We thank members of the Wan lab and the Nagarajan lab for informative discussions. N.Nagarajan is supported by funding from A*STAR. Y.Wan is supported by funding from A*STAR and Society in Science-Branco Weiss Fellowship.

1. Treatment of HeLa Cells with Biotinylated Psoralen and RNA Extraction
<ol>
	<li>Culture HeLa cells in Dulbecco&#39;s modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin streptomycin (PS) in a 10 cm plate.</li>
	<li>Wash the HeLa cells twice with 5 mL of 1x PBS. Drain excess PBS completely from the dish by placing the dish vertically for 1 min.</li>
	<li>Add 1 mL of PBS containing 200 &#181;M of biotinylated psoralen and 0.01% w/v digitonin, to the cells uniformly and incubate at 37 &#176;C for 5 min. While biotinylated psoralen can enter the cell, its permeability is much higher when the cells are exposed to low amounts of digitonin (0.01%) for 5 min</li>
	<li>Remove the lid of the 10 cm plate containing the treated HeLa cells and place the dish flat on ice. Irradiate the dish containing the cells with 365 nm UV for 20 min on ice, at a distance of 3 cm from the UV bulbs, using the UV crosslinker.</li>
	<li>Isolate total RNA from HeLa cells by guanidinium thiocyanate-phenol-chloroform extraction following the manufacturer&#39;s protocol. Add 1:1 volume of isopropanol to precipitate the RNA at room temperature for 30 min. 
	Pause Point: RNA can be stored at -20 &#176;C in isopropanol indefinitely. A dot blot can be performed at this step to check that biotinylated psoralen has successfully entered the cells and has crosslinked RNAs in vivo (Figure 2).</li>
	<li>Centrifuge the precipitated RNA at 20,000 x g for 30 min at 4 &#176;C to recover the RNA. Remove the supernatant and add 1 mL of 70% cold ethanol to the RNA pellet to wash the RNA.</li>
	<li>Centrifuge the samples at 20,000 x g for 15 min at 4 &#176;C. Remove the supernatant and air dry the pellet for 5 min at room temperature.</li>
	<li>Add nuclease free water to the RNA pellet and quantify the concentration of RNA using UV spectrometer. 
	Pause Point: RNA can be stored at -80 &#176;C after flash freezing in liquid nitrogen.</li>
</ol>
2. RNA Fragmentation
<ol>
	<li>Preheat 15 &#181;L of 2x RNA fragmentation buffer and 10 &#181;L of the RNA sample (1 &#181;g/&#181;L) individually in 0.2 mL PCR tubes, at 95 &#176;C for 1 min. Mix 10 &#181;L of the heated 2x RNA fragmentation buffer with 10 &#181;L RNA sample by pipetting up and down. Incubate the sample at 95 &#176;C for 5 min. Stop the reaction by snap cooling the reaction on ice.</li>
	<li>Transfer and pool the 2 fragmentation reactions to a 1.5 mL microfuge tube. Add 40 &#181;L of nuclease free water to the reaction, 10 &#181;L of 3 M sodium acetate, 1 &#181;L of glycogen and 300 &#181;L of 100% ethanol to the fragmentation reaction. Incubate the RNA at -20 &#176;C for at least 1 h to precipitate the RNA.</li>
	<li>Centrifuge the precipitated RNA at 20,000 x g for 30 min, remove the supernatant and wash the RNA using 1 mL of 70% ethanol.</li>
	<li>Centrifuge the RNA at 20,000 x g for 15 min, remove the supernatant and dissolve the RNA in 20 &#181;L of nuclease free water.</li>
</ol>
3. RNA Size Selection and Elution
<ol>
	<li>Add 20 &#181;L of RNA loading dye to the recovered RNA in the microfuge tube. Heat the RNA with the RNA loading dye at 95 &#176;C for 3 min and place it on ice for 2 min.</li>
	<li>Add 3 &#181;L of RNA loading dye to 0.25 &#181;L of 10 nt DNA ladder in a microfuge tube. Heat the ladder at 95 &#176;C for 3 min and place it on ice for 2 min.</li>
	<li>Load the denatured ladder and samples onto an 8.6 cm x 6.8 cm 6% TBE urea gel and size fractionate by electrophoresis for 40 min at 180 V. Stain the gel in 10 mL of TBE buffer containing 1:10,000 of nucleic acid gel stain for 5 min in the dark.</li>
	<li>Puncture a clean 0.6 mL microfuge tube at the bottom using a 24 G needle and place it in a 2 mL microfuge tube.</li>
	<li>Visualize the bands on the post-stained gel using a transilluminator and cut a gel slice corresponding to 90-110 nt. Transfer the gel slice into the punctured 0.6 mL microfuge tube in the 2 mL microfuge tube. This size selection is performed to allow the chimeric fragments to have a minimum length to map to the transcriptome and to distinguish between proximity ligated products versus unligated products in downstream size selection steps.</li>
	<li>Centrifuge the gel slices at 12,000 x g at room temperature for 2 min to shred the gel slice and collect it in the 2 mL microfuge tube. Discard the empty 0.6 mL microfuge tube. Add 700 &#181;L of elution buffer to the shredded gel slice in the 2 mL microfuge tube and incubate at 4 &#176;C overnight with constant rotation, to allow diffusion of the samples into the buffer.</li>
	<li>Transfer the gel slices and the elution buffer to a centrifuge tube filter and centrifuge at 20,000 x g for 2 min. The gel slices will be trapped at the top compartment of the filter. Discard the gel slices and the top compartment.</li>
	<li>Add 1 &#181;L of glycogen and 700 &#181;L of 100% isopropanol to the filtrate in the microfuge tube and precipitate the RNA at -20 &#176;C for at least 1 h or overnight. 
	Pause Point: RNA can be precipitated in isopropanol indefinitely at -20 &#176;C.</li>
	<li>Centrifuge the precipitated RNA at 20,000 x g for 30 min at 4 &#176;C to recover the RNA. Remove the supernatant and add 1 mL of 70% cold ethanol to wash the RNA pellet. Centrifuge the washed pellet at 20,000 x g for 15 min at 4 &#176;C.</li>
	<li>Remove the wash buffer and add 20 &#181;L of nuclease free water to resuspend the RNA. Quantitate the concentration of RNA using an UV spectrometer. 
	Pause Point: RNA can be stored at -80 &#176;C after flash freezing in liquid nitrogen.</li>
</ol>
4. Enrichment of RNA Crosslinking Regions
<ol>
	<li>Vortex streptavidin coated magnetic beads vigorously to resuspend the beads homogenously in the tube. Transfer 100 &#181;L of beads to a 1.5 mL microfuge tube and place it on a magnetic stand for 1 min to allow the beads to stick to the magnetic side of the tube. Remove the storage buffer from the beads carefully and take the tube out of the magnet stand.</li>
	<li>Add 1 mL Lysis Buffer to the beads in the microfuge tube and pipette up and down. Place the microfuge containing beads on the magnetic stand for 1 min to separate the beads from the wash buffer. Repeat this for a total of 3 washes.</li>
	<li>Remove the wash buffer from the beads by placing the microfuge containing beads on the magnetic stand for 1 min. Add RNase inhibitor (1:200) to the lysis buffer and add 100 &#181;L of lysis buffer to the washed beads in the microfuge tube.</li>
	<li>Add 2 mL of freshly prepared Hybridization Buffer, 1 mL of supplemented lysis buffer, 1.5 &#181;g of size fractionated RNA and 100 &#181;L of resuspended beads to a 15 mL conical centrifuge tube. Vortex the tube gently.</li>
	<li>Incubate the 15 mL conical centrifuge tube at 37 &#176;C for 30 min with end to end rotation. Pre-warm the wash buffer at 37 &#176;C.</li>
	<li>Place the 15 mL conical centrifuge tubes on a magnetic stand for 15 mL tubes for 2 min to separate the beads from the buffer. Pipette the buffer carefully out of the tube and discard it.</li>
	<li>Add 1 mL of pre-warmed wash buffer to the beads, pipette up and down and transfer the beads to a 1.5 mL microfuge tube. Incubate at the beads at 37 &#176;C for 5 min, with end to end rotation.</li>
	<li>Briefly centrifuge down the contents of the microfuge tube. Place the 1.5 mL washed beads in microfuge tubes on a magnetic stand for 2 mL tubes for 1 min, to separate the beads from the wash buffer. Remove the buffer from the beads by gently pipetting the buffer out of the microfuge tube.</li>
	<li>Add 1 mL of pre-warmed wash buffer to the beads and pipette up and down to repeat the wash. Perform a total of 5 washes. At the end of the 5th wash, remove the wash buffer by placing the microfuge containing beads on the magnet stand for 1 min.</li>
</ol>
5. Proximity Ligation
<ol>
	<li>Add 1 mL of cold T4 polynucleotide kinase (PNK) buffer to the washed beads and incubate the beads for 5 min at 4 &#176;C, with end to end rotation. Place the microfuge tube containing the beads on the magnetic strip for 1 min and gently remove the T4 PNK buffer. Repeat this step for a total of 2 washes and remove the T4 PNK buffer after the last wash.</li>
	<li>Add buffers to the beads, according to Table 1. To enable the 3&#39; ends of the RNA fragment to be ligated to 3&#39; adapters below, incubate the beads in the buffer at 37 &#176;C for 4 h with constant agitation to convert the 3&#39; cyclic phosphate group at the end of the RNA to 3&#39; OH.</li>
	<li>Add buffers to the previous reaction, according to Table 2. To enable the 5&#39; end of the RNA fragments to be ligation competent, incubate the reaction at 37 &#176;C for 1 h with constant agitation in the presence of ATP, to convert 5&#39; OH on the RNA to 5&#39; phosphate.</li>
	<li>Add buffer to the previous reaction to perform proximity ligation, according to Table 3. Incubate the reaction at 16 &#176;C for 16 h, with constant agitation,</li>
	<li>Place the microfuge containing the ligated RNA onto a magnet stand for 1 min. Remove the supernatant carefully and add 1 mL of room temperature wash buffer to the beads. Resuspend by pipetting up and down.</li>
	<li>Place the microfuge tube onto the magnet stand for 1 min and remove the wash buffer carefully. Perform a total of 2 washes, and remove the wash buffer from the beads at the end of the second wash.</li>
	<li>Add 100 &#181;L of RNA PK Buffer to the beads and resuspend by pipetting up and down. Heat the samples at 95 &#176;C for 10 min on a heat block.</li>
	<li>Chill the sample on ice for 1 min and add 500 &#181;L of guanidinium thiocyanate-phenol-chloroform to the sample. Mix by vortexing vigorously for 10 s. Incubate the mixture at room temperature for 10 min. 
	Pause Point: RNA can be stored in guanidinium thiocyanate-phenol-chloroform at -80 &#176;C for a couple of months.</li>
	<li>Add 100 &#181;L of chloroform to the guanidinium thiocyanate-phenol-chloroform extracted samples. Vortex vigorously for 10 s. Centrifuge the samples at 20,000 x g for 15 min at 4 &#176;C.</li>
	<li>Transfer 400 &#181;L of the aqueous layer to a new 1.5 mL microfuge tube. Add 800 &#181;L (2 volumes) of 100% ethanol and mix by pipetting up and down.</li>
	<li>Transfer the RNA solution to RNA cleanup columns and recover the RNA following manufacturer&#39;s instructions, ensuring that even small RNAs are retained. Elute the RNA in 100 &#181;L of nuclease-free water. 
	Pause Point: RNA can be stored at -80 &#176;C after flash freezing in liquid nitrogen.</li>
</ol>
6. Reverse Crosslinking of Biotinylated Psoralen
<ol>
	<li>Transfer the 100 &#181;L of the eluted samples into a well of a 24 well plate. Remove the cover and irradiate the sample under UV 254 nm,&#160;for 5 min on ice.</li>
	<li>Transfer the reverse crosslinked sample to a clean microfuge tube. Add 10 &#181;L of sodium acetate, 1 &#181;L of glycogen and 300 &#181;L of 100% ethanol and precipitate the RNA at -20 &#176;C for at least 1 h or overnight. 
	Pause Point: RNA can be precipitated in ethanol indefinitely at -20 &#176;C.</li>
	<li>Centrifuge the precipitated RNA at 20,000 x g for 30 min at 4 &#176;C to recover the RNA. Remove the supernatant and add 1 mL of 70% cold ethanol to wash the RNA pellet.</li>
	<li>Centrifuge the washed pellet at 20,000 x g for 15 min at 4 &#176;C. Remove the wash buffer and add 4.25 &#181;L of nuclease free water to resuspend the RNA. Transfer the RNA to a 0.2 mL PCR tube. 
	Pause Point: RNA can be stored at -80 &#176;C after flash freezing in liquid nitrogen.</li>
</ol>
7. Reverse Transcription and cDNA Circularization
<ol>
	<li>Add 0.75 &#181;L of RNA linker (0.5 &#181;g/&#181;L) to the resuspended sample in PCR tube and heat at 80 &#176;C for 90 s. Place the sample on ice for 2 min.</li>
	<li>Add the buffers to the denatured sample for 3&#39; adapter ligation, according to Table 4. Incubate the reaction at 25 &#176;C for 2.5 h.</li>
	<li>Transfer the reaction to a 1.5 mL microfuge tube. Add 90 &#181;L of nuclease free water to the reaction, followed by 10 &#181;L of sodium acetate, 1 &#181;L of glycogen and 300 &#181;L of 100% ethanol. Precipitate the RNA at -20 &#176;C for at least 1 h or overnight. 
	Pause Point: RNA can be precipitated in ethanol indefinitely at -20 &#176;C.</li>
	<li>Centrifuge the precipitated RNA at 20,000 x g for 30 min at 4 &#176;C to recover the RNA. Remove the supernatant and add 1 mL of 70% cold ethanol to wash the RNA pellet.</li>
	<li>Centrifuge the washed pellet at 20,000 g for 15 min at 4 &#176;C. Remove the wash buffer resuspend the pellet in 5 &#181;L of nuclease free water.</li>
	<li>Add 5 &#181;L of RNA loading dye to the recovered RNA in the microfuge tube. Heat the RNA with the RNA loading dye at 95 &#176;C for 3 min and place it on ice for 2 min.</li>
	<li>Add 3 &#181;L of RNA loading dye to 0.25 &#181;L of 10 nt DNA ladder in a microfuge tube. Heat the ladder at 95 &#176;C for 3 min and place it on ice for 2 min.</li>
	<li>Perform size fractionation using 8.6 cm x 6.8 cm 6% TBE urea gel as in steps 3.3 and 3.4.</li>
	<li>Visualize the gel stained with nucleic acid stain using the transilluminator and cut a gel slice corresponding to 110-140 nt on the ladder. Transfer the gel slice into the punctured 0.6 mL microfuge tube in the 2 mL microfuge tube and follow the protocol from steps 3.6- 3.9.</li>
	<li>Add 5 &#181;L of nuclease free water to resuspend the RNA pellet. Transfer the RNA to a 0.2 mL PCR tube. 
	Pause Point: RNA can be stored at -80 &#176;C after flash freezing in liquid nitrogen.</li>
	<li>Add 1 &#181;L of RT primer at 1.25 &#181;M to the RNA in PCR tube and heat at 80 &#176;C for 2 min. Place the sample on ice for 2 min.</li>
	<li>Add the buffers for reverse transcription according to Table 5. Incubate the reaction at 50 &#176;C for 30 min.</li>
	<li>Add 1.1 &#181;L of 1 N NaOH to the reaction and heat at 98 &#176;C for 20 min. Place the reaction on ice.</li>
	<li>Transfer the reaction to a 1.5 mL microfuge tube. Add 90 &#181;L of nuclease free water to the reaction, followed by 10 &#181;L of sodium acetate, 1 &#181;L of glycogen and 300 &#181;L of 100% ethanol. Precipitate the DNA at -20 &#176;C for at least 1 h or overnight. 
	Pause Point: DNA can be precipitated in ethanol indefinitely at -20 &#176;C.</li>
	<li>Centrifuge the precipitated DNA at 20,000 g for 30 min at 4 &#176;C to recover the DNA. Remove the supernatant and add 1 mL of 70% cold ethanol to wash the DNA pellet. Centrifuge the washed pellet at 20,000 x g for 15 min at 4 &#176;C. Remove the wash buffer resuspend the pellet in 5 &#181;L of nuclease free water.</li>
	<li>Perform size fractionation using 8.6 cm x 6.8 cm 6% TBE urea gel as in steps 3.3 and 3.4.</li>
	<li>Visualize the post-stained gel using the transilluminator and cut a gel slice corresponding to 200-240&#160;nt on the ladder. The reverse transcribed cDNA is now 96 bases longer than the RNA fragment due to the addition of the 96 base RT primer. Transfer the gel slice into the punctured 0.6 mL microfuge tube in the 2 mL microfuge tube.</li>
	<li>Centrifuge the gel slices at 12,000 x g at room temperature for 2 min to shred the gel slice and collect it in the 2 mL microfuge tube. Discard the empty 0.6 mL microfuge tube.</li>
	<li>Add 700 &#181;L of elution buffer to the shredded gel slice in the 2 mL microfuge tube and incubate at 37 &#176;C for 2 h with constant rotation. Follow the protocol as described in steps 3.7- 3.8.</li>
	<li>Add 6 &#181;L of nuclease free water to resuspend the DNA pellet. Transfer the DNA to a 0.2 mL PCR tube. 
	Pause Point: DNA can be stored at -80 &#176;C after flash freezing in liquid nitrogen.</li>
	<li>Add the buffers to the reaction for cDNA circularization, according to Table 6. Incubate the reaction at 60 &#176;C for 1 h and heat at 80 &#176;C for 10 min to inactivate the reaction.</li>
	<li>Transfer the reaction to a 1.5 mL microfuge tube. Purify the circularized cDNA using a DNA cleanup column following the manufacturer&#39;s instructions. Add 20 &#181;L of nuclease free water to the column to elute the purified cDNA. 
	Pause Point: DNA can be stored at -20 &#176;C for a couple of months.</li>
</ol>
8. PCR Amplification (Small Scale PCR)
<ol>
	<li>Add the buffers to the reaction according to Table 7 for PCR amplification to test the minimal number of cycles need for library amplification.</li>
	<li>Set up the PCR cycling conditions according to Table 8. Pause the reaction and transfer 5 &#181;L of the PCR reaction at 10, 15 and 20 cycles, into separate 1.5 mL microfuge tubes.</li>
	<li>Add 1 &#181;L of 6x DNA gel loading dye to each of the 5 &#181;L PCR reaction at the different cycles. Perform gel electrophoresis on a 3% agarose gel, at 120 V, for 1 h to visualize the PCR products.
	<ol>
		<li>Use the lowest number of PCR cycles (Y) that show amplification at around 250 bases (In Figure 3, there is a strong band at 15 cycles of amplification and a faint band at 10 cycles. 12 cycles of large scale PCR amplification is likely to generate enough material for deep sequencing as the amount of cDNA used is 10 times that of small scale PCR amplification).</li>
	</ol>
	</li>
</ol>
9. PCR Amplification (Large Scale PCR) and Purification
<ol>
	<li>Add the buffers to the reaction according to Table 9 for PCR amplification for large scale PCR.</li>
	<li>Set up the PCR cycling conditions according to Table 10.</li>
	<li>Add 5 &#181;L of 6x DNA gel loading dye to the 25 &#181;L of PCR reaction and load into a well of a 3% agarose gel. Load 1 kb plus DNA ladder into a separate well. Perform gel electrophoresis at 100 V, for 1.5 h.</li>
	<li>Visualize the completed gel using a UV Transilluminator.</li>
	<li>Size extract a gel slice containing PCR products from 200- 300 bases and transfer the gel to a clean 2 mL microfuge tube.</li>
	<li>Add 1 mL of gel solubility buffer, from a DNA gel extraction kit, to the gel slice and incubate at room temperature for 30 min, or until the gel dissolves, with constant agitation.</li>
	<li>Add 200 &#181;L of isopropanol to the dissolved gel and mix well by pipetting. Transfer 700 &#181;L of the sample to a DNA gel extraction cleanup column and centrifuge at 13,000 x g for 30 s. Keep transferring the dissolved sample to the column until all of the sample has been loaded onto the column.</li>
	<li>Add 500 &#181;L gel solubility buffer, followed by 700 &#181;L of column wash buffer, to the column, according to the manufacturer&#39;s protocol. Add 12 &#181;L of nuclease-free water to the center of the column to elude the DNA. Pause Point: DNA can be stored at -20 &#176;C.</li>
	<li>Quantitate the concentration of the DNA using fluorometric quantification. If multiple libraries are constructed and pooled together for sequencing, add equal amount of each sample to the pool, for high throughput sequencing.</li>
</ol>

<ol>
	<li>Wan, Y., Kertesz, M., Spitale, R. C., Segal, E., Chang, H. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Understanding+the+transcriptome+through+RNA+structure.">Understanding the transcriptome through RNA structure.</a> Nat.Rev.Genet. 12 (9), 641-655 (2011).</li><li>Kertesz, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+measurement+of+RNA+secondary+structure+in+yeast.">Genome-wide measurement of RNA secondary structure in yeast.</a> Nature. 467 (7311), 103-107 (2010).</li><li>Wan, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+Measurement+of+RNA+Folding+Energies.">Genome-wide Measurement of RNA Folding Energies.</a> Mol.Cell. 48 (2), 169-181 (2012).</li><li>Wan, Y., Qu, K., Ouyang, Z., Chang, H. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+mapping+of+RNA+structure+using+nuclease+digestion+and+high-throughput+sequencing.">Genome-wide mapping of RNA structure using nuclease digestion and high-throughput sequencing.</a> Nat.Protoc. 8 (5), 849-869 (2013).</li><li>Wan, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Landscape+and+variation+of+RNA+secondary+structure+across+the+human+transcriptome.">Landscape and variation of RNA secondary structure across the human transcriptome.</a> Nature. 505 (7485), 706-709 (2014).</li><li>Spitale, R. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+imprints+in+vivo+decode+RNA+regulatory+mechanisms.">Structural imprints in vivo decode RNA regulatory mechanisms.</a> Nature. 519 (7544), 486-490 (2015).</li><li>Ding, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+genome-wide+profiling+of+RNA+secondary+structure+reveals+novel+regulatory+features.">In vivo genome-wide profiling of RNA secondary structure reveals novel regulatory features.</a> Nature. 505 (7485), 696-700 (2014).</li><li>Rouskin, S., Zubradt, M., Washietl, S., Kellis, M., Weissman, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+probing+of+RNA+structure+reveals+active+unfolding+of+mRNA+structures+in+vivo.">Genome-wide probing of RNA structure reveals active unfolding of mRNA structures in vivo.</a> Nature. 505 (7485), 701-705 (2014).</li><li>Kudla, G., Granneman, S., Hahn, D., Beggs, J. D., Tollervey, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cross-linking,+ligation,+and+sequencing+of+hybrids+reveals+RNA-RNA+interactions+in+yeast.">Cross-linking, ligation, and sequencing of hybrids reveals RNA-RNA interactions in yeast.</a> Proc.Natl.Acad.Sci.U.S.A. 108 (24), 10010-10015 (2011).</li><li>Sugimoto, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=hiCLIP+reveals+the+in+vivo+atlas+of+mRNA+secondary+structures+recognized+by+Staufen+1.">hiCLIP reveals the in vivo atlas of mRNA secondary structures recognized by Staufen 1.</a> Nature. 519 (7544), 491-494 (2015).</li><li>Engreitz, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-RNA+interactions+enable+specific+targeting+of+noncoding+RNAs+to+nascent+Pre-mRNAs+and+chromatin+sites.">RNA-RNA interactions enable specific targeting of noncoding RNAs to nascent Pre-mRNAs and chromatin sites.</a> Cell. 159 (1), 188-199 (2014).</li><li>Ramani, V., Qiu, R., Shendure, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+determination+of+RNA+structure+by+proximity+ligation.">High-throughput determination of RNA structure by proximity ligation.</a> Nat.Biotechnol. , (2015).</li><li>Lu, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+Duplex+Map+in+Living+Cells+Reveals+Higher-Order+Transcriptome+Structure.">RNA Duplex Map in Living Cells Reveals Higher-Order Transcriptome Structure.</a> Cell. 165 (5), 1267-1279 (2016).</li><li>Sharma, E., Sterne-Weiler, T., O'Hanlon, D., Blencowe, B. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+Mapping+of+Human+RNA-RNA+Interactions.">Global Mapping of Human RNA-RNA Interactions.</a> Mol.Cell. 62 (4), 618-626 (2016).</li><li>Aw, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+Vivo+Mapping+of+Eukaryotic+RNA+Interactomes+Reveals+Principles+of+Higher-Order+Organization+and+Regulation.">In Vivo Mapping of Eukaryotic RNA Interactomes Reveals Principles of Higher-Order Organization and Regulation.</a> Mol.Cell. 62 (4), 603-617 (2016).</li></ol>

The authors do not have competing financial interests.

Here, we describe in detail the experimental and computational workflow for SPLASH, a method that allows us to identify pair-wise RNA interactions in a genome-wide manner. We have successfully utilized SPLASH in bacterial, yeast and human cultures and anticipate that the strategy can be widely applied to diverse organisms under different cellular states. One of the critical steps in the protocol is to start with at least 20 &#181;g of crosslinked RNA to have adequate material for downstream processes. The RNA is then fra...

Studying how macromolecules fold and interact with each other is the key to understanding gene regulation in the cell. While much effort has been focused in the past decade on understanding how DNA and proteins contribute to gene regulation, relatively less is known about post-transcriptional regulation of gene expression. RNA carries information in both its linear sequence and in its secondary and tertiary structure1. Its ability to base pair with itself and with others is important for its function in vivo. Recent advances in high throughput RNA secondary structure probing has provided valuable insights into the locations of double and single stranded regions in the transcriptome2,3,4,5,6,7,8, however information on the pairing interaction partners is still largely missing. To determine which RNA sequence is interacting with another RNA region in the transcriptome, we need global pair-wise information.
Mapping pair-wise RNA interactions in a global, unbiased manner has traditionally been a major challenge. While previous approaches, such as CLASH9, hiCLIP10 and RAP11, are used to identify RNA interactions in a large scale manner, these techniques typically map RNA base pairing for a subset of RNAs that either interact with a particular protein or RNA species. Recent developments in studying global RNA interactions include the method RPL12, which does not stabilize RNA interactions in vivo and hence may only capture a subset of in vivo interactions. To overcome these challenges, we and others developed genome-wide, unbiased strategies to map RNA interactomes in vivo, using modified versions of the crosslinker psoralen13,14,15. In this protocol, we describe the details for performing Sequencing of Psoralen crosslinked, Ligated, and Selected Hybrids (SPLASH), which utilizes biotinylated psoralen to crosslink base pairing RNAs in vivo, followed by proximity ligation and high throughput sequencing to identify RNA base-pairing partners genome-wide (Figure 1)15.
In this manuscript, we describe the steps to perform SPLASH using cultured adherent cells, in this case HeLa cells. The same protocol can be easily adapted to suspension mammalian cells and to yeast and bacteria cells. Briefly, HeLa cells are treated with biotinylated psoralen and irradiated at 365 nm to crosslink interacting RNA base pairs in vivo. The RNAs are then extracted from the cells, fragmented and enriched for crosslinking regions using streptavidin beads. Interacting RNA fragments are then ligated together using proximity ligation and made into a cDNA library for deep sequencing. Upon sequencing, the chimeric RNAs are mapped onto the transcriptome/genome to identify the RNA interacting regions that are paired to each other. We have successfully utilized SPLASH to identify thousands of RNA interactions in vivo in yeast and different human cells, including intramolecular and intermolecular RNA base pairing in diverse classes of RNAs, such as snoRNAs, lncRNAs and mRNAs, to glimpse into the structural organization and interaction patterns of RNAs in the cell.

<table border="0" cellpadding="0" cellspacing="0" width="1136">
	<colgroup>
		<col />
		<col span="3" />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:284px;">1 Kb Plus DNA Ladder</td>
			<td style="width:284px;">Life Technologies Holdings Pte Ltd</td>
			<td style="width:284px;">10787026</td>
			<td style="width:284px;">DNA ladder</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">10 bp DNA ladder</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>10821-015</td>
			<td>DNA ladder</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">20 % SDS solution</td>
			<td>First BASE</td>
			<td>BUF-2052-1L&#160;&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">20x SSC</td>
			<td>First BASE</td>
			<td>BUF-3050-20X1L</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">3.0 M Sodium Acetate Solution</td>
			<td>First BASE</td>
			<td>BUF-1151-1L-pH5.2&#160;&#160;</td>
			<td>Required for nucleic acid precipitation</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">40% Acrylamide/Bis Solution, 19:1</td>
			<td>Bio-Rad</td>
			<td>1610145</td>
			<td>TBE Urea gel component</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Ambion Buffer Kit</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>AM9010</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Ammonium Persulfate, Molecular Grade&#160;&#160;</td>
			<td>Promega</td>
			<td>V3131&#160;</td>
			<td>TBE Urea gel component</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Bromophenol Blue</td>
			<td>Sigma-Aldrich</td>
			<td>B0126-25G</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Chloroform</td>
			<td>Merck</td>
			<td>1.02445.1000</td>
			<td>RNA extraction</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Single strand DNA ligase</td>
			<td>Epicentre</td>
			<td>CL9025K</td>
			<td>CircLigase II ssDNA Ligase</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Centrifuge tube filters</td>
			<td>Sigma-Aldrich</td>
			<td>CLS8160-96EA</td>
			<td>Costar Spin-X centrifuge tube filters</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">D5628-1G DIGITONIN CRYSTALLINE</td>
			<td>Sigma-Aldrich</td>
			<td>D5628-1G</td>
			<td>For cell treatment</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Dark Reader Transilluminator&#160;</td>
			<td>Clare Chemical Research</td>
			<td>Dark Reader DR89X Transilluminator</td>
			<td>Blue light transilluminator</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">DNA Gel Loading Dye (6X)</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>R0611</td>
			<td>Required for agarose gel electroporation</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Dulbecco&#39;s Modified Eagle Medium</td>
			<td>Pan BioTech</td>
			<td>P04-03500</td>
			<td>For Hela cell culture</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Streptavidin magnetic beads</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>65002</td>
			<td>Dynabeads MyOne Streptavidin C1&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Magnetic stand for 15ml tubes</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>12301D</td>
			<td>DynaMag-15</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Magnetic stand for 15ml tubes</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>&#160;12321D</td>
			<td>DynaMag-2</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">ThermoMixer</td>
			<td>Eppendorf</td>
			<td>5382 000.015</td>
			<td>Eppendorf ThermoMixer&#160;C</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Biotinylated psoralen</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>29986</td>
			<td>EZ-Link Psoralen-PEG3-Biotin</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">F8T5/BL&#160;</td>
			<td>Hitachi</td>
			<td>F8T5/BL&#160;</td>
			<td>365 nm UV bulb</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Fetal Bovine Serum</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>10270106&#160;&#160;</td>
			<td>Components of Hela medium</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Formamide</td>
			<td>Promega</td>
			<td>H5052&#160;&#160;</td>
			<td>Component in hybridization buffer</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">G8T5</td>
			<td>Sankyo-Denki</td>
			<td>G8T5</td>
			<td>254 nm UV bulb</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Glycogen&#160;</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>10814010</td>
			<td>Required for nucleic acid precipitation</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Nanodrop</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>Nanodrop 2000</td>
			<td>Spectrophotometer for nucleic acidquantification</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Nuclease free water&#160;</td>
			<td>First BASE</td>
			<td>BUF-1180-500ml&#160;&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Penicillin Streptomycin&#160;&#160;</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>15140122&#160;&#160;</td>
			<td>Components of Hela medium</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">High-Fidelity DNA polymerase (2x)</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>F531L&#160;</td>
			<td>Phusion High-Fidelity PCR Master Mix with HF Buffer (2x)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Primers Set 1</td>
			<td>New England Biolabs</td>
			<td>E7335L&#160;</td>
			<td>PCR primers</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">DNA Gel Extraction Kit</td>
			<td>QIAgen</td>
			<td>28106</td>
			<td>QIAquick Gel Extraction Kit</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Fluorometric Quantification kit</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>Q32854</td>
			<td>Qubit dsDNA HS Assay Kit</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RNA clean up kit</td>
			<td>Qiagen</td>
			<td>74106</td>
			<td>RNeasy Mini Kit Silica-membrane column</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Rnase Inhibitor</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>AM2696</td>
			<td>SUPERase In</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Reverse transcriptase</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>18080400</td>
			<td>SuperScript III First-Strand Synthesis SuperMix</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Nucleic Acid Gel Stain</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>S11494</td>
			<td>SYBR GOLD NUCLEIC ACID 500 UL</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">T4 Polynucleotide Kinase</td>
			<td>New England Biolabs</td>
			<td>M0201L</td>
			<td>End repair enzyme</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">T4 RNA Ligase 1</td>
			<td>New England Biolabs</td>
			<td>M0204L</td>
			<td>Enzyme for proximity ligation</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">T4 RNA Ligase 2, truncated KQ</td>
			<td>New England Biolabs</td>
			<td>M0373L</td>
			<td>Enzyme for adaptor ligation</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Temed</td>
			<td>Bio-Rad</td>
			<td>1610801</td>
			<td>TBE Urea gel component</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Guanidinium thiocyanate-phenol-chloroform</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>15596018</td>
			<td>TRIzol&#174; Reagent for RNA extraction</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Urea</td>
			<td>First BASE</td>
			<td>BIO-2070-5kg&#160;&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">UV crosslinker</td>
			<td>Stratagene</td>
			<td>400072</td>
			<td>UV Stratalinker 1800</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">UV Transilluminator</td>
			<td>UVP</td>
			<td>95-0417-01</td>
			<td>For visualizing of bands</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Xylene Cyanol FF</td>
			<td>Sigma-Aldrich</td>
			<td>X4126-10G</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">DNA cleanup it</td>
			<td>Zymo Research&#160;</td>
			<td>D4004</td>
			<td>Zymo DNA concentrator-5&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">List of software required</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FastQC software</td>
			<td>0.11.4</td>
			<td>http://www.bioinformatics.babraham.ac.uk/projects/fastqc/</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SeqPrep software</td>
			<td>1.0.7</td>
			<td>https://github.com/jstjohn/SeqPrep</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BWA software</td>
			<td>0.7.12</td>
			<td>http://bio-bwa.sourceforge.net/</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SAMTOOLS software</td>
			<td>1.2.1</td>
			<td>http://www.htslib.org/</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PULLSEQ software</td>
			<td>1.0.2</td>
			<td>https://github.com/bcthomas/pullseq</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">STAR software</td>
			<td>2.5.0c</td>
			<td>https://github.com/alexdobin/STAR</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">rem_dups.py PYTHON script</td>
			<td>PYTHON 2.7.11</td>
			<td>https://github.com/CSB5/splash/tree/master/src</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">find_chimeras.py PYTHON script</td>
			<td>PYTHON 2.7.11</td>
			<td>https://github.com/CSB5/splash/tree/master/src</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">pickJunctionReads.awk AWK script</td>
			<td>AWK GNU 4.1.2</td>
			<td>https://github.com/CSB5/splash/tree/master/src</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Buffer composition</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Elution buffer:&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.3 M sodium acetate</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Lysis Buffer:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">50 mM Tris-Cl pH 7.0</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">10 mM EDTA</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1% SDS</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Always add Superase-in fresh before use except when washing beads</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Proteinase K Buffer&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">100 mM NaCl</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">10 mM TrisCl pH 7.0</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 mM EDTA</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.5% SDS</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Hybridization Buffer</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">750 mM NaCl</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1% SDS</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">50 mM Tris-Cl pH 7.0</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 mM EDTA</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">15% formamide (store in the dark at 4 &#176;C)</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Always add Superase-in fresh before use</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">2x SSC Wash Buffer</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">2x NaCl and Sodium citrate (SSC) (diluted from 20x SSC Invitrogen stock)</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.5% SDS</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">2X RNA fragmentation buffer</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">18mM MgCl2</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">450mM KCl</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">300mM Tris-CL pH 8.3</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">2x RNA loading Dye:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">95% Formamide</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.02% SDS</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.02% bromophenol blue</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.01% Xylene Cyanol</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1mM EDTA&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">3&#39; RNA adapter sequence</td>
			<td>5rAppCTGTAGGCACCATCAAT/3ddC</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RT primer sequence</td>
			<td>AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC/iSp18/CACTCA/iSp18/TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

mapping rna-rna interactions globally using biotinylated psoralen

Knowing how RNAs interact with themselves and with others is key to understanding RNA based gene regulation in the cell. While examples of RNA-RNA interactions such as microRNA-mRNA interactions have been shown to regulate gene expression, the full extent to which RNA interactions occur in the cell is still unknown. Previous methods to study RNA interactions have primarily focused on subsets of RNAs that are interacting with a particular protein or RNA species. Here, we detail a method named Sequencing of Psoralen crosslinked, Ligated, and Selected Hybrids (SPLASH) that allows genome-wide capture of RNA interactions in vivo in an unbiased manner. SPLASH utilizes in vivo crosslinking, proximity ligation, and high throughput sequencing to identify intramolecular and intermolecular RNA base-pairing partners globally. SPLASH can be applied to different organisms including bacteria, yeast and human cells, as well as diverse cellular conditions to facilitate the understanding of the dynamics of RNA organization under diverse cellular contexts. The entire experimental SPLASH protocol takes about 5 days to complete and the computational workflow takes about 7 days to complete.

Figure 1 depicts the schematic of the SPLASH workflow. Upon the addition of biotinylated psoralen in the presence of 0.01% digitonin, and UV crosslinking, total RNA is extracted from the cells and a dot blot is performed to ensure that crosslinking of biotinylated to the RNA has happened efficiently (Figure 2). We use biotinylated 20 base oligos as positive controls to titrate the amount of biotinylated psoralen to be added to th...

Watch this Scientific Journal Video about Mapping RNA-RNA Interactions Globally Using Biotinylated Psoralen at JoVE.com

Mapping RNA-RNA Interactions Globally Using Biotinylated Psoralen

Here, we detail the method of Sequencing of Psoralen crosslinked, Ligated, and Selected Hybrids (SPLASH), which enables genome-wide mapping of intramolecular and intermolecular RNA-RNA interactions in vivo. SPLASH can be applied to study RNA interactomes of organisms including yeast, bacteria and humans.

Knowing how RNAs interact with themselves and with others is key to understanding RNA based gene regulation in the cell. While examples of RNA-RNA ...

mapping-rna-rna-interactions-globally-using-biotinylated-psoralen

Universidad de Cartagena UDEC

Research

JoVE Journal

Genetics

11.9K Views.  A*STAR. Here, we detail the method of Sequencing of Psoralen crosslinked, Ligated, and Selected Hybrids (SPLASH), which enables genome-wide mapping of intramolecular and intermolecular RNA-RNA interactions in vivo. SPLASH can be applied to study RNA interactomes of organisms including yeast, bacteria and humans.

Video: Mapping RNA-RNA Interactions Globally Using Biotinylated Psoralen

Conjugative Mating Assays for Sequence-specific Analysis of Transfer Proteins Involved in Bacterial Conjugation

The transfer of genetic material by bacterial conjugation is a process that takes place via complexes formed by specific transfer proteins. In Escherichia coli, these transfer proteins make up a DNA transfer machinery known as the mating pair formation, or DNA transfer complex, which facilitates conjugative plasmid transfer. The objective of this paper is to provide a method that can be used to determine the role of a specific transfer protein that is involved in conjugation using a series of deletions and/or point mutations in combination with mating assays. The target gene is knocked out on the conjugative plasmid and is then provided in trans through the use of a small recovery plasmid harboring the target gene. Mutations affecting the target gene on the recovery plasmid can reveal information about functional aspects of the target protein that result in the alteration of mating efficiency of donor cells harboring the mutated gene. Alterations in mating efficiency provide insight into the role and importance of the particular transfer protein, or a region therein, in facilitating conjugative DNA transfer. Coupling this mating assay with detailed three-dimensional structural studies will provide a comprehensive understanding of the function of the conjugative transfer protein as well as provide a means for identifying and characterizing regions of protein-protein interaction.

Here, we present a protocol to knockout a gene of interest involved in plasmid conjugation and subsequently analyze the impact of its absence using mating assays. The function of the gene is further explored to a specific region of its sequence using deletion or point mutations.

The transfer of genetic material by bacterial conjugation is a process that takes place via complexes formed by specific transfer proteins. In Escherichia ...

QTL Mapping and CRISPR/Cas9 Editing to Identify a Drug Resistance Gene in Toxoplasma gondii

Scientific knowledge is intrinsically linked to available technologies and methods. This article will present two methods that allowed for the identification and verification of a drug resistance gene in the Apicomplexan parasite Toxoplasma gondii, the method of Quantitative Trait Locus (QTL) mapping using a Whole Genome Sequence (WGS) -based genetic map and the method of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas9 -based gene editing. The approach of QTL mapping allows one to test if there is a correlation between a genomic region(s) and a phenotype. Two datasets are required to run a QTL scan, a genetic map based on the progeny of a recombinant cross and a quantifiable phenotype assessed in each of the progeny of that cross. These datasets are then formatted to be compatible with R/qtl software that generates a QTL scan to identify significant loci correlated with the phenotype. Although this can greatly narrow the search window of possible candidates, QTLs span regions containing a number of genes from which the causal gene needs to be identified. Having WGS of the progeny was critical to identify the causal drug resistance mutation at the gene level. Once identified, the candidate mutation can be verified by genetic manipulation of drug sensitive parasites. The most facile and efficient method to genetically modify T. gondii is the CRISPR/Cas9 system. This system comprised of just 2 components both encoded on a single plasmid, a single guide RNA (gRNA) containing a 20 bp sequence complementary to the genomic target and the Cas9 endonuclease that generates a double-strand DNA break (DSB) at the target, repair of which allows for insertion or deletion of sequences around the break site. This article provides detailed protocols to use CRISPR/Cas9 based genome editing tools to verify the gene responsible for sinefungin resistance and to construct transgenic parasites.

QTL Mapping and CRISPR/Cas9 Editing to Identify a Drug Resistance Gene in Toxoplasma gondii

Details are presented on how QTL mapping with a whole genome sequence based genetic map can be used to identify a drug resistance gene in Toxoplasma gondii and how this can be verified with the CRISPR/Cas9 system that efficiently edits a genomic target, in this case the drug resistance gene.

Scientific knowledge is intrinsically linked to available technologies and methods. This article will present two methods that allowed for the ...

Single Molecule Analysis of Laser Localized Psoralen Adducts

The DNA Damage Response (DDR) has been extensively characterized in studies of double strand breaks (DSBs) induced by laser micro beam irradiation in live cells. The DDR to helix distorting covalent DNA modifications, including interstrand DNA crosslinks (ICLs), is not as well defined. We have studied the DDR stimulated by ICLs, localized by laser photoactivation of immunotagged psoralens, in the nuclei of live cells. In order to address fundamental questions about adduct distribution and replication fork encounters, we combined laser localization with two other technologies. DNA fibers are often used to display the progress of replication forks by immunofluorescence of nucleoside analogues incorporated during short pulses. Immunoquantum dots have been widely employed for single molecule imaging. In the new approach, DNA fibers from cells carrying laser localized ICLs are spread onto microscope slides. The tagged ICLs are displayed with immunoquantum dots and the inter-lesion distances determined. Replication fork collisions with ICLs can be visualized and different encounter patterns identified and quantitated.

Lasers are frequently used in studies of the cellular response to DNA damage. However, they generate lesions whose spacing, frequency, and collisions with replication forks are rarely characterized. Here, we describe an approach that enables the determination of these parameters with laser localized interstrand crosslinks.

The DNA Damage Response (DDR) has been extensively characterized in studies of double strand breaks (DSBs) induced by laser micro beam irradiation in live ...

Genome-wide Mapping of Protein-DNA Interactions with ChEC-seq in Saccharomyces cerevisiae

Genome-wide mapping of protein-DNA interactions is critical for understanding gene regulation, chromatin remodeling, and other chromatin-resident processes. Formaldehyde crosslinking followed by chromatin immunoprecipitation and high-throughput sequencing (X-ChIP-seq) has been used to gain many valuable insights into genome biology. However, X-ChIP-seq has notable limitations linked to crosslinking and sonication. Native ChIP avoids these drawbacks by omitting crosslinking, but often results in poor recovery of chromatin-bound proteins. In addition, all ChIP-based methods are subject to antibody quality considerations. Enzymatic methods for mapping protein-DNA interactions, which involve fusion of a protein of interest to a DNA-modifying enzyme, have also been used to map protein-DNA interactions. We recently combined one such method, chromatin endogenous cleavage (ChEC), with high-throughput sequencing as ChEC-seq. ChEC-seq relies on fusion of a chromatin-associated protein of interest to micrococcal nuclease (MNase) to generate targeted DNA cleavage in the presence of calcium in living cells. ChEC-seq is not based on immunoprecipitation and so circumvents potential concerns with crosslinking, sonication, chromatin solubilization, and antibody quality while providing high resolution mapping with minimal background signal. We envision that ChEC-seq will be a powerful counterpart to ChIP, providing an independent means by which to both validate ChIP-seq findings and discover new insights into genomic regulation.

Genome-wide Mapping of Protein-DNA Interactions with ChEC-seq in Saccharomyces cerevisiae

We describe chromatin endogenous cleavage coupled with high-throughput sequencing (ChEC-seq), a chromatin immunoprecipitation (ChIP)-orthogonal method for mapping protein binding sites genome-wide with micrococcal nuclease (MNase) fusion proteins.

Genome-wide mapping of protein-DNA interactions is critical for understanding gene regulation, chromatin remodeling, and other chromatin-resident ...

Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions

Moloney murine leukemia (MLV) virus-based retroviral vectors integrate predominantly in acetylated enhancers and promoters. For this reason, mLV integration sites can be used as functional markers of active regulatory elements. Here, we present a retroviral scanning tool, which allows the genome-wide identification of cell-specific enhancers and promoters. Briefly, the target cell population is transduced with an mLV-derived vector and genomic DNA is digested with a frequently cutting restriction enzyme. After ligation of genomic fragments with a compatible DNA linker, linker-mediated polymerase chain reaction (LM-PCR) allows the amplification of the virus-host genome junctions. Massive sequencing of the amplicons is used to define the mLV integration profile genome-wide. Finally, clusters of recurrent integrations are defined to identify cell-specific regulatory regions, responsible for the activation of cell-type specific transcriptional programs.
The retroviral scanning tool allows the genome-wide identification of cell-specific promoters and enhancers in prospectively isolated target cell populations. Notably, retroviral scanning represents an instrumental technique for the retrospective identification of rare populations (e.g. somatic stem cells) that lack robust markers for prospective isolation.

Here, we describe a protocol for genome-wide mapping of the integration sites of Moloney murine leukemia virus-based retroviral vectors in human cells.

Moloney murine leukemia (MLV) virus-based retroviral vectors integrate predominantly in acetylated enhancers and promoters. For this reason, mLV ...

Mapping Genome-wide Accessible Chromatin in Primary Human T Lymphocytes by ATAC-Seq

Assay for Transposase-Accessible Chromatin with high-throughput sequencing (ATAC-seq) is a method used for the identification of open (accessible) regions of chromatin. These regions represent regulatory DNA elements (e.g., promoters, enhancers, locus control regions, insulators) to which transcription factors bind. Mapping the accessible chromatin landscape is a powerful approach for uncovering active regulatory elements across the genome. This information serves as an unbiased approach for discovering the network of relevant transcription factors and mechanisms of chromatin structure that govern gene expression programs. ATAC-seq is a robust and sensitive alternative to DNase I hypersensitivity analysis coupled with next-generation sequencing (DNase-seq) and formaldehyde-assisted isolation of regulatory elements (FAIRE-seq) for genome-wide analysis of chromatin accessibility and to the sequencing of micrococcal nuclease-sensitive sites (MNase-seq) to determine nucleosome positioning. We present a detailed ATAC-seq protocol optimized for human primary immune cells i.e. CD4+ lymphocytes (T helper 1 (Th1) and Th2 cells). This comprehensive protocol begins with cell harvest, then describes the molecular procedure of chromatin tagmentation, sample preparation for next-generation sequencing, and also includes methods and considerations for the computational analyses used to interpret the results. Moreover, to save time and money, we introduced quality control measures to assess the ATAC-seq library prior to sequencing. Importantly, the principles presented in this protocol allow its adaptation to other human immune and non-immune primary cells and cell lines. These guidelines will also be useful for laboratories which are not proficient with next-generation sequencing methods.

Assay for Transposase-Accessible Chromatin coupled with high-throughput sequencing (ATAC-seq) is a genome-wide method to uncover accessible chromatin. This is a step-by-step ATAC-seq protocol, from molecular to the final computational analysis, optimized for human lymphocytes (Th1/Th2). This protocol can be adopted by researchers without prior experience in next-generation sequencing methods.

Assay for Transposase-Accessible Chromatin with high-throughput sequencing (ATAC-seq) is a method used for the identification of open (accessible) regions ...

Promoter Capture Hi-C: High-resolution, Genome-wide Profiling of Promoter Interactions

The three-dimensional organization of the genome is linked to its function. For example, regulatory elements such as transcriptional enhancers control the spatio-temporal expression of their target genes through physical contact, often bridging considerable (in some cases hundreds of kilobases) genomic distances and bypassing nearby genes. The human genome harbors an estimated one million enhancers, the vast majority of which have unknown gene targets. Assigning distal regulatory regions to their target genes is thus crucial to understand gene expression control. We developed Promoter Capture Hi-C (PCHi-C) to enable the genome-wide detection of distal promoter-interacting regions (PIRs), for all promoters in a single experiment. In PCHi-C, highly complex Hi-C libraries are specifically enriched for promoter sequences through in-solution hybrid selection with thousands of biotinylated RNA baits complementary to the ends of all promoter-containing restriction fragments. The aim is to then pull-down promoter sequences and their frequent interaction partners such as enhancers and other potential regulatory elements. After high-throughput paired-end sequencing, a statistical test is applied to each promoter-ligated restriction fragment to identify significant PIRs at the restriction fragment level. We have used PCHi-C to generate an atlas of long-range promoter interactions in dozens of human and mouse cell types. These promoter interactome maps have contributed to a greater understanding of mammalian gene expression control by assigning putative regulatory regions to their target genes and revealing preferential spatial promoter-promoter interaction networks. This information also has high relevance to understanding human genetic disease and the identification of potential disease genes, by linking non-coding disease-associated sequence variants in or near control sequences to their target genes.

DNA regulatory elements, such as enhancers, control gene expression by physically contacting target gene promoters, often through long-range chromosomal interactions spanning large genomic distances. Promoter Capture Hi-C (PCHi-C) identifies significant interactions between promoters and distal regions, enabling the assignment of potential regulatory sequences to their target genes.

The three-dimensional organization of the genome is linked to its function. For example, regulatory elements such as transcriptional enhancers control the ...

A Fast and Quantitative Method for Post-translational Modification and Variant Enabled Mapping of Peptides to Genomes

Cross-talk between genes, transcripts, and proteins is the key to cellular responses; hence, analysis of molecular levels as distinct entities is slowly being extended to integrative studies to enhance the understanding of molecular dynamics within cells. Current tools for the visualization and integration of proteomics with other omics datasets are inadequate for large-scale studies. Furthermore, they only capture basic sequence identify, discarding post-translational modifications and quantitation. To address these issues, we developed PoGo to map peptides with associated post-translational modifications and quantification to reference genome annotation. In addition, the tool was developed to enable the mapping of peptides identified from customized sequence databases incorporating single amino acid variants. While PoGo is a command line tool, the graphical interface PoGoGUI enables non-bioinformatics researchers to easily map peptides to 25 species supported by Ensembl genome annotation. The generated output borrows file formats from the genomics field and, therefore, visualization is supported in most genome browsers. For large-scale studies, PoGo is supported by TrackHubGenerator to create web-accessible repositories of data mapped to genomes that also enable an easy sharing of proteogenomics data. With little effort, this tool can map millions of peptides to reference genomes within only a few minutes, outperforming other available sequence-identity based tools. This protocol demonstrates the best approaches for proteogenomics mapping through PoGo with publicly available datasets of quantitative and phosphoproteomics, as well as large-scale studies.

Here we present the proteogenomic tool PoGo and protocols for fast, quantitative, post-translational modification and variant enabled mapping of peptides identified through mass spectrometry onto reference genomes. This tool is of use to integrate and visualize proteogenomic and personal proteomic studies interfacing with orthogonal genomics data.

Cross-talk between genes, transcripts, and proteins is the key to cellular responses; hence, analysis of molecular levels as distinct entities is slowly ...

Transcription Start Site Mapping Using Super-low Input Carrier-CAGE

Cap analysis of gene expression (CAGE) is a method used for single-nucleotide resolution detection of RNA polymerase II transcription start sites (TSSs). Accurate detection of TSSs enhances identification and discovery of core promoters. In addition, active enhancers can be detected through signatures of bidirectional transcription initiation. Described here is a protocol for performing super-low input carrier-CAGE (SLIC-CAGE). This SLIC adaptation of the CAGE protocol minimizes RNA losses by artificially increasing the RNA amount through use of an in vitro transcribed RNA carrier mix that is added to the sample of interest, thus enabling library preparation from nanogram-amounts of total RNA (i.e., thousands of cells). The carrier mimics the expected DNA library fragment length distribution, thereby eliminating biases that could be caused by the abundance of a homogenous carrier. In the last stages of the protocol, the carrier is removed through degradation with homing endonucleases and the target library is amplified. The target sample library is protected from degradation, as the homing endonuclease recognition sites are long (between 18 and 27 bp), making the probability of their existence in the eukaryotic genomes very low. The end result is a DNA library ready for next-generation sequencing. All steps in the protocol, up to sequencing, can be completed within 6 days. The carrier preparation requires a full working day; however, it can be prepared in large quantities and kept frozen at -80 &#176;C. Once sequenced, the reads can be processed to obtain genome-wide single-nucleotide resolution TSSs. TSSs can be used for core promoter or enhancer discovery, providing insight into gene regulation. Once aggregated to promoters, the data can also be used for 5&#8217;-centric expression profiling.

Cap Analysis of Gene Expression (CAGE) is a method for genome-wide quantitative mapping of mRNA 5&#8217;ends to capture RNA polymerase II transcription start sites at a single-nucleotide resolution. This work describes a low-input (SLIC-CAGE) protocol for generation of high-quality libraries using nanogram-amounts of total RNA.

Cap analysis of gene expression (CAGE) is a method used for single-nucleotide resolution detection of RNA polymerase II transcription start sites (TSSs). ...

In Vitro Biochemical Assays using Biotin Labels to Study Protein-Nucleic Acid Interactions

Protein-nucleic acid interactions play important roles in biological processes such as transcription, recombination, and RNA metabolism. Experimental methods to study protein-nucleic acid interactions require the use of fluorescent tags, radioactive isotopes, or other labels to detect and analyze specific target molecules. Biotin, a non-radioactive nucleic acid label, is commonly used in electrophoretic mobility shift assays (EMSA) but has not been regularly employed to monitor protein activity during nucleic acid processes. This protocol illustrates the utility of biotin labeling during in vitro enzymatic reactions, demonstrating that this label works well with a range of different biochemical assays. Specifically, in alignment with previous findings using radioisotope 32P-labeled substrates, it is confirmed via biotin-labeled EMSA that MEIOB (a protein specifically involved in the meiotic recombination) is a DNA-binding protein, that MOV10 (an RNA helicase) resolves biotin-labeled RNA duplex structures, and that MEIOB cleaves biotin-labeled single-stranded DNA. This study demonstrates that biotin is capable of substituting 32P in various nucleic acid-related biochemical assays in vitro.&#160;

Presented here are protocols for in vitro biochemical assays using biotin labels that may be widely&#160;applicable for studying protein-nucleic acid interactions.

Protein-nucleic acid interactions play important roles in biological processes such as transcription, recombination, and RNA metabolism. Experimental ...

Mapping RNA-RNA Interactions Globally Using Biotinylated Psoralen

Summary

Explore More Videos

Chapters in this video

Conjugative Mating Assays for Sequence-specific Analysis of Transfer Proteins Involved in Bacterial Conjugation

QTL Mapping and CRISPR/Cas9 Editing to Identify a Drug Resistance Gene in Toxoplasma gondii

Single Molecule Analysis of Laser Localized Psoralen Adducts

Genome-wide Mapping of Protein-DNA Interactions with ChEC-seq in Saccharomyces cerevisiae

Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions

Mapping Genome-wide Accessible Chromatin in Primary Human T Lymphocytes by ATAC-Seq

Promoter Capture Hi-C: High-resolution, Genome-wide Profiling of Promoter Interactions

A Fast and Quantitative Method for Post-translational Modification and Variant Enabled Mapping of Peptides to Genomes

Transcription Start Site Mapping Using Super-low Input Carrier-CAGE

In Vitro Biochemical Assays using Biotin Labels to Study Protein-Nucleic Acid Interactions