Bu eser tarafından desteklenen Ulusal Bilim Vakfı a.ş. (DEB #1427772, 1745411, 1750037) verir.

1. toplama ve yüzey sterilizasyon kene
<ol><li>Kene keneler kaldırma bir kene ilişkili yaşam alanı içinde bir 1 m2 beyaz bez sürükleyerek ana türler için bağlı veya yetiştirme keneler lab15,16' toplamak. İyi forseps keneler işlemek ve onları-80 ° C'de depolamak için kullanın.</li>
	<li>Bireysel PCR tüplerde keneler yerleştirin ve vortexing 15 yüzey kirletici kaldırmak s 500 μL hidrojen peroksit (H2O2), % 70 etanol ve GKD2O. ile Art arda</li>
	<li>Keneler yeni bir PCR tüpü yerleştirin ve onları kurumasını sağlar.</li>
	<li>Bu tüp mekanik harcı ve küçük boncuk boncuk çırpıcı içinde kullanarak, (Bu çalışmada kullanılan) havaneli keneler kırma tarafından kene doku bozabilir veya kene apart bir neşter ile kesme.</li>
</ol>2. DNA arıtma
<ol><li>Bireysel keneler, piyasada bulunan bir DNA ekstraksiyon kiti sağlanan yönergeleri izleyerek gelen DNA arındırmak. 100 μL son bir hacim için elute. Not: resim 1 ' e adımları 2.2-2.8 için genel bakış konusuna bakın. Fenol kloroform ayıklama17,18, etanol yağış19veya ayıklama bir bağlayıcı malzeme20,21ile alternatif çıkarma yöntemleri içerir.</li>
	<li>Bir yer veya spektrofotometre kullanarak başarılı DNA arıtma onaylayın. Fluorometry için DNA şablonunun 10 μL 190 μL çift iplikçikli DNA assay olarak kullanın. 0.1-1.0 beklenen verimidir ng/μL22. Spectrophotometry için bir nükleik asit miktar 1 μL DNA şablonu kullanın. Beklenen A260/280 oranı yaklaşık 1.823' tür.</li>
	<li>Eğer değilse geçmeden hemen amplifikasyon, örnekleri-20 ° C'de depolayın</li>
</ol>3. 16S rRNA gen amplifikasyon
<ol><li>Amplicon PCR içeren bir 27,5 μL tepki olarak ayarlayın: 5 μL her astar, 1 mikron; 12.5 μL piyasada bulunan PCR karışımı; ve bir 5 ng/μL konsantrasyon, bireysel keneler çıkarılan DNA'ın 5 μL. Not: aşağıdaki astar hypervariable V3 V4 bölge 16S rRNA gen13amplifikasyon için kullanın: 5'--TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG--3', 5'--GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC--3'</li>
	<li>Tüpler için programlanmış bir thermocycler gider: ilk denatürasyon 95 ° c 3 dakika; 1) 95 ° C 25 döngüleri için 30 s, 2) 57 ° C 30 s, 30 3) 72 ° C s; Son bir uzantısı 72 ° c 5 min için; ve son bir tutun 10 ° C'de</li>
	<li>PCR işlem tamamlandıktan sonra PCR ürünü 4-6 μL/örnek % 1.5 özel jel üzerinde yükleyerek görselleştirin. 460 adlı bir grup için bak bp amplifikasyon onaylamak için. Not: örnek konsantrasyon çok düşükse Amplicon PCR ürünü jel üzerinde görünür olmayabilir (< 10 ng). Astar dimer varlığı düşük konsantrasyon örneklerinde yaygındır. Diğer hedef grup varsa, tavlama sıcaklığı ayarlayın veya devir sayısını azaltın.</li>
	<li>Eğer değilse geçmeden hemen arıtma, örnekleri 4 ° C'de depolayın</li>
</ol>4. 16S Amplicon arıtma
<ol><li>Yeni bir PCR tüp her örnek için kullanarak, PCR ürünü 60 μL toplam edinme GKD2ile O birleştirmek. Düşük DNA konsantrasyonları ile örnekleri için amplicon PCR güçlendirme önyargı azaltmak ve konsantre örnekleri havuz nüsha gerçekleştirin.</li>
	<li>Paramagnetic boncuk oda sıcaklığında ve girdap onları kullanmadan önce iyi getirmek.</li>
	<li>Paramagnetic boncuk 48 μL örnek 60 μL ekleyin ve 5 dk. 5 çözüm şeklini alıncaya kadar min için manyetik bir raf üzerine boruları temizle yer kuluçkaya. Süpernatant kaldırın. Not: Bu boncuk konsantrasyon astar dimer (< 60 bp) kaldırılmasını hedefler. Gerekirse, diğer non-spesifik bantlama kaldırmak için boncuk konsantrasyon belirleyin.</li>
	<li>Manyetik raf üzerine boruları ile taze hazırlanmış %80 500 μL eklemek alkol. Alkol tüm tüpler için hemen ekledikten sonra sıvı pipet. Boncuk kaldırmaz. Alkol eklendiğini ve kaldırıldığını bir kez daha yineleyin.</li>
	<li>Aşırı alkol tüplerin açık 5 min için veya küçük çatlaklar boncuklar görünür hale gelene kadar manyetik raf üzerinde bırakarak kaldırmak için örnekleri kuruması.</li>
	<li>TE arabelleği 20 μL ekleyin ve 5-10dk için oda sıcaklığında mıknatıs kapalı örnekleri kuluçkaya.</li>
	<li>Tüpler üzerinde geri mıknatıs yerleştirin. Bir kez boncuk ve sıvı ayrılmıştır, süpernatant temizlenmiş PCR ürünü elde etmek için taze bir tüp aktarın.</li>
	<li>(İsteğe bağlı) 4-6 μL/örnek % 1.5 jel üzerinde yükleyerek başarılı amplicon arıtma onaylamak için ürün görselleştirme. 460 bp grup görünür olmalı ve hiçbir astar dimer olmalıdır.</li>
	<li>Hemen PCR dizini devam değil örnekleri saklayabilirsiniz 4 ° C.</li>
</ol>5. örnek tedarikçilerden ve arıtma
<ol><li>Benzersiz astar bileşimleri her örnek için ileriye veya geriye doğru astar veya her ikisini de bir ticari olarak mevcut Kütüphane Dizin Takımı'ndan seçerek atayın. Not: Benzersiz olarak etiketleme örnekleri sıralama sonra farklılaşma sağlar. Kitleri genellikle 96-384 örneklerini sıralamak için yeterli astar sağlar.</li>
	<li>Çift astar veya endeksi, her astar (N7xx ve S5xx), 12,5 μL piyasada bulunan PCR ana Mix, GKD2O 5 μL ve temizlenmiş amplicon ürünün 2.5 μL 2.5 μL içeren bir 25 μL reaksiyon PCR gerçekleştirerek örnekleri iliştirin.</li>
	<li>Tüpler için programlanmış bir thermocycler gider: ilk denatürasyon 95 ° c 3 dakika; 1) 95 ° c 8-14 devredir 30 s, 2) 55 ° C 30 s, 30 3) 72 ° C s; Son bir uzantısı 72 ° c 5 min için; ve son bir tutun 10 ° C'de</li>
	<li>PCR işlem tamamlandıktan sonra PCR ürünü 4-6 μL/örnek % 1.5 özel jel üzerinde yükleyerek görselleştirin. 550 bir band arayın bp amplifikasyon onaylamak için. Not: görselleştirme sonuçları Dizin PCR Bisiklet koşullarını bildirmek için kullanabilirsiniz. Non-spesifik bağlama azaltmak veya her örnek için görünür bantları elde etmek için döngü sayımı artırmak için döngü sayısını düşürmesi.</li>
	<li>4. adımda listelenen temizlik yordamı yineleyin. Seyreltme temizlik sırasında önlemek için içinde yinelenen dizin PCR gerçekleştirmek ve ürün burada havuz.</li>
	<li>Eğer değilse geçmeden hemen Kütüphane miktar ve normalleştirme, örnekleri 4 ° C'de depolayın</li>
</ol>6. Kütüphane miktar ve normalleştirme
<ol><li>Her arıtılmış, barkodlu ürün--dan adım bir yer veya spektrofotometre kullanarak 5.5 konsantrasyonu tahmin (bkz. Adım 2.2). Yaklaşık 1 de konsantrasyonları elde etmek TE arabellek örneklerinde sulandırmak. Not: Kütüphane miktar konsantrasyon sıralama platformu için önerilen yükleme örnek sağlamak gereklidir. Kütüphane miktar qPCR elde edilir, ama örnek konsantrasyon qPCR önce tahmin reaktifler ve zaman kazandırır. Bu miktar Seti24' te sağlanan qPCR standartları ortalama yoğunlukta olduğu gibi 1 de konsantrasyon Kütüphane miktar, doğruluğunu en üst düzeye çıkarmak için önerilir.</li>
	<li>QPCR qPCR ana mix (kütüphane miktar kitinden), GKD2O 2.0 μL ve 2.0 μL örnek veya Standart 6.0 μL içeren bir 10 μL reaksiyonu gerçekleştirmek. Her örnek ve standart büyük doğruluk ve kesinlik için nüsha olarak çalıştırın. Üç veya daha fazla seyreltme düzeylerinde her örneği çalıştırmak (Örn., 0 pm 1, 1 pm ve 10 pm için tahmini başlangıç konsantrasyonu) doğru miktar emin olmak için. Not: Sağlanan astar ve standartları hakkında ayrıntılı bilgi kullanılan miktar kiti göre değişir ve ürünler teknik data sayfasında mevcuttur. Bu çalışmada kullanılan miktar kit için Malzemeler tablo bakın.</li>
	<li>QPCR plaka veya borular için programlanmış bir gerçek zamanlı PCR araç taşıma: bir ilk denatürasyon 95 ° c 5 dakika; 1) 95 ° C 35 döngüleri 30 ve 45 için 2) 60 ° C için s; ve ayrılma adım 1) 95 ° C 15 / s, 2) 60 ° C 30 s ve 3) 95 ° C 15 s.</li>
	<li>Konsantrasyon qPCR sonuçlarından elde edilen miktar değerler ve kullanılan örnek seyreltme düzeyleri kullanarak her örnek için başlangıç ortalamasını hesapla. Not: Örneğin, 2 de seyreltilmiş örnek 1:100,000 için Ortalama bir yoğunlukta bir özgün başlangıç konsantrasyonu 200 verir. nM. Belirli bir örnek için seyreltme seviyeleri hiçbiri standart eğrileri aralığı içinde düşerse, miktar sonuçlar doğru olmayabilir; Bu durumda, seyreltme düzeylerini ayarlamak ve qPCR yeniden gerçekleştirin.</li>
	<li>Arıtılmış, barkodlu örnekleri 4 seyreltik nM üzerinde ortalama konsantrasyonları dayalı TE arabellekte hesaplanan adım 7,5. Not: Örneğin, bir ortalama örnek konsantrasyonu 200 nM, seyreltik örnek 1:50 te arabellek 4 nM konsantrasyonu elde etmek için. Kesin örnek konsantrasyon kullanılan sıralama sistemi ve reaktif kiti göre değişir. Önerilen konsantrasyon için sıralama sistemi kullanıcı kılavuzuna bakın.</li>
	<li>Birleşik kitaplığı eşit birimleri (genellikle 5-10 μL) ekleyerek tüm bireysel kütüphanelerin tek bir tüp oluşturun. Not: tüm örneklerini bir 4 nM konsantrasyonu, olması gerektiği gibi eşit birimleri ekleme havuza alınan kitaplığındaki tüm örnekleri eşit bir konsantrasyon sağlar.</li>
	<li>6.2-6.4 4 nM konsantrasyon onaylamak için birleştirilmiş belge kitaplığını adımları yineleyin.</li>
	<li>Birleşik kitaplığı toplama hesaplamak ve seyreltik veya Kütüphane Tris arabellek 4 ulaşmak için gerektiği gibi kullanarak son, havuza alınan yeniden teşkil nM.</li>
	<li>Eğer değilse geçmeden hemen örnek yükleme, örnekleri-20 ° C'de depolayın Miktar kaybı veya DNA toplama depolama sırasında değişiklikleri en aza indirmek için kısa bir süre sonra çalıştırmak sıralama gerçekleştirir.</li>
</ol>7. Kütüphane denatürasyon ve seyreltme ve sıralama çalıştırın (aynı gün gerçekleştirmek)
<ol><li>Adım 6,9 NaOH ile 4 nM kombine kitaplığından denatüre. Not: Son Kütüphane hazırlık adımları her sıralama sistemi için farklı. Daha detaylı ve güncel iletişim kuralları için sıralama sistemi kullanıcı kılavuzuna bakın. Yeni kullanıcılar büyük olasılıkla sıralama platform kullanımı hakkında eğitimli olması gerekir veya arşivlerine bir çekirdek sıralama tesisine gönderebilir.</li>
	<li>Sıralama reaktif kiti (Tablo reçetesi) sağlanan arabellek kullanarak istenen yükleme konsantrasyon denatüre kitaplığına sulandırmak. Not: Sıralama sistemi ve genellikle 1-250 pM25arasında değişen tarafından en uygun yükleme konsantrasyonları farklılık.</li>
	<li>Denatüre ve sıralama denetimi oranında seyreltin. Not: sıralama denetimi ekleme düşük çeşitlilik kitaplıklardan doğan sıralama sorunları düzeltir. NaOH kullanarak sıralama denetimini tabiatını ve Kütüphane olarak aynı konsantrasyonu oranında seyreltin.</li>
	<li>Kütüphane ve sıralama denetimi birleştirir. Not: Sıralama denetimini Birleşik kitaplığı için oranını Kütüphane çeşitlilik ve kullanılan sıralama sistemi üzerinde bağlıdır, ama genellikle 11:2626öyle.</li>
	<li>Birleşik kitaplığı ve sıralama kontrol karışımı sıralama akışı hücre üzerine yükleyin.</li>
</ol>8. Amplicon dizi analizi
<ol><li>Çalıştır genel başarısı kullanılan sıralama sistemi karşılık gelen bulut bilgi işlem ortamı üzerinde çalışma ölçümleri inceleyerek değerlendirmek. Not: Sıralama okuma, sayısı gibi çalışma ölçümleri platformu ve reaktif kiti kullanılan sıralama göre değişir. Genel sıralama sistemleri için hedef değerleri Tablo 1' de listelenmiştir.</li>
	<li>Ham sıralama veri indirme ve istenen Biyoinformatik açık kaynak bilgisayar yazılımı, mikrobiyal ekoloji (QIIME)27 veya Mothur28nicel anlayışlar. Not: Her ikisi de QIIME ve Mothur açık kaynak ve ücretsiz olarak yüklenebilir. Bu programları kullanma hakkında ayrıntılı yönergeler çevrimiçi bulunabilir ve ilk kez kullananlar için yeterince ayrıntılı olarak açıklanmıştır. Aşağıdaki adımları bir Biyoinformatik boru hattı QIIME içinde yürütülen geniş bir genel bakış sağlar. Python ile aşinalık gerekli değildir ancak aşağıdaki komut dosyaları uygulanması kolaylaştıracak</li>
	<li>Oluşturun ve QIIME içinde "validate_mapping_file.py" komut dosyası kullanarak eşleme dosyası doğrulayın. Not: Eşleme dosyası örnek kimliği, amplicon astar dizileri ve örnek açıklama da dahil olmak üzere veri analizi yapmak gerekli tüm meta veriler içerir. Doğrulama adım gerekli tüm veriler doğru biçimde girilen denetler.</li>
	<li>Demultiplex ve dizileri "split_libraries.py" komut dosyası (Şekil 1) kullanarak filtre uygulayabilirsiniz. Not: Bu komut dosyası örnekleri dizin astar kombinasyonlarını temel alarak barkodlu okuma atar ve örnek kimliği eşleme dosyasında girdi. Ayrıca çeşitli kalite adımları hata Kullanıcı tanımlı kesintileri en düşük kalite puanı, sırası uzunlukları ve bitiş kırpma için temel sıralama için denetlemek için filtreleme yapar.</li>
	<li>Operasyonel taksonomik birimleri (OTUs) serileri "pick_open_references_otus.py" komut dosyası kullanarak atayın. Not: Bu adımda, kimlik (%97) bir eşiğe göre başvuru sıra koleksiyon karşı dizileri kümelenir. Başvuru sıra koleksiyon eşleşmiyor okuma birbirlerine karşı kümelenir. De novo ve kapalı-başvuru OTU malzeme çekme seçenekleri de mevcuttur, ancak açık-referans malzeme çekme QIIME geliştiriciler tarafından önerilir.</li>
	<li>"Alpha_rarefaction.py" veya "normalize_table.py" komut dosyası kullanarak OTU tablo normalize. Not: Sütun toplamları varyasyon için bu adım düzeltir veya modern sıralama teknolojilerinden neden örnek başına toplam serisi okur. Normalleştirme gerçekleştirilen geleneksel rarefaction, kullanarak ya da kümülatif toplamı ölçekleme gibi alternatif yöntemler aracılığıyla.</li>
	<li>Birkaç Alfa-çeşitlilik, beta-çeşitlilik ve "core_diversity_analysis.py" komut dosyası kullanarak tek seferde taksonomik kompozisyon çeşitlilik analizleri gerçekleştirmek. Not: Alternatif olarak, bu analizleri ayrı olarak bireysel komut dosyaları kullanarak çalıştırılabilir (Örneğin, "alpha_diversity.py").</li>
</ol>

Yazarlar ifşa gerek yok.

Yeni nesil sıralama 16S rRNA, mikrobiyal tanımlama için standart bir yaklaşım haline ve vektör microbiomes patojen iletim etkilemesi çalışma etkin. Burada özetlenen protokolü, ı. pacificus, Lyme hastalığı için bir vektör tür derlemede mikrobiyal topluluk araştırmak için bu yöntemin kullanılması detayları; Ancak, bu kolayca diğer kene türleri veya vektörel arthropod türlerin çalışma için uygulanabilir.
Nitekim, 16S rRNA sıralama microbiome analiz için...

Diriliş ve vektör kaynaklı hastalıkların yayılması olarak son yıllarda küresel insan ve yabani hayvanlar ve bitkiler sağlık için ciddi bir tehdit oluşturmaktadır. Etkili aşılar bu hastalıkların bir çoğu için eksik olan ve denetim çabaları vektörel çizimler ve vektör-host etkileşimleri karmaşık biyolojik doğası tarafından engellemiştir. Mikrobiyal etkileşim bir vektör patojen iletim içindeki rolünün anlaşılması için bu zorlukları aşmak roman strateji geliştirme izin verebilirsiniz. Özellikle, mikrobiyal commensals vektör ilişkili, simbiont ve patojenler, microbiome anılacaktır arasındaki etkileşimler patojen iletimi için önemli sonuçları olabilir. Şimdi kanıt ezici bu iddianın vektör microbiome ve sıtma, Zika virüs ve Lyme hastalığı1,2,3gibi hastalıklar için yetki arasında bir bağlantı gösteren örnekler ile destekler. Ancak bu bulgular hastalık kontrol stratejileri içine çeviri yapı, fonksiyon ve vektör microbiomes kökeni çok daha detaylı bir anlayış gerektirir. Kimlik ve ekolojik ve deneysel koşullar değişen altında vektör mikrobiyal topluluk karakterizasyonu bu alanda önemli bir yol oluşturur.
Bir patojen vektör mikrobiyal sakinleri tanımlamak için bir yordam burada Batı siyah bacaklı kene, Ixodes pacificus, Lyme hastalığı Borrelia burgdorferipatojen bir vektör tür kullanarak sağlanır. Nispeten az insan patojenleri daha fazla tür herhangi bir diğer eklem bacaklılar daha keneler liman iken, kene microbiomes4biyoloji ve topluluk ekolojisi hakkında bilinir. Bu kenelerin virüs, bakteri, mantar ve commensals, endosymbionts ve geçici mikrobiyal sakinleri5,4dahil protozoa çeşitli bir dizi liman açıktır. Ön çalışma güçlü Ixodes microbiomes coğrafya, türler, seks, hayat sahne ve kan yemek kaynak6,7,8ile ilişkili değişimler göstermiştir. Ancak, bu varyasyon yatan mekanizmaları bilinmeyen kalır ve daha ayrıntılı araştırmalar kökeni ve mikrobiyal bu toplulukların Meclisi garanti. Keneler mikroplar dikey iletim yoluyla elde ana bilgisayarlar ve vızıltısı, ağız ve anal gözenek9ortamından alımı ile ilgili. İlk oluşumu ve kene microbiome gelişimini şekillendirme faktörleri anlama, dikey ve çevresel iletim, özellikle göreli katkısını doğal desenler ve kene değişimleri anlamak için önemli microbiome çeşitlilik ve nasıl hastalık ya da vektör kontrol etmek mümkün uygulamalarla patojen iletim sırasında bu toplulukların etkileşim.
Yeni nesil sıralama gibi güçlü moleküler teknikler şimdi mikrobiyal toplulukları tanımlamak için mevcut ve vektör microbiomes çeşitli çevresel veya deneysel koşullar altında karakterize etmek için istihdam edilebilir. Bu yüksek üretilen iş sıralama yaklaşımlar gelişiyle önce mikroplar tanımlaması ağırlıklı olarak mikroskobu ve kültür üzerine dayanıyordu. Mikroskopi hızlı ve kolay bir tekniktir, mikroplar tanımlamak için morfolojik yöntemleri doğal olarak öznel ve kaba ve düşük duyarlılık ve algılama10tarafından sınırlı iken. Kültür tabanlı yöntemleri mikrobiyal tanımlama için genel olarak kullanılan ve ilaç tedavileri11mikroplar duyarlılık belirlemek için kullanılabilir. Ancak, çevre mikroplar az % 212ayarlama bir laboratuarda kültürlü olduğunu tahmin ediyor gibi bu yöntem aynı zamanda düşük duyarlılık uğrar. Histolojik boyama yaklaşımlar da algılamak ve belirli mikroplar vektörel çizimler içinde Yerelleştir, araştırmalar kene içinde çeşitli takson dağılımları etkinleştirmek ve mikrobiyal etkileşim hakkında hipotezler incelemek için istihdam edilmiştir. Ancak, mikrobiyal kimliğinin ön bilgi hasta uygun mikrobiyal karakterizasyonu ve kimlik için bu yaklaşım yapmak uygun lekeleri seçmek için gereklidir. Ayrıca, histolojik boyama çok zaman yoğun, zahmetli bir süreç ve iyi örneklerin boyutu büyük ölçekli değil. Sıralama aynı şekilde onların duyarlılık ve algılama mikrobiyal çeşitli toplulukların sınırlı Sanger gibi geleneksel moleküler yaklaşımlar.
Çok sayıda örnekleri üzerinden mikroplar hızlı tanımlanması için yeni nesil sıralama sağlar. Standart marker gen ve başvuru veritabanları daha fazla sağlar geliştirilmiş cins veya tür seviyesine kez taksonomik çözünürlük. Küçük alt birimi ribozomal RNA'ların 16S rRNA gen içinde korunmuş ve değişken bölgeler varlığı nedeniyle en yaygın olanıdır her bakteriyel için benzersiz amplicons ile evrensel astar oluşturmak için izin ile bu hedefe ulaşmak için sık sık kullanılır tür13,14. Bu rapor 16S rRNA yeni nesil sıralama ile kene microbiome takson tanımlamak için bir yordam ayrıntıları. Özellikle, bu protokolü örnekleri sıralama için hazırlanmasında ilgili adımlar vurgular. Daha tafsilât üstünde nasıl yapılacağını yaygın ve Biyoinformatik adımlar sağlanmaktadır, şu anda mevcut, çeşitli sıralama platformları ve analiz programları gibi her biri ayrıntılı varolan belgeleri. Bu yeni nesil sıralama yaklaşımın genel fizibilite soruşturma mikrobiyal topluluk derleme içinde bir anahtar hastalık vektör uygulayarak gösterilmiştir.

<table><tbody><tr><td>Item</td><td>Name of Material/Equipment</td><td>Company</td><td>Catalog #</td></tr><tr><td>1</td><td>DNeasy Blood &amp;amp; Tissue Kit</td><td>Qiagen</td><td>69504</td></tr><tr><td>2</td><td>Qubit 4 Fluorometer</td><td>ThermoFisher Scientific</td><td>Q3326</td></tr><tr><td>3</td><td>NanoDrop 8000 Spectrophotometer</td><td>ThermoFisher Scientific</td><td>ND-8000-GL</td></tr><tr><td>4</td><td>2x KAPA HiFi HotStart ReadyMix</td><td>Kapa Biosystems</td><td>KK2501</td></tr><tr><td>5</td><td>AMPure XP beads</td><td>Agen Court</td><td>A63880&amp;nbsp;</td></tr><tr><td>6</td><td>Magnetic Rack</td><td>ThermoFisher Scientific</td><td>MR02</td></tr><tr><td>6</td><td>TE buffer</td><td>Teknova</td><td>T0223</td></tr><tr><td>7</td><td>Nextera Index Kit</td><td>Illumina</td><td>FC-121-1011</td></tr><tr><td>8</td><td>KAPA Library Quantification Kit</td><td>Roche</td><td>KK4824</td></tr><tr><td>9</td><td>MiSeq System</td><td>Illumina</td><td>SY-410-1003</td></tr><tr><td>10</td><td>MiSeq Reagent Kit v3&amp;nbsp;</td><td>Illumina</td><td>MS-102-3001</td></tr><tr><td>11</td><td>10 mM Tris-HCl with 0.1% Tween 20</td><td>Teknova</td><td>T7724</td></tr></tbody></table>

tick microbiome characterization by next-generation 16s rrna amplicon sequencing

Son yıllarda, vektör kaynaklı hastalıklar yeniden ortaya çıktı ve fiyatlar, önemli morbidite ve mortalite dünya çapında neden endişe verici genişletilmiş. Etkili ve yaygın olarak kullanılan aşılar roman hastalığı azaltma stratejileri geliştirme gerektiren bir çoğunluğu bu hastalıklar için eksik vardır. Bu amaçla, hastalık kontrol umut verici bir cadde vektör microbiome, topluluk vektör yaşayan mikroplar hedef belirleme içerir. Vektör microbiome patojen dinamiklerini çok önemli bir rol oynar ve microbiome işlemler indirimli vektör vektör kaynaklı hastalıklar bir avuç bereket veya patojen iletiminde yol açmıştır. Ancak bu bulgular hastalık kontrol uygulamaları içine çeviri vektör mikrobiyal ekoloji, tarihsel olarak bu alanda yetersiz teknoloji tarafından sınırlı kapsamlı bir anlayış gerektirir. Yeni nesil sıralama yaklaşımlar gelişiyle hızlı, son derece paralel sıralama çeşitli mikrobiyal toplulukların sağlamıştır. Son derece korunmuş 16S rRNA gen hedefleme karakterizasyonu mikroplar ekolojik ve deneysel koşullar değişen altında vektörel çizimler içinde mevcut kolaylaştırdı. Bu tekniği 16S rRNA gen, PCR, sıralama için bir akış hücre üzerine yükleme örnekleri ile örnek barkodlama amplifikasyon içerir ve filogenetik bilgileriyle sıra verileri eşleştirmek için Biyoinformatik yaklaşımlar. Türler veya çoğaltır yüksek bir dizi için cins düzeyi kimlik genellikle böylece alçak hafiye, çözünürlük ve çıkış geleneksel kültür, mikroskopi veya histolojik boyama engellemeyi bu yaklaşım yoluyla elde edilebilir teknikleri. Bu nedenle, bu yöntem vektör mikroplar çeşitli koşullar altında karakterize için uygundur ancak bilgileri şu anda sağlayamaz mikrobiyal işlevi, konumu vektör veya antibiyotik tedavisine yanıt içinde tarih. Genel olarak, 16S yeni nesil sıralama kimlik ve vektör mikroplar hastalık dinamikleri rolünü daha iyi anlamak için güçlü bir tekniktir.

Üç ayrı yumurtadan 42 keneler toplam debriyajlar ve iki çevre pozlama süreleri, 0 ve 2 hafta içinde toprak, microbiome sıralama için işlenen. Her tedavi grubu, 6-8 kene örnekleri çoğaltmak bulunan tek bir debriyaj ve pozlama zaman, olarak kabul. Bu işlenmiş kene özleri yeni nesil sekanslama dolu ve filtre geçen 12,885,713 eşleştirilmiş uç okuma vermiştir. Bu çalışmasında yer dahil 211,214 okuma (önceki sayıma dahil) Toplam verimli ayıklama adım 3 negatif kontr...

Watch this Scientific Journal Video about Tick Microbiome Characterization by Next-Generation 16S rRNA Amplicon Sequencing at JoVE.com

Tick Microbiome Characterization by Next-Generation 16S rRNA Amplicon Sequencing

Burada bir nesil sıralama iletişim kuralı kimliği ve mikrobiyal topluluklar vektörel çizimler içinde karakterizasyonu sağlayan 16S rRNA sıralama için mevcut. Bu yöntem, DNA ekstraksiyon, amplifikasyon ve barkodlama filogenetik bilgi için sıra verileri eşleştirmek için bir akış-hücre ve Biyoinformatik üzerinde sıralama PCR aracılığıyla örnekleri içerir.

Kene Microbiome karakterizasyonu tarafından yeni nesil 16S rRNA Amplicon sıralama

In recent decades, vector-borne diseases have re-emerged and expanded at alarming rates, causing considerable morbidity and mortality worldwide. Effective ...

tick-microbiome-characterization-next-generation-16s-rrna-amplicon

Universidad de Cartagena UDEC

Research

JoVE Journal

Biology

12.7K Görüntüleme.  San Francisco State University. Burada bir nesil sıralama iletişim kuralı kimliği ve mikrobiyal topluluklar vektörel çizimler içinde karakterizasyonu sağlayan 16S rRNA sıralama için mevcut. Bu yöntem, DNA ekstraksiyon, amplifikasyon ve barkodlama filogenetik bilgi için sıra verileri eşleştirmek için bir akış-hücre ve Biyoinformatik üzerinde sıralama PCR aracılığıyla örnekleri içerir.

Video: Tick Microbiome Characterization by Next-Generation 16S rRNA Amplicon Sequencing

Exploring the Root Microbiome: Extracting Bacterial Community Data from the Soil, Rhizosphere, and Root Endosphere

The intimate interaction between plant host and associated microorganisms is crucial in determining plant fitness, and can foster improved tolerance to abiotic stresses and diseases. As the plant microbiome can be highly complex, low-cost, high-throughput methods such as amplicon-based sequencing of the 16S rRNA gene are often preferred for characterizing its microbial composition and diversity. However, the selection of appropriate methodology when conducting such experiments is critical for reducing biases that can make analysis and comparisons between samples and studies difficult. This protocol describes in detail a standardized methodology for the collection and extraction of DNA from soil, rhizosphere, and root samples. Additionally, we highlight a well-established 16S rRNA amplicon sequencing pipeline that allows for the exploration of the composition of bacterial communities in these samples, and can easily be adapted for other marker genes. This pipeline has been validated for a variety of plant species, including sorghum, maize, wheat, strawberry, and agave, and can help overcome issues associated with the contamination from plant organelles.

Here, we describe a protocol to obtain amplicon sequence data of soil, rhizosphere, and root endosphere microbiomes. This information can be used to investigate the composition and diversity of plant-associated microbial communities, and is suitable for the use with a wide range of plant species.

Kök Microbiome keşfetmek: toprak, rizosferde ve kök Endosphere bakteriyel topluluk verileri ayıklama

The intimate interaction between plant host and associated microorganisms is crucial in determining plant fitness, and can foster improved tolerance to ...

Genetik

A Method for Targeted 16S Sequencing of Human Milk Samples

Studies of microbial communities have become widespread with the development of relatively inexpensive, rapid, and high throughput sequencing. However, as with all these technologies, reproducible results depend on a laboratory workflow that incorporates appropriate precautions and controls. This is particularly important with low-biomass samples where contaminating bacterial DNA can generate misleading results. This article details a semi-automated workflow to identify microbes from human breast milk samples using targeted sequencing of the 16S ribosomal RNA (rRNA) V4 region on a low- to mid-throughput scale. The protocol describes sample preparation from whole milk including: sample lysis, nucleic acid extraction, amplification of the V4 region of the 16S rRNA gene, and library preparation with quality control measures. Importantly, the protocol and discussion consider issues that are salient to the preparation and analysis of low-biomass samples including appropriate positive and negative controls, PCR inhibitor removal, sample contamination by environmental, reagent, or experimental sources, and experimental best practices designed to ensure reproducibility. While the protocol as described is specific to human milk samples, it is adaptable to numerous low- and high-biomass sample types, including samples collected on swabs, frozen neat, or stabilized in a preservation buffer.

A semi-automated workflow is presented for targeted sequencing of 16S rRNA from human milk and other low-biomass sample types.

Hedeflenen 16S sıralama insan sütü örnekleri için bir yöntem

Studies of microbial communities have become widespread with the development of relatively inexpensive, rapid, and high throughput sequencing. However, as ...

İmmünoloji ve Enfeksiyon

Fluorescence-microscopy Screening and Next-generation Sequencing: Useful Tools for the Identification of Genes Involved in Organelle Integrity

This protocol describes a fluorescence microscope-based screening of Arabidopsis seedlings and describes how to map recessive mutations that alter the subcellular distribution of a specific tagged fluorescent marker in the secretory pathway. Arabidopsis is a powerful biological model for genetic studies because of its genome size, generation time, and conservation of molecular mechanisms among kingdoms. The array genotyping as an approach to map the mutation in alternative to the traditional method based on molecular markers is advantageous because it is relatively faster and may allow the mapping of several mutants in a really short time frame. This method allows the identification of proteins that can influence the integrity of any organelle in plants. Here, as an example, we propose a screen to map genes important for the integrity of the endoplasmic reticulum (ER). Our approach, however, can be easily extended to other plant cell organelles (for example see1,2), and thus represents an important step toward understanding the molecular basis governing other subcellular structures.

A fundamental quest in cell biology is to define the mechanisms that underlie the identity of the organelles that make eukaryotic cells. Here we propose a method to identify the genes responsible for the morphological and functional integrity of plant organelles using fluorescence microscopy and next-generation sequencing tools.

Floresans-mikroskopi Tarama ve nesil Sekanslama: organel Bütünlüğü ile ilgilendim Genlerin belirlenmesi için Faydalı Araçlar

This protocol describes a fluorescence microscope-based screening of Arabidopsis seedlings and describes how to map recessive mutations that alter the ...

Biyoloji

Next-generation Sequencing of 16S Ribosomal RNA Gene Amplicons

One of the major questions in microbial ecology is &#8220;who is there?&#8221; This question can be answered using various tools, but one of the long-lasting gold standards is to sequence 16S ribosomal RNA (rRNA) gene amplicons generated by domain-level PCR reactions amplifying from genomic DNA. Traditionally, this was performed by cloning and Sanger (capillary electrophoresis) sequencing of PCR amplicons. The advent of next-generation sequencing has tremendously simplified and increased the sequencing depth for 16S rRNA gene sequencing. The introduction of benchtop sequencers now allows small labs to perform their 16S rRNA sequencing in-house in a matter of days. Here, an approach for 16S rRNA gene amplicon sequencing using a benchtop next-generation sequencer is detailed. The environmental DNA is first amplified by PCR using primers that contain sequencing adapters and barcodes. They are then coupled to spherical particles via emulsion PCR. The particles are loaded on a disposable chip and the chip is inserted in the sequencing machine after which the sequencing is performed. The sequences are retrieved in fastq format, filtered and the barcodes are used to establish the sample membership of the reads. The filtered and binned reads are then further analyzed using publically available tools. An example analysis where the reads were classified with a taxonomy-finding algorithm within the software package Mothur is given. The method outlined here is simple, inexpensive and straightforward and should help smaller labs to take advantage from the ongoing genomic revolution.

Characterizing microbial community has been a longstanding goal in environmental microbiology. Next-generation sequencing methods now allow for the characterization of microbial communities at an unprecedented depth with minimal cost and labor. We detail here our approach to sequence bacterial 16S ribosomal RNA genes using a benchtop sequencer.

16S Ribozomal RNA Gen amplikonlarının nesil Sıralama

One of the major questions in microbial ecology is &#8220;who is there?&#8221; This question can be answered using various tools, but one of the ...

Targeted DNA Methylation Analysis by Next-generation Sequencing

The role of epigenetic processes in the control of gene expression has been known for a number of years. DNA methylation at cytosine residues is of particular interest for epigenetic studies as it has been demonstrated to be both a long lasting and a dynamic regulator of gene expression. Efforts to examine epigenetic changes in health and disease have been hindered by the lack of high-throughput, quantitatively accurate methods. With the advent and popularization of next-generation sequencing (NGS) technologies, these tools are now being applied to epigenomics in addition to existing genomic and transcriptomic methodologies. For epigenetic investigations of cytosine methylation where regions of interest, such as specific gene promoters or CpG islands, have been identified and there is a need to examine significant numbers of samples with high quantitative accuracy, we have developed a method called Bisulfite Amplicon Sequencing (BSAS). This method combines bisulfite conversion with targeted amplification of regions of interest, transposome-mediated library construction and benchtop NGS. BSAS offers a rapid and efficient method for analysis of up to 10 kb of targeted regions in up to 96 samples at a time that can be performed by most research groups with basic molecular biology skills. The results provide absolute quantitation of cytosine methylation with base specificity. BSAS can be applied to any genomic region from any DNA source. This method is useful for hypothesis testing studies of target regions of interest as well as confirmation of regions identified in genome-wide methylation analyses such as whole genome bisulfite sequencing, reduced representation bisulfite sequencing, and methylated DNA immunoprecipitation sequencing.

Bisulfite amplicon sequencing (BSAS) is a method for quantifying cytosine methylation in targeted genomic regions of interest. This method uses bisulfite conversion paired with PCR amplification of target regions prior to next-generation sequencing to produce absolute quantitation of DNA methylation at a base-specific level.

DNA Metilasyon Analizi nesil Dizilimine tarafından hedef

The role of epigenetic processes in the control of gene expression has been known for a number of years. DNA methylation at cytosine residues is of ...

Amplification, Next-generation Sequencing, and Genomic DNA Mapping of Retroviral Integration Sites

Retroviruses exhibit signature integration preferences on both the local and global scales. Here, we present a detailed protocol for (1) generation of diverse libraries of retroviral integration sites using ligation-mediated PCR (LM-PCR) amplification and next-generation sequencing (NGS), (2) mapping the genomic location of each virus-host junction using BEDTools, and (3) analyzing the data for statistical relevance. Genomic DNA extracted from infected cells is fragmented by digestion with restriction enzymes or by sonication. After suitable DNA end-repair, double-stranded linkers are ligated onto the DNA ends, and semi-nested PCR is conducted using primers complementary to both the long terminal repeat (LTR) end of the virus and the ligated linker DNA. The PCR primers carry sequences required for DNA clustering during NGS, negating the requirement for separate adapter ligation. Quality control (QC) is conducted to assess DNA fragment size distribution and adapter DNA incorporation prior to NGS. Sequence output files are filtered for LTR-containing reads, and the sequences defining the LTR and the linker are cropped away. Trimmed host cell sequences are mapped to a reference genome using BLAT and are filtered for minimally 97% identity to a unique point in the reference genome. Unique integration sites are scrutinized for adjacent nucleotide (nt) sequence and distribution relative to various genomic features. Using this protocol, integration site libraries of high complexity can be constructed from genomic DNA in three days. The entire protocol that encompasses exogenous viral infection of susceptible tissue culture cells to integration site analysis can therefore be conducted in approximately one to two weeks. Recent applications of this technology pertain to longitudinal analysis of integration sites from HIV-infected patients.

We describe a protocol for amplifying retroviral integration sites from the genomic DNA of infected cells, sequencing the amplified virus-host junctions, and then mapping these sequences to a reference genome. We also describe techniques to quantify the distribution of integration sites relative to various genomic annotations using BEDTools.

Retroviral Entegrasyon Siteleri Amplifikasyon, Yeni Nesil Sıralama ve Genomik DNA Haritalama

Retroviruses exhibit signature integration preferences on both the local and global scales. Here, we present a detailed protocol for (1) generation of ...

Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization

There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information.

We describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs for characterization of bacterial communities using 16S rRNA gene amplicon sequencing. The method allows for a common processing approach for multiple sample types and accommodates a number of downstream analytic processes.

Bakteriyel Topluluk Karakterizasyonu Verimli Nükleik Asit Ekstraksiyonu ve 16S rRNA gen Sıralama

There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing ...

Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing

The human intestinal microbiome plays a central role in protecting cells from injury, in processing energy and nutrients, and in promoting immunity. Deviations from what is considered a healthy microbiota composition (dysbiosis) may impair vital functions leading to pathologic conditions. Recent and ongoing research efforts have been directed toward the characterization of associations between microbial composition and human health and disease.
Advances in high-throughput sequencing technologies enable characterization of the gut microbial composition. These methods include 16S rRNA-amplicon sequencing and shotgun sequencing. 16S rRNA-amplicon sequencing is used to profile taxonomical composition, while shotgun sequencing provides additional information about gene predictions and functional annotation. An advantage in using a targeted sequencing method of the 16S rRNA gene variable region is its substantially lower cost compared to shotgun sequencing. Sequence differences in the 16S rRNA gene are used as a microbial fingerprint to identify and quantify different taxa within an individual sample.
Major international efforts have enlisted standards for 16S rRNA-amplicon sequencing. However, several studies report a common source of variation caused by batch effect. To minimize this effect, uniformed protocols for sample collection, processing, and sequencing must be implemented. This protocol proposes the integration of broadly used protocols starting from fecal sample collection to data analyses. This protocol includes a column-free, direct-PCR approach that enables simultaneous handling and DNA extraction of large numbers of fecal samples, along with PCR amplification of the V4 region. In addition, the protocol describes the analysis pipeline and provides a script using the latest version of QIIME (QIIME 2 version 2017.7.0 and DADA2). This step-by-step protocol is aimed to guide those interested in initiating the use of 16S rRNA-amplicon sequencing in a robust, reproductive, easy to use, detailed way.

This manuscript describes a detailed standardized protocol of high-throughput 16S rRNA-amplicon sequencing. The protocol introduces an integrated, uniformed, feasible, and inexpensive protocol starting from fecal sample collection through data analyses. This protocol enables analysis of large numbers of samples with rigorous standards and several controls.

16S rRNA Amplicon sıralama tarafından dışkı mikrobiyal karakterizasyonu için rehberli iletişim kuralı

The human intestinal microbiome plays a central role in protecting cells from injury, in processing energy and nutrients, and in promoting immunity. ...

Microbiota Analysis Using Two-step PCR and Next-generation 16S rRNA Gene Sequencing

The human gut is colonized by trillions of bacteria that support physiologic functions such as food metabolism, energy harvesting, and regulation of the immune system. Perturbation of the healthy gut microbiome has been suggested to play a role in the development of inflammatory diseases, including multiple sclerosis (MS). Environmental and genetic factors can influence the composition of the microbiome; therefore, identification of microbial communities linked with a disease phenotype has become the first step towards defining the microbiome&#8217;s role in health and disease. Use of 16S rRNA metagenomic sequencing for profiling bacterial community has helped in advancing microbiome research. Despite its wide use, there is no uniform protocol for 16S rRNA-based taxonomic profiling analysis. Another limitation is the low resolution of taxonomic assignment due to technical difficulties such as smaller sequencing reads, as well as use of only forward (R1) reads in the final analysis due to low quality of reverse (R2) reads. There is need for a simplified method with high resolution to characterize bacterial diversity in a given biospecimen. Advancements in sequencing technology with the ability to sequence longer reads at high resolution have helped to overcome some of these challenges. Present sequencing technology combined with a publicly available metagenomic analysis pipeline such as R-based Divisive Amplicon Denoising Algorithm-2 (DADA2) has helped advance microbial profiling at high resolution, as DADA2 can assign sequence at the genus and species levels. Described here is a guide for performing bacterial profiling using two-step amplification of the V3-V4 region of the 16S rRNA gene, followed by analysis using freely available analysis tools (i.e., DADA2, Phyloseq, and METAGENassist). It is believed that this simple and complete workflow will serve as an excellent tool for researchers interested in performing microbiome profiling studies.

Described here is a simplified standard operating procedure for microbiome profiling using 16S rRNA metagenomic sequencing and analysis using freely available tools. This protocol will help researchers who are new to the microbiome field as well as those requiring updates on methods to achieve bacterial profiling at a higher resolution.

İki adımlı PCR ve Yeni Nesil 16S rRNA Gen Sıralaması Kullanarak Mikrobiyota Analizi

The human gut is colonized by trillions of bacteria that support physiologic functions such as food metabolism, energy harvesting, and regulation of the ...

16S rRNA Sequencing: A PCR-based Technique to Identify Bacterial Species

Source: Ewa Bukowska-Faniband1, Tilde Andersson1, Rolf Lood1 
1 Department of Clinical Sciences Lund, Division of Infection Medicine, Biomedical Center, Lund University, 221 00 Lund, Sweden
Planet Earth is a habitat for millions of bacterial species, each of which has specific characteristics. Identification of bacterial species is widely used in microbial ecology to determine biodiversity of environmental samples and medical microbiology to diagnose infected patients. Bacteria can be classified using conventional microbiology methods, such as microscopy, growth on specific media, biochemical and serological tests, and antibiotic sensitivity assays. In recent decades, molecular microbiology methods have revolutionized bacterial identification. A popular method is 16S ribosomal RNA (rRNA) gene sequencing. This method is not only faster and more accurate than conventional methods, but also allows identification of strains that are difficult to grow in laboratory conditions. Furthermore, differentiation of strains at the molecular level enables discrimination between phenotypically identical bacteria (1-4).
16S rRNA joins with a complex of 19 proteins to form a 30S subunit of the bacterial ribosome (5). It is encoded by the 16S rRNA gene, which is present and highly conserved in all bacteria due to its essential function in ribosome assembly; however, it also contains variable regions which may serve as fingerprints for particular species. These features have made the 16S rRNA gene an ideal genetic fragment to be used in identification, comparison, and phylogenetic classification of bacteria (6).
16S rRNA gene sequencing is based on the polymerase chain reaction (PCR) (7-8) followed by DNA sequencing (9). PCR is a molecular biology method used to amplify specific fragments of DNA through a series of cycles that include:
i) Denaturation of a double stranded DNA template 
ii) Annealing of primers (short oligonucleotides) that are complementary to the template 
iii) Extension of primers by the DNA polymerase enzyme, which synthesizes a new DNA strand
A schematic overview of the method is shown in Figure 1.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/10510/10510fig1.jpg" /> 
Figure 1: Schematic overview of the PCR reaction. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/10510/10510fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
There are several factors that are important for a successful PCR reaction, one of which is quality of the DNA template. Isolation of chromosomal DNA from bacteria can be performed using standard protocols or commercial kits. Special care should be taken to obtain DNA that is free of contaminants that can inhibit the PCR reaction.
Conserved regions of the 16S rRNA gene permit the design of universal primer pairs (one forward and one reverse) that can bind to and amplify the target region in any bacterial species. The target region can vary in size. While some primer pairs can amplify most of the 16S rRNA gene, others amplify only parts of it. Examples of commonly used primers are shown in Table 1 and their binding sites are depicted in Figure 2.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Primer name</td>
			<td>Sequence (5&#39;&#8594;3&#39;)</td>
			<td>Forward/ reverse</td>
			<td>Reference</td>
		</tr>
		<tr>
			<td>8F b)</td>
			<td>AGAGTTTGATCCTGGCTCAG</td>
			<td>forward</td>
			<td>-1</td>
		</tr>
		<tr>
			<td>27F</td>
			<td>AGAGTTTGATCMTGGCTCAG</td>
			<td>forward</td>
			<td>-10</td>
		</tr>
		<tr>
			<td>515F</td>
			<td>GTGCCAGCMGCCGCGGTAA</td>
			<td>forward</td>
			<td>-11</td>
		</tr>
		<tr>
			<td>911R</td>
			<td>GCCCCCGTCAATTCMTTTGA</td>
			<td>reverse</td>
			<td>-12</td>
		</tr>
		<tr>
			<td>1391R</td>
			<td>GACGGGCGGTGTGTRCA</td>
			<td>reverse</td>
			<td>-11</td>
		</tr>
		<tr>
			<td>1492R</td>
			<td>GGTTACCTTGTTACGACTT</td>
			<td>reverse</td>
			<td>-11</td>
		</tr>
	</tbody>
</table>
Table 1: Examples of standard oligonucleotides used in amplification of 16S rRNA genes a). 
a) The expected lengths of the PCR product generated using the different primer combinations can be estimated by calculating the distance between the binding sites for the forward and the reverse primer (see Figure 2), e.g. the size of the PCR product using primer pair 8F-1492R is ~1500 bp, and for primer pair 27F-911R ~900 bp. 
b) also known as fD1
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/10510/10510fig2.jpg" /> 
Figure 2: Representative figure of the 16S rRNA sequence and the primer-binding sites. Conserved regions are colored in grey and variable regions are filled with diagonal lines. To allow for the highest resolution, primer 8F and 1492R (name based on location on rRNA sequence) are used to amplify the whole sequence, allowing for the sequencing of several variable regions of the gene. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/10510/10510fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
Cycling conditions for PCR (i.e. the temperature and time required for the DNA to be denatured, annealed with primers, and synthesized) are dependent on the type of polymerase that is used and the properties of the primers. It is recommended to follow the manufacturer&#39;s guidelines for a particular polymerase.
After the PCR program is completed, the products are analyzed by agarose gel electrophoresis. A successful PCR yields a single band of expected size. The product must be purified prior to sequencing to remove residual primers, deoxyribonucleotides, polymerase, and buffer which were present in the PCR reaction. The purified DNA fragments are usually sent for sequencing to commercial sequencing services; however, some institutions perform DNA sequencing at their own core facilities.
The DNA sequence is automatically generated from a DNA chromatogram by a computer and must be carefully checked for quality, as manual editing is sometimes needed. Following this step, the gene sequence is compared with sequences deposited in the 16S rRNA database. The regions of similarity are identified, and the most similar sequences are delivered.

16S rRNA Sequencing: Identifying Bacterial Species by PCR

Source: Ewa Bukowska-Faniband1, Tilde Andersson1, Rolf Lood1
1 Department of Clinical Sciences Lund, Division of Infection Medicine, Biomedical Center, ...