Name: guided protocol for fecal microbial characterization by 16s rrna-amplicon sequencing
Uploaded: 2018-03-19T13:30:00.000+00:00
Duration: 8 min 5 s
Description: Watch this Scientific Journal Video about Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing at JoVE.com

Bu eser kısmen (No 41/11 verir)-CORE programı, İsrail Bilim Vakfı (grant No 908/15), Avrupa Crohn ve kolit organizasyon (ECCO) tarafından desteklenmiştir.

Etik onay çalışma için Sheba yerel araştırma Etik Komitesi tarafından kabul edildi ve tüm yöntemleri ilgili kurallara ve düzenlemelere uygun şekilde gerçekleştirilmiştir. İletişim kuralı bir hastanın rızası özel durum alınan yerel etik inceleme kurulu, kullanılan fekal madde beri zaten Mikrobiyoloji çekirdek klinik testleri ve yaş dışında hasta bilgilerinizi olmayan bir parçası olarak sunuldu toplumsal cinsiyet ve mikrobiyal sonuçları. Yazılı, aydınlatılmış onam sağlıklı gönüllülerden elde edildi ve kurumsal inceleme kurulu çalışma onayladı. Bu örnekleri bazıları zaten bir önceki analiz1' dahil ettik.
1. örnek işleme
<ol><li>Toplamak bir yaklaşık 5 mm2 smear (kabaca bir Silgi boyutunu) testinde steril bir bez ile taze bir dışkı örnekten tüp ( Tablo malzemelerigörmek). 24 saat içinde-80 ° C'de dışkı örnekleri içeren tüm temizleme bezi saklayın. Dışkı temizleme bezi daha fazla işleme kadar orada kalabilir.</li>
</ol>2. DNA ekstraksiyon
<ol><li>Oda sıcaklığında çıkarma ve seyreltme çözümleri çözülme ( Tablo malzemelerigörmek).</li>
	<li>Transferi dışkı çubukla bir boş 2 mL koleksiyonu içine tüp ( Tablo malzemelerigörmek). Pamuklu çubuk sopa boyutu kesim tarafından tüp kapatma minimum Çapraz bulaşma ile etkinleştirmek için temiz bir makas kullanarak ayarlayın. Ayıklama çözüm 250 μL dışkı çubukla ve girdap karışımı içeren her koleksiyon tüp ekleyin.</li>
	<li>Örnekleri 10 min kaynar su banyosu için ısı (95-100° C). Seyreltme çözüm 250 μL her örnek ve girdap karışımı ekleyin.</li>
	<li>Ayıklanan DNA ve 4 ° C'de çubukla içeren 2 mL tüpler depolamak</li>
</ol>3. PCR ve Kütüphane hazırlık
3.1 ve 3.2 adımlar için şablon ve amplicon ücretsiz ortam temiz, sağlayan bir PCR iş istasyonu içinde çalışır.
<ol><li>Astar (Tablo 1) göre onların barkod etiket. Çift Kişilik distile su (DDW) bir 50 mikron konsantrasyon ve mağaza-20 ° C'de her astar sulandırmak</li>
	<li>96-şey plaka PCR reaksiyonları için kullanın. Her plaka 32 farklı dizin astar tarafından etiketlenir 32 farklı örnekler içerebilir. İleri astar ve 32 ters astar oda sıcaklığında erimek ve onları için 5 mikron sulandırmak.</li>
	<li>PCR reaksiyon karışımları (her iyi son hacim 20 μl olacaktır) 100 reaksiyonlar için 5 mikron ileri astar, 1 mL 2 X PCR Master mix ve 400 μL DDW 100 μL karıştırarak hazırlayın. Bu PCR karışımı 15 μL her kuyuda (96 kuyu toplam) koymak. Her 5 mikron ters dizin oluşturulmuş astar 1 μL (32 farklı Astar boyaları triplicates verir toplam 96 Wells) 3 farklı wells için ekleyin.</li>
	<li>Pre-PCR adanmış bölgesinde reaksiyon karışımları için her ayıklanan DNA örneğinin 4 μL eklemek şablonu ve amplicon ücretsiz, temiz bir Bank anlamı (ayıklanan her DNA örneği nüsha güçlendirilmiş — 32 örnek / 96-şey plaka).</li>
	<li>PCR aşağıdaki ayarlarla çalıştırın: ilk denatürasyon 94 ° c 3 dakika; denatürasyon 94 ° C'de 35 döngüleri için 1 dk 1 dk ve uzantısı için 1 dk 72 ° C'de için 55 ° C'de tavlama, ardından; ve 10 dk 72 ° C'de son bir uzantısı.</li>
	<li>Bir post-PCR özel bölge olarak tanımlanacağını belirtiyor, farklı bir bankta bir tek birim tüp (örnek başına 60 μL) içine onaylatılacak her PCR reaksiyon birleştirin.</li>
	<li>PCR amplicons kalitesini değerlendirmek için üzerinde bir etidyum bromür lekeli % 1'özel jel her kombine-PCR reaksiyon 4 μL çalıştırın. Altında UV dalga boyu 260 nm, pozitif amplicons 375-425 bp beklenen grup boyutunda görüntülenir. Sadece bu amplicons sonraki adımda eklenecektir. Not: Her bir örneği her örnek içinde 3 farklı PCR reaksiyonları güçlendirilmiş onaylatılacak, anlamda güçlendirilmiş. Büyütmek değil.</li>
</ol>4. Kütüphane miktar ve Temizleme
<ol><li>Bir ekimolar toplama havuzu tüm PCR örnekleri almak için her amplicon bir çift iplikçikli DNA tarafından ölçmek (dsDNA ölçmek reaktif) floresan nükleik asit leke (bkz. Tablo reçetesi) geniş eşzamanlı miktar için uygun örnekleri miktarı. Not: amplicon boyutu aralığını belirsiz olduğu için nanogram gerçek tutarı ekimolar bir konsantrasyon yüklemek için kullanılır.</li>
	<li>Bir tek, steril tüp içine her örneğinin birleştirmek 500 ng. Girdap karıştırmak için.</li>
	<li>Havuza alınan Kütüphanesi 200 μL etidyum bromür lekeli % 1'özel jel üzerinde çalıştırın. Bir jel ekstraksiyon kiti üreticinin talimatlarına göre kullanarak jel 375-425 bp bantları ayıklamak ( Tablo malzemelerigörmek) ve havuza alınan kütüphanede 80 μL DDW elute. Not: Havuza alınan Kütüphane boyutu belirsiz amplifikasyon ürünleri ana bilgisayardan DNA azaltmak için seçili olmalıdır.</li>
	<li>Son derece hassas bir dsDNA kiti üreticinin talimatlarına göre algılama kullanarak son Kütüphane konsantrasyon ölçmek ( Tablo malzemelerigörmek). Üreticinin yönergelerine göre DNA kitaplıkları için son derece hassas bir ayrılık ve analiz kiti kullanarak doğru kitaplık boyutunu ölçmek ( Tablo malzemelerigörmek).</li>
</ol>5. sıralama
<ol><li>7 de % 20 Denetim Kitaplığı eklenmesi ile havuza alınan kitaplığına seyreltik (bkz. Tablo reçetesi) sıralama makine protokolüne göre.</li>
	<li>Sıralama için tasarlanmış kullanımı özel (bkz. Tablo 1) V4 amplifikasyon astar ücretsizdir astar okuyun.</li>
	<li>Ek bir barkoda okur kullanım üçüncü özel tasarlanmış sıralama astar (bkz. Tablo 1) döngüsü ve üreticinin belirtimlerine göre her yöne doğru uzunlukta eşleştirilmiş uç okuma 175 üslerinin oluşturur.</li>
	<li>Sıralama makine çalıştırabilir ve FASTQ dosyaları üreticinin protokolüne göre elde edilir.</li>
</ol>6. veri işleme
<ol><li>Birleştirmek ve QIIME 2 sürüm 2017.7.017uygulanan veri küratörlüğü potansiyel örtüşen eşleştirilmiş uç FASTQ dosyalarında işlem. Örnek belirli barkodlar göre okuma demultiplex.</li>
	<li>DADA218 kalite kontrol ve sıra varyant (SVs) algılaması için kullanabilir. Okuma 3' sonundan itibaren 13 üsleri ve 15 üsleri 5' uç, üzerinden atma ile 2'den fazla beklenen hataları okur kesecek. Belirlemek ve uzlaşma yöntemiyle chimeras kaldırmak — chimeras örnekleri ayrı ayrı algılanır ve örnekleri yeterli bir kısmını chimeric bulundu dizileri kaldırılır.</li>
	<li>SVs taksonomik sınıflandırma bir Naive Bayes donatılmış Sınıflandırıcısı kullanarak gerçekleştirmek, Ağustos 2013 eğitim % 99 kimliği Greengenes veritabanı6, 175 için uzun ayarla ileri/geri astar ve okur.</li>
	<li>2.146 dizileri derinliği için tüm örneklerini rarefy.</li>
	<li>Unweighted UniFrac β-çeşitlilik seyreltilmiş örnekleri (örnek çeşitlilik19,20) arası ölçüm için bir örnek boyutu etkisi önlemek için kullanın.</li>
	<li>Bir asıl koordinatları (PCoA) çözümlemesi için elde edilen mesafe matris kullanın. Not: Veri işleme komut dosyası ve eşleme dosyaları ek malzeme (ek malzeme 1 ve 2) sağlanır.</li>
</ol>

<ol>
	<li>Braun, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fecal+microbial+characterization+of+hospitalized+patients+with+suspected+infectious+diarrhea+shows+significant+dysbiosis.">Fecal microbial characterization of hospitalized patients with suspected infectious diarrhea shows significant dysbiosis.</a> Scientific Reports. 7, 1088 (2017).</li><li>De Filippo, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+diet+in+shaping+gut+microbiota+revealed+by+a+comparative+study+in+children+from+Europe+and+rural+Africa.">Impact of diet in shaping gut microbiota revealed by a comparative study in children from Europe and rural Africa.</a> Proceedings of the National Academy of Sciences of the United States of America. 107, 14691-14696 (2010).</li><li>Yatsunenko, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+gut+microbiome+viewed+across+age+and+geography.">Human gut microbiome viewed across age and geography.</a> Nature. 486, 222-227 (2012).</li><li>Rodriguez, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+composition+of+the+gut+microbiota+throughout+life,+with+an+emphasis+on+early+life.">The composition of the gut microbiota throughout life, with an emphasis on early life.</a> Microbial Ecology in Health and Disease. 26, 26050 (2015).</li><li>Turnbaugh, P. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+obesity-associated+gut+microbiome+with+increased+capacity+for+energy+harvest.">An obesity-associated gut microbiome with increased capacity for energy harvest.</a> Nature. 444, 1027-1031 (2006).</li><li>McDonald, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+improved+Greengenes+taxonomy+with+explicit+ranks+for+ecological+and+evolutionary+analyses+of+bacteria+and+archaea.">An improved Greengenes taxonomy with explicit ranks for ecological and evolutionary analyses of bacteria and archaea.</a> The ISME Journal. 6, 610-618 (2012).</li><li>Bakken, J. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Treating+Clostridium+difficile+infection+with+fecal+microbiota+transplantation.">Treating Clostridium difficile infection with fecal microbiota transplantation.</a> Clinical Gastroenterology and Hepatology. 9, 1044-1049 (2011).</li><li>Khoruts, A., Dicksved, J., Jansson, J. K., Sadowsky, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Changes+in+the+composition+of+the+human+fecal+microbiome+after+bacteriotherapy+for+recurrent+Clostridium+difficile-associated+diarrhea.">Changes in the composition of the human fecal microbiome after bacteriotherapy for recurrent Clostridium difficile-associated diarrhea.</a> Journal of Clinical Gastroenterology. 44, 354-360 (2010).</li><li>Nood, E. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Duodenal+infusion+of+donor+feces+for+recurrent+Clostridium+difficile.">Duodenal infusion of donor feces for recurrent Clostridium difficile.</a> The New England Journal of Medicine. 368, 407-415 (2013).</li><li>Koplan, J. P., Benfari Ferraro, M. J., Fineberg, H. V., Rosenberg, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Value+of+stool+cultures.">Value of stool cultures.</a> The Lancet. 316, 413-416 (1980).</li><li>Platts-Mills, J. A., Liu, J., Houpt, E. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+concepts+in+diagnostics+for+infectious+diarrhea.">New concepts in diagnostics for infectious diarrhea.</a> Mucosal Immunology. 6, 876-885 (2013).</li><li>Bokulich, N. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quality-filtering+vastly+improves+diversity+estimates+from+Illumina+amplicon+sequencing.">Quality-filtering vastly improves diversity estimates from Illumina amplicon sequencing.</a> Nature Methods. 10, 57-59 (2013).</li><li>Leek, J. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tackling+the+widespread+and+critical+impact+of+batch+effects+in+high-throughput+data.">Tackling the widespread and critical impact of batch effects in high-throughput data.</a> Nature Reviews Genetics. 11, (2010).</li><li>Dubilier, N., McFall-Ngai, M., Zhao, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Create+a+global+microbiome+effort.">Create a global microbiome effort.</a> Nature. 526, 631-634 (2015).</li><li>Caporaso, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+patterns+of+16S+rRNA+diversity+at+a+depth+of+millions+of+sequences+per+sample.">Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample.</a> PNAS. 108, 4516-4522 (2011).</li><li>Flores, G. E., Henley, J. B., Fierer, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+direct+PCR+approach+to+accelerate+analyses+of+human-associated+microbial+communities.">A direct PCR approach to accelerate analyses of human-associated microbial communities.</a> PloS One. 7, (2012).</li><li>Caporaso, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=QIIME+allows+analysis+of+high-throughput+community+sequencing+data.">QIIME allows analysis of high-throughput community sequencing data.</a> Nature Methods. 7, 335-336 (2010).</li><li>Callahan, B. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DADA2:+High-resolution+sample+inference+from+Illumina+amplicon+data.">DADA2: High-resolution sample inference from Illumina amplicon data.</a> Nature Methods. 13, 581-583 (2016).</li><li>Lozupone, C., Knight, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=UniFrac:+A+new+phylogenetic+method+for+comparing+microbial+communities.">UniFrac: A new phylogenetic method for comparing microbial communities.</a> Applied and Environmental Microbiology. 71, 8228-8235 (2005).</li><li>Lozupone, C., Lladser, M. E., Knights, D., Stombaugh, J., Knight, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=UniFrac:+An+effective+distance+metric+for+microbial+community+comparison.">UniFrac: An effective distance metric for microbial community comparison.</a> The ISME Journal. 5, 169-172 (2011).</li><li>Srinivasan, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+16S+rRNA+gene+for+identification+of+a+broad+range+of+clinically+relevant+bacterial+pathogens.">Use of 16S rRNA gene for identification of a broad range of clinically relevant bacterial pathogens.</a> PloS One. 10, e0117617 (2015).</li><li>Hiergeist, A., Gl&#228;sner, J., Reischl, U., Gessner, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analyses+of+intestinal+microbiota:+culture+versus+sequencing.">Analyses of intestinal microbiota: culture versus sequencing.</a> ILAR Journal. 56, 228-240 (2015).</li><li>Didelot, X., Bowden, R., Wilson, D. J., Peto, T. E. A., Crook, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transforming+clinical+microbiology+with+bacterial+genome+sequencing.">Transforming clinical microbiology with bacterial genome sequencing.</a> Nature Reviews Genetics. 13, 601-612 (2012).</li><li>Salipante, S. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+16S+rRNA+next-generation+sequencing+of+polymicrobial+clinical+samples+for+diagnosis+of+complex+bacterial+infections.">Rapid 16S rRNA next-generation sequencing of polymicrobial clinical samples for diagnosis of complex bacterial infections.</a> PloS One. 8, e65226 (2013).</li><li>Caporaso, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultra-high-throughput+microbial+community+analysis+on+the+Illumina+HiSeq+and+MiSeq+platforms.">Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms.</a> The ISME Journal. 6, 1621-1624 (2012).</li></ol>

Yazarlar ifşa gerek yok.

16s rRNA-amplicon ve metagenomics av tüfeği sıralamanın Klinik Mikrobiyoloji uygulamaları21,22,23popülerlik kazanmıştır. Bu teknikler artan yeteneklerini patojen inoculum ve yeteneklerini daha doğrusu bir polymicrobial bulaşıcı belirlemek için göreli bolluk hakkında veri sağlayan culturable ve culturable takson yakalamak için avantajlı olan 24parmak izi. Microbiome araştırma alanında gelişmeler çeşitli yaklaşımla...

Yoğun çabaları microbiome çeşitlilik ve bolluk, fark ve sağlıklı ve patolojik koşullarda bireyler arasındaki benzerlikler yakalamak bir diğer yönü olarak daha iyi anlamak için yapılmıştır. Yaş2,3, coğrafi konum4, yaşam tarzı5,6ve hastalık5 gut microbiome kompozisyon ile ilişkili olduğu gösterilmiştir, ancak birçok koşul ve nüfus henüz tam olarak henüz karakterize. Son zamanlarda microbiome için tedavi uygulamaları7,8,9değiştirilebilir bildirilmiştir. Bu nedenle, çeşitli fizyolojik şartlarda ve mikrobiyal kompozisyon ilişkisi içine ek fikir potansiyel gelecek değişiklikler duruma getirilmesi doğru ilk adımdır.
Geleneksel mikrobiyal kültür yöntemleri düşük verimleri10,11tarafından sınırlı olduğunu ve ikili bir devlet ya da nerede bir bakteri kavramsallaştırma gut ya da mevcut. Yüksek işlem hacmi DNA tabanlı sıralama mikrobiyal ekoloji, mikrobiyal toplumun tüm üyelerinin yakalama etkinleştirme devrim yarattı. Ancak, sıra uzunluğu ve kalite önemli engelleri doğru taksonomi atama12kalır okuyun. Ayrıca, yüksek üretilen iş tabanlı deneyler nerede ölçümleri biyolojik olmayan veya bilimsel olmayan değişkenler13tarafından etkilenen toplu etkileri muzdarip olabilir. Son yıllarda, çeşitli programlar insan microbiome Amerikan Gut proje, Amerika Birleşik Devletleri (ABD) insan Microbiome projesi ve Birleşik Krallık (UK) MetaHIT projesi de dahil olmak üzere, eğitim için kurulmuştur. Bu girişimler tutarlılık onların yaklaşımlar eksikliği nedeniyle kolayca karşılaştırılabilir değildir verileri oluşturmuş. Bazı bu sorunları14 yönelik olarak uluslararası insan Microbiome Konsorsiyumu, uluslararası insan Microbiome Standartları Projesi ve National Institute of Standards ve Technology (NIST) gibi uluslararası projeler çeşitli çalıştı ve geliştirilen güvenilir üreme sonuçlar ulaşılmasına izin vermesi gerekir microbiome ölçümleri için standartları. Burada açıklanan 16S rRNA yüksek üretilen iş (16S-seq) sıralama veri analizleri aracılığıyla dışkı örneği koleksiyonundan başlatmak için birkaç genel olarak kullanılan yöntemlerin15,16 entegre bir protokoldür. Bitki DNA16doğrudan çıkarma için tasarlanan bir sütun ücretsiz PCR yaklaşım, protokolünü açıklar, dışkı çok sayıda eşzamanlı işlemeyi etkinleştirmek IÇIN örnekleri nispeten kısa sürede yüksek kalitede DNA hedef için güçlendirilmiş mikrobiyal değişken V4 bölgenin ortak bir sıralama platformu üzerinde sıralanıyor. Bu iletişim kuralı bilim adamları sağlam, üreme, kullanımı kolay, detaylı bir şekilde 16S rRNA amplicon sıralaması kullanımına başlatılıyor baktılar önemli denetimlerini kullanma kılavuzu amaçlamaktadır. Bir rehber eşliğinde ve detaylı adım-tarafından adım protokolü olan toplu etkisini en aza indirmek ve böylece daha karşılaştırılabilir sıralama sonuçları labs arasında izin verir.

<table><tbody><tr><td>Primers</td><td>Integrated DNA Technologies (IDT)</td><td></td><td></td></tr><tr><td>Extraction solution</td><td>Sigma-Aldrich</td><td>E7526</td><td></td></tr><tr><td>Dilution solution</td><td>Sigma-Aldrich</td><td>D5688</td><td></td></tr><tr><td>Kapa HiFi HotStart ReadyMix PCR Kit</td><td>KAPABIOSYSTEMS</td><td>KK2601</td><td>PCR Master mix</td></tr><tr><td>Quant-iT PicoGreen dsDNA Reagent kit</td><td>Invitrogen</td><td>P7589</td><td>dsDNA quantify reagent</td></tr><tr><td>MinElute Gel extraction kit</td><td>Qiagen</td><td>28606</td><td></td></tr><tr><td>Agarose</td><td>Amresco</td><td>0710-250G</td><td></td></tr><tr><td>Ultra Pure Water Dnase and Rnase Free</td><td>Biological Industries</td><td>01-866-1A</td><td></td></tr><tr><td>Qubit dsDNA HS assay kit</td><td>Molecular probes</td><td>Q32854</td><td>dsDNA detecting kit</td></tr><tr><td>High Sensitivity D1000</td><td>Agilent Technologies</td><td>Screen Tape 5067-5582</td><td>separation and analysis</td></tr><tr><td>Screen Tape Assay</td><td>Agilent Technologies</td><td>Reagents 5067-5583</td><td>for DNA libraries</td></tr><tr><td>PhiX Control v3</td><td>Illumina</td><td>15017666</td><td>control library</td></tr><tr><td>MiSeq Reagent Kit v2 (500 cycle)</td><td>Illumina</td><td>MS-102-2003</td><td></td></tr><tr><td>Ethidium Bromide</td><td>Amresco</td><td>E406-10mL-TAM</td><td></td></tr><tr><td>2 mL collection tubes</td><td>SARSTEDT</td><td>72.695.400</td><td>Safe Seal collection tubes</td></tr><tr><td>Plastic stick swab in PP test tube</td><td>STERILE INTERIOR</td><td>23117</td><td></td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Comments&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;Equipment&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>PCR Machine</td><td>Applied Biosystems</td><td>2720 Thermal Cycler</td><td></td></tr><tr><td>Sequncing Machine</td><td>Illumina</td><td>Miseq</td><td></td></tr><tr><td>PCR workstation</td><td>Biosan</td><td>UV-cleaner</td><td></td></tr><tr><td>scissors</td><td></td><td></td><td></td></tr><tr><td>vortexer</td><td>Scientific Industries</td><td>Vortex-Genie 2</td><td></td></tr></tbody></table>

guided protocol for fecal microbial characterization by 16s rrna-amplicon sequencing

İnsan bağırsak microbiome hücreleri yaralanmalara karşı korumak, enerji ve besin işleme ve dokunulmazlık teşvik merkezi bir rol oynar. Sağlıklı microbiota kompozisyon (dysbiosis) olarak kabul edilir ne gelen sapmalar hayati fonksiyonları için patolojik koşulları önde gelen bozabilen. Son ve devam eden araştırma çabalarının mikrobiyal kompozisyon ve insan sağlığı ve hastalık arasındaki ilişkilendirmeleri karakterizasyonu doğru yönetmen var.
Yüksek işlem hacmi sıralama teknolojileri gelişmeler bağırsak mikrobiyal kompozisyon karakterizasyonu etkinleştirin. Bu yöntemler 16S rRNA amplicon sıralama ve av tüfeği sıralamanın içerir. 16s rRNA amplicon sıralama av tüfeği sıralama gen Öngörüler ve fonksiyonel ek açıklama hakkında ek bilgi sağlarken taxonomical kompozisyon, profil için kullanılır. 16S rRNA gen değişken bölge hedefli sıralama yöntemini kullanarak bir av tüfeği sıralama için karşılaştırıldığında önemli ölçüde daha düşük maliyet avantajdır. 16S rRNA gen farklılıkları sıra mikrobiyal parmak izi kadar tanımlamak ve farklı özellikleri tek tek bir örnek içinde ölçmek için kullanılır.
Büyük uluslararası çabalara 16S rRNA amplicon sıralama için standartlar kayıtlı. Ancak, çeşitli çalışmalarda ortak bir kaynaktan toplu etkisiyle neden varyasyon bildirin. Bu etki, üniformalı protokolleri için örnek koleksiyonu, en aza indirmek için işleme ve sıralamanın uygulanması gerekir. Bu iletişim kuralı veri analizleri için dışkı örneği koleksiyonundan başlayan genel olarak kullanılan protokolleri entegrasyonu öneriyor. Bu iletişim kuralını eşzamanlı kullanım ve DNA ekstraksiyon dışkı örnekleri, PCR güçlendirme V4 bölgesinin yanı sıra çok sayıda sağlar sütun-Alerjik, doğrudan-PCR yaklaşım içerir. Ayrıca, protokol analiz boru hattı açıklar ve QIIME (QIIME 2 yorum 2017.7.0 ve DADA2) en son sürümünü kullanarak bir komut dosyası sağlar. Adım adım bu protokolü ilgilenenler sağlam, üreme, kullanımı kolay ve ayrıntılı bir şekilde 16S rRNA amplicon sıralaması kullanımına başlatılıyor rehberlik etmek hedefleniyor.

Şematik Protokolü'nün şekil 1' de gösterilen.
Biz prospektif şüpheli bulaşıcı ishal ile yatan hastalardan dışkı örneği toplanmıştır. Yukarıda açıklanan1olduğu gibi bu örnekleri Sheba Tıp Merkezi Şubat ve Mayıs 2015 yılları arasında Klinik Mikrobiyoloji Lab sunuldu. Dışkı örneği Klinik Mikrobiyoloji laboratuarında gerçekleştirilen gelenekse...

Watch this Scientific Journal Video about Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing at JoVE.com

Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing

Bu el yazması yüksek üretilen iş 16S rRNA amplicon sıralama, detaylı bir standart protokolünü açıklar. Protokol dışkı örneği koleksiyonu veri analizleri ile başlayarak bir entegre, üniformalı, uygun ve ucuz protokol tanıttı. Bu protokol analiz örnekleri titiz standartları ile çok sayıda ve çeşitli denetimler sağlar.

16S rRNA Amplicon sıralama tarafından dışkı mikrobiyal karakterizasyonu için rehberli iletişim kuralı

The human intestinal microbiome plays a central role in protecting cells from injury, in processing energy and nutrients, and in promoting immunity. ...

guided-protocol-for-fecal-microbial-characterization-16s-rrna

Universidad de Cartagena UDEC

Research

JoVE Journal

Biology

19.5K Görüntüleme.  Sheba Medical Center. Bu el yazması yüksek üretilen iş 16S rRNA amplicon sıralama, detaylı bir standart protokolünü açıklar. Protokol dışkı örneği koleksiyonu veri analizleri ile başlayarak bir entegre, üniformalı, uygun ve ucuz protokol tanıttı. Bu protokol analiz örnekleri titiz standartları ile çok sayıda ve çeşitli denetimler sağlar.

Video: Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing

Exploring the Root Microbiome: Extracting Bacterial Community Data from the Soil, Rhizosphere, and Root Endosphere

The intimate interaction between plant host and associated microorganisms is crucial in determining plant fitness, and can foster improved tolerance to abiotic stresses and diseases. As the plant microbiome can be highly complex, low-cost, high-throughput methods such as amplicon-based sequencing of the 16S rRNA gene are often preferred for characterizing its microbial composition and diversity. However, the selection of appropriate methodology when conducting such experiments is critical for reducing biases that can make analysis and comparisons between samples and studies difficult. This protocol describes in detail a standardized methodology for the collection and extraction of DNA from soil, rhizosphere, and root samples. Additionally, we highlight a well-established 16S rRNA amplicon sequencing pipeline that allows for the exploration of the composition of bacterial communities in these samples, and can easily be adapted for other marker genes. This pipeline has been validated for a variety of plant species, including sorghum, maize, wheat, strawberry, and agave, and can help overcome issues associated with the contamination from plant organelles.

Here, we describe a protocol to obtain amplicon sequence data of soil, rhizosphere, and root endosphere microbiomes. This information can be used to investigate the composition and diversity of plant-associated microbial communities, and is suitable for the use with a wide range of plant species.

Kök Microbiome keşfetmek: toprak, rizosferde ve kök Endosphere bakteriyel topluluk verileri ayıklama

The intimate interaction between plant host and associated microorganisms is crucial in determining plant fitness, and can foster improved tolerance to ...

Genetik

Isolation, Propagation, and Identification of Bacterial Species with Hydrocarbon Metabolizing Properties from Aquatic Habitats

Hydrocarbon pollutants are recalcitrant to degradation and their accumulation in the environment is toxic to all life forms. Bacteria encode numerous catalytic enzymes and are naturally capable of metabolizing hydrocarbons. Scientists harness biodiversity in aquatic ecosystems to isolate bacteria with biodegradation and bioremediation potential. Such isolates from the environment provide a rich set of metabolic pathways and enzymes, which can be further utilized to scale up the degradation process at an industrial scale. In this article, we outline the general process of isolation, propagation, and identification of bacterial species from aquatic habitats and screen their ability to utilize hydrocarbons as the sole carbon source in vitro using simple techniques. The present protocol describes the isolation of various bacterial species and their subsequent identification using the 16S rRNA analysis. The protocol also presents steps for characterizing the hydrocarbon degrading potential of bacterial isolates. This protocol will be useful for researchers trying to isolate bacterial species from environmental habitats for their biotechnological applications.

We present the process of isolating, propagating, and characterizing hydrocarbon-degrading bacteria from aquatic habitats. The protocol outlines bacterial isolation, identification by the 16S rRNA method, and testing of their hydrocarbon-degrading potential. This article would help researchers in characterizing microbial biodiversity in environmental samples, and specifically screen for microbes with bioremediation potential.

Sucul Habitatlardan Hidrokarbon Metabolize Edici Özelliğe Sahip Bakteri Türlerinin İzolasyonu, Çoğaltılması ve Tanımlanması

Hydrocarbon pollutants are recalcitrant to degradation and their accumulation in the environment is toxic to all life forms. Bacteria encode numerous ...

Çevre

Applying Advanced In Vitro Culturing Technology to Study the Human Gut Microbiota

The human gut microbiota plays a vital role in both human health and disease. Studying the gut microbiota using an in vivo model, is difficult due to its complex nature, and its diverse association with mammalian components. The goal of this protocol is to culture the gut microbiota in vitro, which allows for the study of the gut microbiota dynamics, without having to consider the contribution of the mammalian milieu. Using in vitro culturing technology, the physiological conditions of the gastro intestinal tract are simulated, including parameters such as pH, temperature, anaerobiosis, and transit time. The intestinal surface of the colon is simulated by adding mucin-coated carriers, creating a mucosal phase, and adding further dimension. The gut microbiota is introduced by inoculating with the human fecal material. Upon inoculation with this complex mixture of bacteria, specific microbes are enriched in the different longitudinal (ascending, transverse and descending colons) and transversal (luminal and mucosal) environments of the in vitro model. It is crucial to allow the system to reach a steady state, in which the community and the metabolites produced remain stable. The experimental results in this manuscript demonstrate how the inoculated gut microbiota community develops into a stable community over time. Once steady state is achieved, the system can be used to analyze bacterial interactions and community functions or to test the effects of any additives on the gut microbiota, such as food, food components, or pharmaceuticals.

Here, we present a protocol for culturing the gut microbiota of the colon in vitro, using a series of bioreactors that simulate the physiological conditions of the gastro intestinal tract.

Uygulama gelişmiş teknoloji insan Gut Microbiota Eğitim Kültür Vitro

The human gut microbiota plays a vital role in both human health and disease. Studying the gut microbiota using an in vivo model, is difficult due to its ...

Biyomühendislik

An In Vitro Batch-culture Model to Estimate the Effects of Interventional Regimens on Human Fecal Microbiota

The emerging role of the gut microbiome in several human diseases demands a breakthrough of new tools, techniques and technologies. Such improvements are needed to decipher the utilization of microbiome modulators for human health benefits. However, the large-scale screening and optimization of modulators to validate microbiome modulation and predict related health benefits may be practically difficult due to the need for large number of animals and/or human subjects. To this end, in vitro or ex vivo models can facilitate preliminary screening of microbiome modulators. Herein, it is optimized and demonstrated an ex vivo fecal microbiota culture system that can be used for examining the effects of various interventions of gut microbiome modulators including probiotics, prebiotics and other food ingredients, aside from nutraceuticals and drugs, on the diversity and composition of the human gut microbiota. Inulin, one of the most widely studied prebiotic compounds and microbiome modulators, is used as an example here to examine its effect on the healthy fecal microbiota composition and its metabolic activities, such as fecal pH and the fecal levels of organic acids including lactate and short-chain fatty acids (SCFAs). The protocol may be useful for studies aimed at estimating the effects of different interventions of modulators on fecal microbiota profiles and at predicting their health impacts.

This protocol describes an in vitro batch-culture fermentation system of human fecal microbiota, using inulin (a well-known prebiotic and one of the most widely studied microbiota modulators) to demonstrate the use of this system in estimating effects of specific interventions on fecal microbiota composition and metabolic activities.

Bir In vitro Batch-kültür modeli ınsan dışkı microbiota üzerinde girişimsel rejimlerin etkilerini tahmin etmek

The emerging role of the gut microbiome in several human diseases demands a breakthrough of new tools, techniques and technologies. Such improvements are ...

İmmünoloji ve Enfeksiyon

Next-generation Sequencing of 16S Ribosomal RNA Gene Amplicons

One of the major questions in microbial ecology is &#8220;who is there?&#8221; This question can be answered using various tools, but one of the long-lasting gold standards is to sequence 16S ribosomal RNA (rRNA) gene amplicons generated by domain-level PCR reactions amplifying from genomic DNA. Traditionally, this was performed by cloning and Sanger (capillary electrophoresis) sequencing of PCR amplicons. The advent of next-generation sequencing has tremendously simplified and increased the sequencing depth for 16S rRNA gene sequencing. The introduction of benchtop sequencers now allows small labs to perform their 16S rRNA sequencing in-house in a matter of days. Here, an approach for 16S rRNA gene amplicon sequencing using a benchtop next-generation sequencer is detailed. The environmental DNA is first amplified by PCR using primers that contain sequencing adapters and barcodes. They are then coupled to spherical particles via emulsion PCR. The particles are loaded on a disposable chip and the chip is inserted in the sequencing machine after which the sequencing is performed. The sequences are retrieved in fastq format, filtered and the barcodes are used to establish the sample membership of the reads. The filtered and binned reads are then further analyzed using publically available tools. An example analysis where the reads were classified with a taxonomy-finding algorithm within the software package Mothur is given. The method outlined here is simple, inexpensive and straightforward and should help smaller labs to take advantage from the ongoing genomic revolution.

Characterizing microbial community has been a longstanding goal in environmental microbiology. Next-generation sequencing methods now allow for the characterization of microbial communities at an unprecedented depth with minimal cost and labor. We detail here our approach to sequence bacterial 16S ribosomal RNA genes using a benchtop sequencer.

16S Ribozomal RNA Gen amplikonlarının nesil Sıralama

One of the major questions in microbial ecology is &#8220;who is there?&#8221; This question can be answered using various tools, but one of the ...

Biyoloji

Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization

There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information.

We describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs for characterization of bacterial communities using 16S rRNA gene amplicon sequencing. The method allows for a common processing approach for multiple sample types and accommodates a number of downstream analytic processes.

Bakteriyel Topluluk Karakterizasyonu Verimli Nükleik Asit Ekstraksiyonu ve 16S rRNA gen Sıralama

There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing ...

Tick Microbiome Characterization by Next-Generation 16S rRNA Amplicon Sequencing

In recent decades, vector-borne diseases have re-emerged and expanded at alarming rates, causing considerable morbidity and mortality worldwide. Effective and widely available vaccines are lacking for a majority of these diseases, necessitating the development of novel disease mitigation strategies. To this end, a promising avenue of disease control involves targeting the vector microbiome, the community of microbes inhabiting the vector. The vector microbiome plays a pivotal role in pathogen dynamics, and manipulations of the microbiome have led to reduced vector abundance or pathogen transmission for a handful of vector-borne diseases. However, translating these findings into disease control applications requires a thorough understanding of vector microbial ecology, historically limited by insufficient technology in this field. The advent of next-generation sequencing approaches has enabled rapid, highly parallel sequencing of diverse microbial communities. Targeting the highly-conserved 16S rRNA gene has facilitated characterizations of microbes present within vectors under varying ecological and experimental conditions. This technique involves amplification of the 16S rRNA gene, sample barcoding via PCR, loading samples onto a flow cell for sequencing, and bioinformatics approaches to match sequence data with phylogenetic information. Species or genus-level identification for a high number of replicates can typically be achieved through this approach, thus circumventing challenges of low detection, resolution, and output from traditional culturing, microscopy, or histological staining techniques. Therefore, this method is well-suited for characterizing vector microbes under diverse conditions but cannot currently provide information on microbial function, location within the vector, or response to antibiotic treatment. Overall, 16S next-generation sequencing is a powerful technique for better understanding the identity and role of vector microbes in disease dynamics.

Here we present a next-generation sequencing protocol for 16S rRNA sequencing which enables identification and characterization of microbial communities within vectors. This method involves DNA extraction, amplification and barcoding of samples through PCR, sequencing on a flow-cell, and bioinformatics to match sequence data to phylogenetic information.

Kene Microbiome karakterizasyonu tarafından yeni nesil 16S rRNA Amplicon sıralama

In recent decades, vector-borne diseases have re-emerged and expanded at alarming rates, causing considerable morbidity and mortality worldwide. Effective ...

Microbiota Analysis Using Two-step PCR and Next-generation 16S rRNA Gene Sequencing

The human gut is colonized by trillions of bacteria that support physiologic functions such as food metabolism, energy harvesting, and regulation of the immune system. Perturbation of the healthy gut microbiome has been suggested to play a role in the development of inflammatory diseases, including multiple sclerosis (MS). Environmental and genetic factors can influence the composition of the microbiome; therefore, identification of microbial communities linked with a disease phenotype has become the first step towards defining the microbiome&#8217;s role in health and disease. Use of 16S rRNA metagenomic sequencing for profiling bacterial community has helped in advancing microbiome research. Despite its wide use, there is no uniform protocol for 16S rRNA-based taxonomic profiling analysis. Another limitation is the low resolution of taxonomic assignment due to technical difficulties such as smaller sequencing reads, as well as use of only forward (R1) reads in the final analysis due to low quality of reverse (R2) reads. There is need for a simplified method with high resolution to characterize bacterial diversity in a given biospecimen. Advancements in sequencing technology with the ability to sequence longer reads at high resolution have helped to overcome some of these challenges. Present sequencing technology combined with a publicly available metagenomic analysis pipeline such as R-based Divisive Amplicon Denoising Algorithm-2 (DADA2) has helped advance microbial profiling at high resolution, as DADA2 can assign sequence at the genus and species levels. Described here is a guide for performing bacterial profiling using two-step amplification of the V3-V4 region of the 16S rRNA gene, followed by analysis using freely available analysis tools (i.e., DADA2, Phyloseq, and METAGENassist). It is believed that this simple and complete workflow will serve as an excellent tool for researchers interested in performing microbiome profiling studies.

Described here is a simplified standard operating procedure for microbiome profiling using 16S rRNA metagenomic sequencing and analysis using freely available tools. This protocol will help researchers who are new to the microbiome field as well as those requiring updates on methods to achieve bacterial profiling at a higher resolution.

İki adımlı PCR ve Yeni Nesil 16S rRNA Gen Sıralaması Kullanarak Mikrobiyota Analizi

The human gut is colonized by trillions of bacteria that support physiologic functions such as food metabolism, energy harvesting, and regulation of the ...

Fecal Microbiota Transplantation and Detection of Prevalence of IgA-Coated Bacteria in the Gut

Gut microbiota exert pleiotropic roles in human health and disease. Fecal microbiota transplantation (FMT) is an effective method to investigate the biological function of intestinal bacteria as a whole or at the species level. Several different FMT methods have been published. Here, we present an FMT protocol that successfully depletes gut microbiota in a matter of days, followed by transplantation of fecal microbiota from fresh or frozen donor intestinal contents to conventional mice. Real time-PCR is applied to test the efficacy of bacterial depletion. Sequencing of the 16S ribosomal RNA (rRNA) is then applied to test the relative abundance and identity of gut microbiota in recipient mice. We also present a flow cytometry-based detection method of immunoglobulin A (IgA)-coated bacteria in the gut.

We established an efficient way to deplete intestinal bacteria in three days, and subsequently transplant fecal microbiota via gavage of fecal fluid prepared from fresh or frozen intestinal contents in mice. We also present an optimized method to detect the frequency of IgA-coated bacteria in the gut.

Gut microbiota exert pleiotropic roles in human health and disease. Fecal microbiota transplantation (FMT) is an effective method to investigate the ...

16S rRNA Sequencing: A PCR-based Technique to Identify Bacterial Species

Source: Ewa Bukowska-Faniband1, Tilde Andersson1, Rolf Lood1 
1 Department of Clinical Sciences Lund, Division of Infection Medicine, Biomedical Center, Lund University, 221 00 Lund, Sweden
Planet Earth is a habitat for millions of bacterial species, each of which has specific characteristics. Identification of bacterial species is widely used in microbial ecology to determine biodiversity of environmental samples and medical microbiology to diagnose infected patients. Bacteria can be classified using conventional microbiology methods, such as microscopy, growth on specific media, biochemical and serological tests, and antibiotic sensitivity assays. In recent decades, molecular microbiology methods have revolutionized bacterial identification. A popular method is 16S ribosomal RNA (rRNA) gene sequencing. This method is not only faster and more accurate than conventional methods, but also allows identification of strains that are difficult to grow in laboratory conditions. Furthermore, differentiation of strains at the molecular level enables discrimination between phenotypically identical bacteria (1-4).
16S rRNA joins with a complex of 19 proteins to form a 30S subunit of the bacterial ribosome (5). It is encoded by the 16S rRNA gene, which is present and highly conserved in all bacteria due to its essential function in ribosome assembly; however, it also contains variable regions which may serve as fingerprints for particular species. These features have made the 16S rRNA gene an ideal genetic fragment to be used in identification, comparison, and phylogenetic classification of bacteria (6).
16S rRNA gene sequencing is based on the polymerase chain reaction (PCR) (7-8) followed by DNA sequencing (9). PCR is a molecular biology method used to amplify specific fragments of DNA through a series of cycles that include:
i) Denaturation of a double stranded DNA template 
ii) Annealing of primers (short oligonucleotides) that are complementary to the template 
iii) Extension of primers by the DNA polymerase enzyme, which synthesizes a new DNA strand
A schematic overview of the method is shown in Figure 1.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/10510/10510fig1.jpg" /> 
Figure 1: Schematic overview of the PCR reaction. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/10510/10510fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
There are several factors that are important for a successful PCR reaction, one of which is quality of the DNA template. Isolation of chromosomal DNA from bacteria can be performed using standard protocols or commercial kits. Special care should be taken to obtain DNA that is free of contaminants that can inhibit the PCR reaction.
Conserved regions of the 16S rRNA gene permit the design of universal primer pairs (one forward and one reverse) that can bind to and amplify the target region in any bacterial species. The target region can vary in size. While some primer pairs can amplify most of the 16S rRNA gene, others amplify only parts of it. Examples of commonly used primers are shown in Table 1 and their binding sites are depicted in Figure 2.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Primer name</td>
			<td>Sequence (5&#39;&#8594;3&#39;)</td>
			<td>Forward/ reverse</td>
			<td>Reference</td>
		</tr>
		<tr>
			<td>8F b)</td>
			<td>AGAGTTTGATCCTGGCTCAG</td>
			<td>forward</td>
			<td>-1</td>
		</tr>
		<tr>
			<td>27F</td>
			<td>AGAGTTTGATCMTGGCTCAG</td>
			<td>forward</td>
			<td>-10</td>
		</tr>
		<tr>
			<td>515F</td>
			<td>GTGCCAGCMGCCGCGGTAA</td>
			<td>forward</td>
			<td>-11</td>
		</tr>
		<tr>
			<td>911R</td>
			<td>GCCCCCGTCAATTCMTTTGA</td>
			<td>reverse</td>
			<td>-12</td>
		</tr>
		<tr>
			<td>1391R</td>
			<td>GACGGGCGGTGTGTRCA</td>
			<td>reverse</td>
			<td>-11</td>
		</tr>
		<tr>
			<td>1492R</td>
			<td>GGTTACCTTGTTACGACTT</td>
			<td>reverse</td>
			<td>-11</td>
		</tr>
	</tbody>
</table>
Table 1: Examples of standard oligonucleotides used in amplification of 16S rRNA genes a). 
a) The expected lengths of the PCR product generated using the different primer combinations can be estimated by calculating the distance between the binding sites for the forward and the reverse primer (see Figure 2), e.g. the size of the PCR product using primer pair 8F-1492R is ~1500 bp, and for primer pair 27F-911R ~900 bp. 
b) also known as fD1
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/10510/10510fig2.jpg" /> 
Figure 2: Representative figure of the 16S rRNA sequence and the primer-binding sites. Conserved regions are colored in grey and variable regions are filled with diagonal lines. To allow for the highest resolution, primer 8F and 1492R (name based on location on rRNA sequence) are used to amplify the whole sequence, allowing for the sequencing of several variable regions of the gene. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/10510/10510fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
Cycling conditions for PCR (i.e. the temperature and time required for the DNA to be denatured, annealed with primers, and synthesized) are dependent on the type of polymerase that is used and the properties of the primers. It is recommended to follow the manufacturer&#39;s guidelines for a particular polymerase.
After the PCR program is completed, the products are analyzed by agarose gel electrophoresis. A successful PCR yields a single band of expected size. The product must be purified prior to sequencing to remove residual primers, deoxyribonucleotides, polymerase, and buffer which were present in the PCR reaction. The purified DNA fragments are usually sent for sequencing to commercial sequencing services; however, some institutions perform DNA sequencing at their own core facilities.
The DNA sequence is automatically generated from a DNA chromatogram by a computer and must be carefully checked for quality, as manual editing is sometimes needed. Following this step, the gene sequence is compared with sequences deposited in the 16S rRNA database. The regions of similarity are identified, and the most similar sequences are delivered.

16S rRNA Sequencing: Identifying Bacterial Species by PCR

Source: Ewa Bukowska-Faniband1, Tilde Andersson1, Rolf Lood1
1 Department of Clinical Sciences Lund, Division of Infection Medicine, Biomedical Center, ...