophila Medium containing 10% heat inactivated FBS, 100 units/mL Penicillin and 100 &#956;g/mL Streptomycin. 
		NOTE: Healthy cells should show a round shape and exhibit homogenous size.</li>
		<li>Quickly thaw the DCV stock from -80 &#176;C in a 25 &#176;C water bath. Infect S2* cells with DCV at MOI = 0.01 immediately by directly adding 1 mL of virus solution to the cell culture dishes (growth area: 55 cm2) with 10 mL of complete medium for S2* cells.</li>
		<li>Incubate cells at 25 &#176;C for 3 to 5 days. When the virus is ready for collection, the cell morphology is abnormal (cell shape looks blur) and the culture medium is full of black particles indicative of cell debris.</li>
		<li>Collect the whole cell culture in a 15 mL tube by pipetting up and down and freeze at -80 &#176;C (for up to a year). 
		NOTE: DCV can be stored for prolonged periods of time at -80 &#176;C with minimal loss of infectivity, for up to one year.</li>
		<li>Thaw the cell culture in a 25 &#176;C water bath with constant shaking and then centrifuge at 6,000 x g, for 15 min at 4 &#176;C. Collect the supernatant in a sterile 15 mL tube and vortex. Aliquot up to 200 &#956;L of virus solution per tube. 
		NOTE: Virus aliquots can be stored for short periods of up to 3 days at 4 &#176;C and for up to 1 year at -80 &#176;C. Repeated freeze-thaw cycles should be avoided. It is always better to use all the aliquot at once.</li>
		<li>Pick 5 random virus-containing tubes to determine the average virus tissue culture infective dose (TCID50) by a cytopathic effect (CPE) assay (1 unit of TCID50= 0.7 plaque forming unit [PFU]). 
		NOTE: CPE refers to structural changes in host cells caused by viral invasion. The infecting virus causes lysis of the host cell or when the cell dies without lysis due to an inability to reproduce48.
		<ol>
			<li>On day 1, collect prepared S2* cells by pipetting. Count the cell number. Centrifuge cells for 300 x g for 4 min and discard the supernatant. Dilute the cells to the density of 1 x 106 cells/mL with complete medium for S2* cells as described in step 1.1.1.</li>
			<li>Seed 1 x 105 S2*cells (100 &#956;L) per well to the flat-bottom 96-well-plate (~30% confluency).</li>
			<li>Perform serial 10-fold dilutions of the DCV stock with complete medium for S2* cells. Add 50 &#181;L dilutions into the well. Add 50 &#181;L of culture medium without virus to the well classified as the negative control well. 
			NOTE: For each dilution rate, 8 wells were used. As the typical DCV yield is around 108-109 PFU/mL, the dilution should at least cover ~10-5-10-10.</li>
			<li>On day 4, observe CPE with a bright-field microscope with a 20X or 40X objective. Classify a well in which the cells look blurry and the medium is full of fragments as a &#34;positive well&#34;, and a well in which the cell morphology is normal as &#8220;negative well&#8221;.</li>
			<li>Mark CPE positive or negative wells with + or &#8211;, respectively. Calculate the virus TCID50 by the Reed and Muench method49.</li>
		</ol>
		</li>
		<li>Dispose of all contaminated materials and gloves in the decontamination pan. If the virus cannot reach the desired TCID50, concentrate 100 mL of virus solution by centrifuging at 68,000 x g for 1 h at 4 &#176;C. 
		NOTE: Depending on the aim of the experiment, a range of doses from 102 to 106 TCID50 units can be used for virus infection. Typically, we use 3 x 106 TCID50 units.</li>
		<li>Discard the supernatant and re-suspend in 1 mL of Tris-HCl buffer (10 mM, pH 7.2). Aliquot 20 &#956;L of virus solution per tube and store at -80 &#176;C. Pick 5 random tubes to determine the average virus TCID50 again.</li>
	</ol>
	</li>
	<li>Fly preparation for infection 
	NOTE: Symbiotic bacteria Wolbachia can suppress many kinds of RNA virus infection in insects30,31,32,33,41. Thus, it is essential to purge Wolbachia from flies before studying host-virus infection in vivo33.
	<ol>
		<li>Prepare fly food containing tetracycline by adding 400 &#956;L of 50 &#181;g/mL tetracycline (in 70% ethanol) to 4 g of fresh standard cornmeal fly food (1 L of food contains 77.7 g of cornmeal, 32.19 g of yeast, 10.6 g of agar, 0.726 g of CaCl2, 31.62 g of sucrose, 63.3 g of glucose, 2 g of potassium sorbate and 15 mL of 5% C8H8O3). Mix thoroughly and place the food at 4 &#176;C overnight to evaporate ethanol. 
		NOTE: A high dose of ethanol may affect fly fertility, so do NOT omit this step.</li>
		<li>Warm the food to room temperature and put newly eclosed adult flies (20 females and 10 males) in the vial. Breed the flies at 25 &#176;C, 60% humidity under a normal light/dark cycle. 
		NOTE: Typically, it takes 3-4 days for the flies to lay enough eggs. Too many eggs inhibit larvae development and decrease tetracycline efficiency.</li>
		<li>Collect newly eclosed adult flies (within 3~5 days) under a light flow of CO2, and repeat step ~1.2.1-1.2.2. Typically, at least 3 generations are required for the completely elimination of Wolbachia.</li>
		<li>After 3 generations with tetracycline treatment, collect 5 flies under a light flow of CO2 for the Wolbachia infection test. Grind flies for 1 min with 250 &#956;L of double-distilled water (ddH2O) and a few 0.5 mm sterile ceramic beads in a 1.5 mL tube using a homogenizer. Add another 250 &#956;L of 2x buffer A (0.2 M Tris-HCl, pH 9.0; 0.2 M EDTA; 2% SDS) to the sample and vortex. 
		NOTE: Since SDS will impede the bead movement, 1x buffer A cannot be directly used to grind flies. If the flies have red eyes, remove heads before grinding, as this may influence the color of DNA product.</li>
		<li>Freeze the samples at -80 &#176;C (keep for up to one year). Quickly thaw the the sample from -80 &#176;C in a 25 &#176;C water bath until dissolved. Incubate the samples at 70 &#176;C for 30 min.</li>
		<li>Add 190 &#956;L of 5 M KOAc, vortex and incubate on ice for 15 min or longer.</li>
		<li>Centrifuge samples at 13,000 x g for 5 min at room temperature, collect the supernatant and transfer them to new tubes.</li>
		<li>Repeat step 1.2.7 to obtain DNA with better quality.</li>
		<li>Add 750 &#956;L of isopropanol to each sample and gently invert a few times by hand. Incubate at room temperature for 5 min.</li>
		<li>Centrifuge samples at 13,000 x g for 5 min at room temperature and discard the supernatant. The white genomic DNA pellet will stay at the bottom of the tube.</li>
		<li>Add 1 mL of 70% ethanol to the pellets, centrifuge at 13,000 x g for 5 min, and discard the supernatant. Air-dry the DNA until it becomes transparent.</li>
		<li>Dissolve DNA in 100 &#956;L of ddH2O, titrate DNA concentration by UV-Vis absorption spectrophotometry and dilute the DNA to 100 ng/&#956;L.</li>
		<li>Use 200 ng of DNA for the PCR reaction (in a 20 &#956;L system, see the Table of Materials). Perform PCR by the following program: 95 &#176;C for 15 min; 36 cycle of 95 &#176;C for 45 s, 50 &#176;C for 45 s, and 72 &#176;C for 1 min; and a final extension step (72 &#176;C for 1 min) in a thermal cycler. 
		NOTE: Based on the Wolbachia 16S rRNA, use the following primers: 5&#8217; TGAGGAAGATAATGACGG 3&#8217; (forward) and 5&#8217; CCTCTATCCTCTTTCAACC 3&#8217; (reverse). For wsp, the primers were 5&#8217; CATTGGTGTTGGTGTTGGTG 3&#8217; (forward) and 5&#8217; ACCGAAATAACGAGCTCCAG 3&#8217; (reverse).</li>
		<li>Analyze PCR products with 1% agarose gel electrophoresis. The PCR product size of Wolbachia 16S rRNA and wsp is around 200 bp and 600 bp, respectively.</li>
		<li>Rear Wolbachia free fly stock on standard cornmeal fly food. Collect 3-5 day newly eclosed male flies for infection. 
		NOTE: Tetracycline treatment can also affect intestinal microbiota composition, which subsequently influences antiviral responses in the host. We recommend that all flies should receive the same tetracycline treatments. Keep Wolbachia-free flies growing under standard conditions for at least 3 generations to restore gut microbiota.</li>
	</ol>
	</li>
	<li>Pastrel genotyping 
	NOTE: The presence of the S or R allele of the pst gene in the genetic background has been reported to affect DCV infection in Drosophila34,35. It is necessary to check the pst genotype, especially for DCV infection. There are a few SNPs in pst that can affect virus infection, the major SNP is 512C/T. The temperature gradient PCR is a quick method to identify pst genotype.
	<ol>
		<li>Extract fly genomic DNA as described above (step 1.2.4 - 1.2.15).</li>
		<li>Use 100 ng of DNA as the template, the 512C primer, 5&#8217; CAGCATGGTGTCCATGAAGTC 3&#8217; (forward) and 5&#8217; ACGTGATCAATGCTGAAAGT 3&#8217; (reverse) to detect the R allele, the 512T primer, 5&#8217; CAGCATGGTGTCCATGAAGTT 3&#8217; (forward) and 5&#8217; ACGTGATCAATGCTGAAAGT 3&#8217; (reverse) to detect the S allele.</li>
		<li>Set the Tm (melting temperature) gradients as follows: 54 &#176;C, 54.7 &#176;C, 55.5 &#176;C, 58 &#176;C, 59.7 &#176;C, 62.2 &#176;C, 63.7 &#176;C, and 64 &#176;C (45 s at each temperature). 
		NOTE: 30 cycles of PCR chain reaction are recommended (20 &#956;L system).</li>
		<li>Visualize the 100-bp PCR product by 2% agarose gel electrophoresis.</li>
	</ol>
	</li>
</ol>
2. Viral Infection in Drosophila
<ol>
	<li>Infect flies by nano-injection and perform survival assays.
	<ol>
		<li>Pull the capillaries to prepare injection needles, back-fill the injection needle with oil and assemble the injector as previously described50.</li>
		<li>Anaesthetize flies on the pad under a light flow of CO2. Inoculate flies by intra-thoracic injection44 of 50.6 nL of virus solution (100 PFU, diluted with Tris-HCl buffer, pH 7.2). Inject at least 3 vials of flies (20 flies per vial). 
		NOTE: The injection is time-consuming (generally 100 flies per hour) and DCV replication is very rapid, so it is very important to write down the exact time on the tube once finishing each vial (20 flies). Buffer only injection is set as a mock control. Usually, male adult flies are preferred, as results are more stable and reproducible than when using females since hormonal variations during mating and reproduction may influence the readout of females51.</li>
		<li>Grow the injected flies at 25 &#176;C, 60% humidity under a normal light/dark cycle. Supply flies with fresh food daily and record the number of dead &#64258;ies.</li>
		<li>Perform at least 3 biological replicates and plot the survival curve.</li>
		<li>For the statistical analysis of survival data, generate Kaplan-Meier survival curves by statistical software. Perform log-rank test to calculate the P values. On the survival table, enter information for each subject. The software then computes percent survival at each time, and plots a Kaplan-Meier survival plot. 
		NOTE: Do NOT add additional yeast into the vial. Compared with mock controls, DCV-infected flies occasionally have ascites and are clumsy, which make them vulnerable to the sticky yeast. It is better to record more time points in the preliminary experiment to find out a time frame at which the massive death will happen for infected flies. Generally, the infected flies rarely die within the first two days, even for the Dcr-2 mutant lines. For the Wolbachia free w1118 (Bloomington 5905) fly infected with 100 PFU of DCV, this time window is around 3-5 days post infection. Fruit flies that die within 0.5 h post injection hours should not be counted as a fatality because they may be killed by needle injury not by viral infection.</li>
	</ol>
	</li>
	<li>DCV load measure by CPE assay 
	NOTE: Viral load is measured similarly to the titration of the virus stock (Step 1.1.6) but requires additional sample preparation (step 2.2.1-2.2.4).
	<ol>
		<li>On day 1, infect male flies as described in step 2.1.1-2.1.2. Group injected flies in groups of 20 and keep them growing on fresh fly food for the desired time (typically for 24 h or 3 days). Provide flies with fresh food daily.</li>
		<li>On day 2, seed Drosophila S2* cells in a 10 cm cell culture dish to the density of approximately 5 x106 to 1x107 cells/mL as described in step 1.1.1.</li>
		<li>On day 3, collect 5 flies (under a light flow of CO2) and grind them in a 1.5 mL centrifuge tube for 30 s with 200 &#956;L of Tris buffer and ceramic beads using homogenizer. Store the samples at -80 &#176;C or immediately proceed to the next step.</li>
		<li>Thoroughly vortex the sample. Use a 1 mL syringe and 0.22 &#956;m filter to filter the supernatant to a new 1.5 mL tube. Proceed with the titration, as described in steps 1.1.6.1-1.1.6.5.</li>
	</ol>
	</li>
	<li>DCV load measured by qRT-PCR 
	<ol>
		<li>On day 1, infect flies as described above. Group injected male flies (20 flies/group) and grow on fresh fly food for desired time, typically for 24 h or 3 days. Provide flies with fresh food daily.</li>
		<li>On day 3, collect 5 flies under a light flow of CO2 in a 1.5 mL tube with 200 &#956;L of lysis buffer and 20 ceramic beads (diameter = 0.5 mm), grind the samples by homogenizer with high speed for 30 s. Add 800 &#956;L of additional lysis buffer to each tube and store the samples at -80 &#176;C or immediately conduct RNA extraction and qRT-PCR.</li>
		<li>Prepare RNase free tips, tubes and deionized, diethylpyrocarbonate (DEPC) treated and 0.22 &#181;m membrane-filtered water. Add 200 &#956;L of chloroform (&#8805;99.5%) into the sample and vigorously shake for 15 s by hand. Incubate for 5 min or longer at room temperature until the water phase and the organic phase are clearly separated. 
		NOTE: Chloroform is extremely hazardous and must be handled with care. Do NOT vortex the sample, which will increase the risk of DNA contamination.</li>
		<li>Centrifuge samples at 13,000 x g for 15 min at 4 &#176;C.</li>
		<li>Collect 400 &#956;L of supernatant and transfer the supernatant to new tubes. Mix with the same volume isopropanol (&#8805; 99.5%), gently invert the samples for 20 times by hand, and then precipitate for 10 min or longer at room temperature. 
		NOTE: Precipitation at -20 &#176;C will increase RNA yield.</li>
		<li>Centrifuge samples at 13,000 x g for 10 min at 4 &#176;C. White RNA pellets are visible at the bottom of the tube.</li>
		<li>Discard the supernatant and add 1 mL of 70% ethanol (ethanol in DEPC water) and invert few times to wash the RNA.</li>
		<li>Centrifuge samples at 13,000 x g for 5 min at 4 &#176;C. Discard the supernatant and dry RNA for 5-10 min; RNA should become transparent.</li>
		<li>Add 50 &#956;L of DEPC water to the sample, pipette for few times and vortex.</li>
		<li>Take 3 &#956;L of RNA for titrating the RNA concentration. Quantify the RNA at 260 nm. Normally, the RNA concentration extracted by this protocol is approximately 100-500 &#956;g/&#956;L, which is suitable for cDNA synthesis.</li>
		<li>Use 2 &#956;g of RNA for cDNA synthesis. Dilute the sample to 100 &#956;L with ddH2O and store at -20 &#176;C.</li>
		<li>Perform qRT-PCR according to the manufacturer&#39;s instructions and run qRT-PCR. 
		NOTE: For cDNA synthesis of DCV, random primers worked much better than Poly A primer in our hands. DCV mRNA expression is normalized to endogenous ribosomal protein 49 (rp49) mRNA. Oligonucleotide primers used in this part: rp49 5&#8217; AGATCGTGAAGAAGCGCACCAAG 3&#8217; (forward) and 5&#8217; CACCAGGAACTTCTTGAATCCGG 3&#8217; (reverse); DCV, 5&#8217; TCATCGGTATGCACATTGCT 3&#8217; (forward) and 5&#8217; CGCATAACCATGCTCTTCTG 3&#8217; (reverse); vago, 5&#8217; TGCAACTCTGGGAGGATAGC 3&#8217; (forward) and 5&#8217; AATTGCCCTGCGTCAGTTT 3&#8217; (reverse); virus-induced RNA 1 (vir-1) 5&#8217; GATCCCAATTTTCCCATCAA 3&#8217; (forward) and 5&#8217; GATTACAGCTGGGTGCACAA 3&#8217; (reverse).</li>
	</ol>
	</li>
</ol>

The authors have nothing to disclose.

In this article, we present a detailed procedure on how to establish a viral infectious system in adult Drosophila melanogaster using nano-injection. The protocols include the preparation of appropriate fly lines and virus stock, infection techniques, the evaluation of infectious indicators and the measurement of the antiviral response. Although DCV is used as an example of a viral pathogen, tens of different kinds of virus have been successfully applied for study in the Drosophila system. In addition, hundreds ...

Emerging viral infections, especially by arboviruses, such as the Chikungunya virus1, the Dengue virus, the Yellow fever virus2 and the Zikavirus3, have been a huge threat to public health by causing pandemics4. Thus, a better understanding of virus-host interaction has become increasingly important for epidemic control and treatment of viral diseases in humans. For this goal, more appropriate and efficient models must be established to investigate the mechanisms underlying virus infection.
The fruit fly, Drosophilamelanogaster (D. melanogaster), provides a powerful system to investigate virus-host interaction5,6 and has proven to be one of the most efficient models to study human viral diseases7,8,9. Highly conserved antiviral signaling pathways and incomparable genetic tools make flies a great model to produce significant results with real implications for human antiviral studies. In addition, flies are easy and inexpensive to maintain in the laboratory and are convenient for large-scale screening of novel regulatory factors6,10 in the virus and the host during infection.
Four major highly conserved antiviral pathways (e.g., the RNA interference (RNAi) pathway11, the JAK-STAT pathway12, the NF-&#954;B pathway, and the autophagy pathway13) are well studied in Drosophila in recent years6. The RNAi pathway is a broad antiviral mechanism that can suppress most kinds of virus infection6,14. Disruption of this pathway by mutation in genes like Dicer-2 (Dcr-2) or Argonaute 2 (AGO2) can lead to increased virus titer and host mortality15,16,17. The JAK-STAT pathway has been implicated in control of infection by a virus from the Dicistroviridae family and the Flaviviridae family in insects, e.g., Drosophila C virus (DCV) in flies16 and West Nile virus (WNV) and Dengue Virus in mosquito18,19. The Drosophila Toll (homologous to the human NF-&#954;B pathway) and Immune deficiency (IMD) pathways (similar to the human NF-&#954;B and TNF pathway) are both involved in defending virus invasion20,21,22. Autophagy is another conserved mechanism involved in the regulation of viral infection, which is well characterized in Drosophila23,24. Thus, identification of novel regulatory factors of these pathways and dissecting crosstalk between these antiviral signaling and other biological pathways, such as metabolism, aging, neural reaction and so on, can be easily set up in the Drosophila system.
Although most well-established viral infectious models in Drosophila are induced by RNA viruses, infection by the Invertebrate iridescent Virus 6I (IV-6) and Kallithea viruses have shown the potential for study of DNA viruses in flies25,26. Moreover, the virus can also be modified to allow infection of Drosophila, such as the influenza virus9. This has greatly expanded the application of the Drosophila screening platform. In this procedure, we use DCV as an example to describe how to develop a viral infectious system in Drosophila. DCV is a positive-sense single stranded RNA virus of approximately 9300 nucleotides, encoding 9 proteins27. As a natural pathogen of D. melanogaster, DCV is considered as a suitable virus to study host physiological, behavioral and basal immune response during host-virus interaction and co-evolution28. Additionally, its rapid mortality rate following infection in wild type flies makes DCV useful to screen for resistant or susceptible genes in the host29.
However, there are several aspects of concern when studying viral infections in Drosophila. For example, symbiotic bacteria Wolbachia have an ability to inhibit a wide spectra of RNA virus proliferation in Drosophila and mosquito30,31,32. Recent evidence shows a possible mechanism in which Wolbachia blocks Sindbis virus (SINV) infection through the upregulation of methyltransferase Mt2 expression in the host33. Additionally, the genetic background of insects is also critical for viral infection. For instance, the natural polymorphism in the gene, pastrel (pst), determines the susceptibility to DCV infection in Drosophila34,35, whilst the loci of Ubc-E2H and CG8492 are involved in Cricket paralysis virus&#160;(CrPV) and Flock house virus (FHV) infection, respectively36.
The particular ways to establish the virus-host interaction in flies, must be chosen according to research purposes such as a high-throughput screen for host cellular components in Drosophila cell lines37,38, oral infection to study gut-specific antiviral response22,39,40, needle pricking41,42 or nano-injection by passing epithelial barriers to stimulate systemic immune responses. Nano-injection can precisely control the viral dose to induce a controlled antiviral reaction and a physiological lesion43, thus guaranteeing high experimental reproducibility44. In this study, we describe a nano-injection method to study virus-host interactions in Drosophila, highlighting the importance of the flies&#39; background effects.

<table><tbody><tr><td>0.22um filter</td><td>Millipore</td><td>SLGP033RS</td><td></td></tr><tr><td>1.5 ml Microcentrifuge tubes</td><td>Brand</td><td>352070</td><td></td></tr><tr><td>1.5 ml RNase free Microcentrifuge tubes</td><td>Axygen</td><td>MCT-150-C</td><td></td></tr><tr><td>10 cm cell culture dish</td><td>Sigma</td><td>CLS430167</td><td>Cell culture</td></tr><tr><td>100 Replacement tubes</td><td>Drummond Scientific</td><td>3-000-203-G/X</td><td></td></tr><tr><td>15 ml tube</td><td>Corning</td><td>352096</td><td></td></tr><tr><td>ABI 7500 qPCR system</td><td>ABI</td><td>7500</td><td>qPCR</td></tr><tr><td>Cell Incubator</td><td>Sanyo</td><td>MIR-553</td><td></td></tr><tr><td>Centriguge</td><td>Eppendof</td><td>5810R</td><td></td></tr><tr><td>Centriguge</td><td>Eppendof</td><td>5424R</td><td></td></tr><tr><td>Chloroform</td><td>Sigma</td><td>151858</td><td>RNA extraction</td></tr><tr><td>DEPC water</td><td>Sigma</td><td>95284-100ML</td><td>RNA extraction</td></tr><tr><td>Drosophila Incubator</td><td>Percival</td><td>I-41NL</td><td>Rearing Drosophila</td></tr><tr><td>FBS</td><td>Invitrogen</td><td>12657-029</td><td>Cell culture</td></tr><tr><td>flat bottom 96-well-plate</td><td>Sigma</td><td>CLS3922</td><td>Cell culture</td></tr><tr><td>Fluorescence microscope</td><td>Olympus</td><td>DP73</td><td></td></tr><tr><td>Isopropyl alcohol</td><td>Sigma</td><td>I9516</td><td>RNA extraction</td></tr><tr><td>Lysis buffer (RNA extraction)</td><td>Thermo Fisher</td><td>15596026</td><td>TRIzol Reagent</td></tr><tr><td>Lysis buffer (liquid sample RNA extraction)</td><td>Thermo Fisher</td><td>10296028</td><td>TRIzol LS Reagent</td></tr><tr><td>Microscope</td><td>Olympus</td><td>CKX41</td><td></td></tr><tr><td>Nanoject II Auto-Nanoliter Injector</td><td>Drummond Scientific</td><td>3-000-204</td><td>Nanoject II Variable Volume (2.3 to 69 nL) Automatic Injector with Glass Capillaries (110V)</td></tr><tr><td>Optical Adhesive Film</td><td>ABI</td><td>4360954</td><td>qPCR</td></tr><tr><td>Penicillin-Streptomycin, Liquid</td><td>Invitrogen</td><td>15140-122</td><td>Cell culture</td></tr><tr><td>qPCR plate</td><td>ABI</td><td>A32811</td><td>qPCR</td></tr><tr><td>Schneider&amp;rsquo;s Insect Medium</td><td>Sigma</td><td>S9895</td><td>Cell culture</td></tr><tr><td>statistical software</td><td>GraphPad Prism 7</td><td></td><td></td></tr><tr><td>TransScript Fly First-Strand cDNA Synthesis SuperMix</td><td>TransScript</td><td>AT301</td><td>RNA extraction</td></tr><tr><td>Vortex</td><td>IKA</td><td>VORTEX 3</td><td>RNA extraction</td></tr></tbody></table>

establishment of viral infection and analysis of host-virus interaction in drosophila melanogaster

Virus spreading is a major cause of epidemic diseases. Thus, understanding the interaction between the virus and the host is very important to extend our knowledge of prevention and treatment of viral infection. The fruit fly Drosophila melanogaster has proven to be one of the most efficient and productive model organisms to screen for antiviral factors and investigate virus-host interaction, due to powerful genetic tools and highly conserved innate immune signaling pathways. The procedure described here demonstrates a nano-injection method to establish viral infection and induce systemic antiviral responses in adult flies. The precise control of the viral injection dose in this method enables high experimental reproducibility. Protocols described in this study include the preparation of flies and the virus, the injection method, survival rate analysis, the virus load measurement, and an antiviral pathway assessment. The influence effects of viral infection by the flies' background were mentioned here. This infection method is easy to perform and quantitatively repeatable; it can be applied to screen for host/viral factors involved in virus-host interaction and to dissect the crosstalk between innate immune signaling and other biological pathways in response to viral infection.

Results of this section are obtained after DCV infection of D. melanogaster. Figure 1 shows the flow chart of viral infection in Drosophila. Flies are injected intra-thoracically, and then the samples are collected for the measurement of the viral TCID50 and the genome RNA level (Figure 1). Virus infection can induce cell lysis and CPE is observed at 3 days post infection (Figure 2A). The virus load measured by the CPE assay is in line with t...

Watch this Scientific Journal Video about Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster at JoVE.com

Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster

This protocol describes how to establish viral infection in vivo in Drosophila melanogaster using the nano-injection method and basic techniques to analyze virus-host interaction.

Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster

Virus spreading is a major cause of epidemic diseases. Thus, understanding the interaction between the virus and the host is very important to extend our ...

establishment-viral-infection-analysis-host-virus-interaction

Universidad de Cartagena UDEC

Research

JoVE Journal

Immunology and Infection

10.5K Views.  Guangzhou Women and Children's Medical Center. This protocol describes how to establish viral infection in vivo in Drosophila melanogaster using the nano-injection method and basic techniques to analyze virus-host interaction.

Video: Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster

RNAi Screening for Host Factors Involved in Vaccinia Virus Infection using Drosophila Cells

Viral pathogens represent a significant public health threat; not only can viruses cause natural epidemics of human disease, but their potential use in bioterrorism is also a concern. A better understanding of the cellular factors that impact infection would facilitate the development of much-needed therapeutics. Recent advances in RNA interference (RNAi) technology coupled with complete genome sequencing of several organisms has led to the optimization of genome-wide, cell-based loss-of-function screens. Drosophila cells are particularly amenable to genome-scale screens because of the ease and efficiency of RNAi in this system 1. Importantly, a wide variety of viruses can infect Drosophila cells, including a number of mammalian viruses of medical and agricultural importance 2,3,4. Previous RNAi screens in Drosophila have identified host factors that are required for various steps in virus infection including entry, translation and RNA replication 5. Moreover, many of the cellular factors required for viral replication in Drosophila cell culture are also limiting in human cells infected with these viruses 4,6,7,8, 9. Therefore, the identification of host factors co-opted during viral infection presents novel targets for antiviral therapeutics. Here we present a generalized protocol for a high-throughput RNAi screen to identify cellular factors involved in viral infection, using vaccinia virus as an example.

RNAi Screening for Host Factors Involved in Vaccinia Virus Infection using Drosophila Cells

Novel host factors involved in viral infection can be identified through cell-based genome-wide loss of function RNAi screening. A Drosophila cell culture model is particularly amenable to this approach due to the ease and efficiency of RNAi. Here we demonstrate this technique using vaccinia virus as an example.

Viral pathogens represent a significant public health threat; not only can viruses cause natural epidemics of human disease, but their potential use in ...

Rearing the Fruit Fly Drosophila melanogaster Under Axenic and Gnotobiotic Conditions

The influence of microbes on myriad animal traits and behaviors has been increasingly recognized in recent years. The fruit fly Drosophila melanogaster is a model for understanding microbial interactions with animal hosts, facilitated by approaches to rear large sample sizes of Drosophila under microorganism-free (axenic) conditions, or with defined microbial communities (gnotobiotic). This work outlines a method for collection of Drosophila embryos, hypochlorite dechorionation and sterilization, and transfer to sterile diet. Sterilized embryos are transferred to sterile diet in 50 ml centrifuge tubes, and developing larvae and adults remain free of any exogenous microbes until the vials are opened. Alternatively, flies with a defined microbiota can be reared by inoculating sterile diet and embryos with microbial species of interest. We describe the introduction of 4 bacterial species to establish a representative gnotobiotic microbiota in Drosophila. Finally, we describe approaches for confirming bacterial community composition, including testing if axenic Drosophila remain bacteria-free into adulthood.

Rearing the Fruit Fly Drosophila melanogaster Under Axenic and Gnotobiotic Conditions

A method for rearing Drosophila melanogaster under axenic and gnotobiotic conditions is presented. Fly embryos are dechorionated in sodium hypochlorite, transferred aseptically to sterile diet, and reared in closed containers. Inoculating diet and embryos with bacteria leads to gnotobiotic associations, and bacterial presence is confirmed by plating whole-body Drosophila homogenates.

The influence of microbes on myriad animal traits and behaviors has been increasingly recognized in recent years. The fruit fly Drosophila melanogaster is ...

Developmental Biology

Quantitative Measurement of the Immune Response and Sleep in Drosophila

A complex interaction between the immune response and host behavior has been described in a wide range of species. Excess sleep, in particular, is known to occur as a response to infection in mammals 1 and has also recently been described in Drosophila melanogaster2. It is generally accepted that sleep is beneficial to the host during an infection and that it is important for the maintenance of a robust immune system3,4. However, experimental evidence that supports this hypothesis is limited4, and the function of excess sleep during an immune response remains unclear. We have used a multidisciplinary approach to address this complex problem, and have conducted studies in the simple genetic model system, the fruitfly Drosophila melanogaster. We use a standard assay for measuring locomotor behavior and sleep in flies, and demonstrate how this assay is used to measure behavior in flies infected with a pathogenic strain of bacteria. This assay is also useful for monitoring the duration of survival in individual flies during an infection. Additional measures of immune function include the ability of flies to clear an infection and the activation of NF&kappa;B, a key transcription factor that is central to the innate immune response in Drosophila. Both survival outcome and bacterial clearance during infection together are indicators of resistance and tolerance to infection. Resistance refers to the ability of flies to clear an infection, while tolerance is defined as the ability of the host to limit damage from an infection and thereby survive despite high levels of pathogen within the system5. Real-time monitoring of NF&kappa;B activity during infection provides insight into a molecular mechanism of survival during infection. The use of Drosophila in these straightforward assays facilitates the genetic and molecular analyses of sleep and the immune response and how these two complex systems are reciprocally influenced.

Quantitative Measurement of the Immune Response and Sleep in Drosophila

To understand a link between the immune response and behavior, we describe a method to measure locomotor behavior in Drosophila during bacterial infection as well as the ability of flies to mount an immune response by monitoring survival, bacterial load, and real-time activity of a key regulator of innate immunity, NF&kappa;B.

A complex interaction between the immune response and  host behavior has been described in a wide range of species. Excess sleep, in  particular, is known ...

Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster

The fruit fly Drosophila melanogaster is one of the premier model organisms for studying the function and evolution of immune defense. Many aspects of innate immunity are conserved between insects and mammals, and since Drosophila can readily be genetically and experimentally manipulated, they are powerful for studying immune system function and the physiological consequences of disease. The procedure demonstrated here allows infection of flies by introduction of bacteria directly into the body cavity, bypassing epithelial barriers and more passive forms of defense and allowing focus on systemic infection. The procedure includes protocols for the measuring rates of host mortality, systemic pathogen load, and degree of induction of the host immune system. This infection procedure is inexpensive, robust and quantitatively repeatable, and can be used in studies of functional genetics, evolutionary life history, and physiology.

Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster

Drosophila melanogaster is an outstanding model organism for studying innate immune systems and the physiological consequences of infection and disease. This protocol describes how to deliver robust and quantitatively repeatable bacterial infections to D. melanogaster, and how to subsequently measure infection severity and quantify the host immune response.

The fruit fly Drosophila melanogaster is one of the premier model organisms for studying the function and evolution of immune defense. Many aspects of ...

Straightforward Assay for Quantification of Social Avoidance in Drosophila melanogaster

Drosophila melanogaster is an emerging model to study different aspects of social interactions. For example, flies avoid areas previously occupied by stressed conspecifics due to an odorant released during stress known as the Drosophila stress odorant (dSO). Through the use of the T-maze apparatus, one can quantify the avoidance of the dSO by responder flies in a very affordable and robust assay. Conditions necessary to obtain a strong performance are presented here. A stressful experience is necessary for the flies to emit dSO, as well as enough emitter flies to cause a robust avoidance response to the presence of dSO. Genetic background, but not their group size, strongly altered the avoidance of the dSO by the responder flies. Canton-S and Elwood display a higher performance in avoiding the dSO than Oregon and Samarkand strains. This behavioral assay will allow identification of mechanisms underlying this social behavior, and the assessment of the influence of genes and environmental conditions on both emission and avoidance of the dSO. Such an assay can be included in batteries of simple diagnostic tests used to identify social deficiencies of mutants or environmental conditions of interest.

Straightforward Assay for Quantification of Social Avoidance in Drosophila melanogaster

Here, we present a protocol to quantify the avoidance of stressed individuals. This paradigm is powerful yet user-friendly and can be used to assess the influence of genes and environment on one kind of social interaction in Drosophila melanogaster.

Drosophila melanogaster is an emerging model to study different aspects of social interactions. For example, flies avoid areas previously occupied by ...

Neuroscience

Extraction of Hemocytes from Drosophila melanogaster Larvae for Microbial Infection and Analysis

During the pathogenic infection of Drosophila melanogaster, hemocytes play an important role in the immune response throughout the infection. Thus, the goal of this protocol is to develop a method to visualize the pathogen invasion in a specific immune compartment of flies, namely hemocytes. Using the method presented here, up to 3 &#215; 106 live hemocytes can be obtained from 200 Drosophila 3rd instar larvae in 30 min for ex vivo infection. Alternatively, hemocytes can be infected in vivo through injection of 3rd instar larvae followed by hemocyte extraction up to 24 h post-infection. These infected primary cells were fixed, stained, and imaged using confocal microscopy. Then, 3D representations were generated from the images to definitively show pathogen invasion. Additionally, high-quality RNA for qRT-PCR can be obtained for the detection of pathogen mRNA following infection, and sufficient protein can be extracted from these cells for Western blot analysis. Taken together, we present a method for definite reconciliation of pathogen invasion and confirmation of infection using bacterial and viral pathogen types and an efficient method for hemocyte extraction to obtain enough live hemocytes from Drosophila larvae for ex vivo and in vivo infection experiments.

Extraction of Hemocytes from Drosophila melanogaster Larvae for Microbial Infection and Analysis

This method demonstrates how to visualize pathogen invasion into insect cells with three-dimensional (3D) models. Hemocytes from Drosophila larvae were infected with viral or bacterial pathogens, either ex vivo or in vivo. Infected hemocytes were then fixed and stained for imaging with a confocal microscope and subsequent 3D cellular reconstruction.

During the pathogenic infection of Drosophila melanogaster, hemocytes play an important role in the immune response throughout the infection. Thus, the ...

Assessing the Cellular Immune Response of the Fruit Fly, Drosophila melanogaster, Using an In Vivo Phagocytosis Assay

In all animals, innate immunity provides an immediate and robust defense against a broad spectrum of pathogens. Humoral and cellular immune responses are the main branches of innate immunity, and many of the factors regulating these responses are evolutionarily conserved between invertebrates and mammals. Phagocytosis, the central component of cellular innate immunity, is carried out by specialized blood cells of the immune system. The fruit fly, Drosophila melanogaster, has emerged as a powerful genetic model to investigate the molecular mechanisms and physiological impacts of phagocytosis in whole animals. Here we demonstrate an injection-based in vivo phagocytosis assay to quantify the particle uptake and destruction by Drosophila blood cells, hemocytes. The procedure allows researchers to precisely control the particle concentration and dose, making it possible to obtain highly reproducible results in a short amount of time. The experiment is quantitative, easy to perform, and can be applied to screen for host factors that influence pathogen recognition, uptake, and clearance.

Assessing the Cellular Immune Response of the Fruit Fly, Drosophila melanogaster, Using an In Vivo Phagocytosis Assay

This protocol describes an in vivo phagocytosis assay in adult Drosophila melanogaster to quantify phagocyte recognition and clearance of microbial infections.

In all animals, innate immunity provides an immediate and robust defense against a broad spectrum of pathogens. Humoral and cellular immune responses are ...

Drosophila melanogaster Larva Injection Protocol

The use of unconventional models to study innate immunity and pathogen virulence provides a valuable alternative to mammalian models, which can be costly and raise ethical issues. Unconventional models are notoriously cheap, easy to handle and culture, and do not take much space. They are genetically amenable and possess complete genome sequences, and their use presents no ethical considerations. The fruit fly Drosophila melanogaster, for instance, has provided great insights into a variety of behavior, development, metabolism, and immunity research. More specifically, D. melanogaster adult flies and larvae possess several innate defense reactions that are shared with vertebrate animals. The mechanisms regulating immune responses have been mostly revealed through genetic and molecular studies in the D. melanogaster model. Here a novel larval injection technique is provided, which will further promote investigations of innate immune processes in D. melanogaster larvae and explore the pathogenesis of a wide range of microbial infections.

Drosophila melanogaster Larva Injection Protocol

Drosophila melanogaster adult flies have been extensively utilized as model organisms to investigate the molecular mechanisms underlying host antimicrobial innate immune responses and microbial infection strategies. To promote the D. melanogaster larva stage as an additional or alternative model system, a larval injection technique is described.

The use of unconventional models to study innate immunity and pathogen virulence provides a valuable alternative to mammalian models, which can be costly ...

Oral Bacterial Infection and Shedding in Drosophila melanogaster

The fruit fly Drosophila melanogaster is one of the best developed model systems of infection and innate immunity. While most work has focused on systemic infections, there has been a recent increase of interest in the mechanisms of gut immunocompetence to pathogens, which require methods to orally infect flies. Here we present a protocol to orally expose individual flies to an opportunistic bacterial pathogen (Pseudomonas aeruginosa) and a natural bacterial pathogen of D. melanogaster (Pseudomonas entomophila). The goal of this protocol is to provide a robust method to expose male and female flies to these pathogens. We provide representative results showing survival phenotypes, microbe loads, and bacterial shedding, which is relevant for the study of heterogeneity in pathogen transmission. Finally, we confirm that Dcy mutants (lacking the protective peritrophic matrix in the gut epithelium) and Relish mutants (lacking a functional immune deficiency (IMD) pathway), show increased susceptibility to bacterial oral infection. This protocol, therefore, describes a robust method to infect flies using the oral route of infection, which can be extended to the study of a variety genetic and environmental sources of variation in gut infection outcomes and bacterial transmission.

Oral Bacterial Infection and Shedding in Drosophila melanogaster

This protocol describes methods to orally expose and infect the fruit fly Drosophila melanogaster with bacterial pathogens, and to measure the number of infectious bacteria shed following gut infection. We further describe the effect of immune mutants on fly survival following oral bacterial infection.

The fruit fly Drosophila melanogaster is one of the best developed model systems of infection and innate immunity. While most work has focused on systemic ...

Biology

Intrathoracic Viral Nano-Injection to Study Host-Virus Interactions in Adult Flies

Source: Yang, S., et al. <a href="https://appjove.unicartagenaproxy.elogim.com/v/58845">Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster.</a> J. Vis. Exp. (2019).
In this video, we describe a procedure to perform a nano-injection of a positive-sense, single-stranded RNA virus into adult male Drosophila flies and subsequently study the antiviral responses initiated due to the infection. Polymerase chain reaction analysis identifies the upregulation of specific genes in the infected flies that indicate the activation of immune response pathways including RNA interference and JAK/STAT signaling.

Source: Yang, S., et al. Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster. J. Vis. Exp. (2019).
In this ...

Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster

Summary

Explore More Videos

Chapters in this video

RNAi Screening for Host Factors Involved in Vaccinia Virus Infection using Drosophila Cells

Rearing the Fruit Fly Drosophila melanogaster Under Axenic and Gnotobiotic Conditions

Quantitative Measurement of the Immune Response and Sleep in Drosophila

Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster

Straightforward Assay for Quantification of Social Avoidance in Drosophila melanogaster

Extraction of Hemocytes from Drosophila melanogaster Larvae for Microbial Infection and Analysis

Assessing the Cellular Immune Response of the Fruit Fly, Drosophila melanogaster, Using an In Vivo Phagocytosis Assay

Drosophila melanogaster Larva Injection Protocol

Oral Bacterial Infection and Shedding in Drosophila melanogaster

Intrathoracic Viral Nano-Injection to Study Host-Virus Interactions in Adult Flies