Name: phage-mediated delivery of targeted srna constructs to knock down gene expression in e. coli
Uploaded: 2016-03-20T14:00:00.000+00:00
Duration: 8 min 25 s
Description: Watch this Scientific Journal Video about Phage-mediated Delivery of Targeted sRNA Constructs to Knock Down Gene Expression in E. coli at JoVE.com

Bu iş için fon Paris Bettencourt iGEM takımı destek Fondation Bettencourt Schueller tarafından sağlandı. Biz teknik yardım ve tavsiye için İNSERM U1001 araştırma ünitesi ve Chantal Lotton teşekkür ederiz. Fajmid Litmus28i_J23115-B0032-GFP Monica Ortiz ve Stanford Drew Endy tarafından sağlandı.

Srna Susturulması kasetler Rulman 1. Tasarım ve İnşaat Fajemid Vektörler <ol><li> Srna Susturulması Kasetler 8 De Novo Tasarımı <ol><li> mRNA tam dizi bir DNA dizisi veritabanı kullanılarak susturulması tespit edilir. Hedef sekans oluşturmak için, bir başlangıç ​​kodonu (örneğin, ATG) ile başlayan pozisyonda +1 +24, kodlama dizisinin ilk 24 bp not edin. Not: diğer siteler veya mRNA kesimleri 8 hedeflenen zaman suskunluğu daha az verimlidir. </li><li> Srna kaset için KILAVUZU dizisi üretmek için HEDEF dizisinin ters tamamlayıcı alın. Kloramfenikol asetiltransferaz (CAT) için HEDEF ve REHBER dizilerinin örnekleri için Tablo 1&#39;e bakınız. </li><li> 292 bp&#39;lik tam Srna sentezleme kasetini tasarlamak için, seri pR promotör, rehber sekans, Hfq protein bağlayıcı etki alanı ve T1 / TE kopyalama sonlandırıcı dizileri içerir (Tablo 2) yerleştirin. </li><li> Hedef vektörüne Srna kasetinin klonlanmasını kolaylaştırmak için seçimin diğer bir klonlama siteleri ekleyin. </li><li> Ticari gen sentezi veya benzer bir yöntemle tam Srna kasetini edinin ve işlevsel bir f1 replikasyon orijini 11 ile herhangi bir fajemid vektörü içine klonlamak. Nihai fajmid vektörü tam dizisi için Yardımcı Bilgiler bakın. </li></ol></li><li> PCR tabanlı site Yönlendirilmiş Mutagenezler 12 kullanarak Varolan Srna İfade Kaset tarafından Hedeflenen sırası değiştirilmesi <ol><li> Mevcut bir Srna ekspresyon kaseti 24 bp&#39;lik rehber sekans tanımlama. Not: Bu çalışmada kullanılan açıklamalı pAB.001 plazmid, tamamlayıcı dizi dosyası olarak kullanılabilir. </li><li> Tasarım ileri ve yeni 24 bp KILAVUZU dizisini kuşatan mevcut Srna kasetine homoloji kısa bölgeleri ile primerler ters. Ticari oligonükleotid sentezi yoluyla primerler elde edilir. Not: yer yönelimli mutajenez için geliştirilmiş primer tasarımı depic olanted Şekil 2&#39;de tam astar şablon sekansların, Tablo 3&#39;te verilmiştir. </li><li> E. 5 ml&#39;lik bir kültürden hazırlanması E. coli şablonu Srna sentezleme fajmid yapılması. uygun antibiyotikler ile LB ortamında, çalkalanarak 37 ° C&#39;de gece boyunca hücre büyütün. </li><li> Özü ve bir DNA miniprep kiti ya da benzer bir yöntem 12 ile 5 ml bakteri kültüründen şablon Srna ifade fajmid arındırmak. </li><li> Şablon Srna sentezleme fajmid ve yüksek kalitede polimeraz ileri ile bir ve ters primer (Tablo 4) birini kullanarak iki PCR reaksiyonları hazırlayın. Polimeraz ile ilgili (Tablo 5) tarafından tavsiye edildiği gibi PCR koşulları kullanarak. Tek astar reaksiyon üstel amplifikasyon üretmek değil gerçeği açıklamak için bir standart reaksiyonu daha yüksek 10-50x şablon konsantrasyonu artırır. </li><li> Bir mikrosantrifüj tüp içinde iki yukarıdaki PCR reaksiyonları birleştirin. AnneaL, bir kaynar su banyosu içinde 98 ° C&#39;de ısıtılarak ürünleri. Hemen su banyosuna mikrosantrifüj tüpü yerleştirdikten sonra, ısı kaynağı çıkarın ve banyo yavaş 1-2 saat boyunca oda sıcaklığına dönmesi için izin verir. </li><li> 1 ul, mutasyona uğramamış şablonu Srna sentezleme fajmid ortadan kaldırmak için. Karışıma DpnI sınır enzimi ve 1 saat, ya da tam sindirim için üretici tarafından önerilen bir süre için 37 ° C&#39;de inkübe edin. Not: DpnI PCR ürünleri ana çoğaltılmış fajmidler mevcut değil sadece metillenmiş hedef sitesi, sindirir. </li><li> Satın alınan veya 13 kimyasal yetkili E. hazırlanmış Transform tavlanmış PCR ürünü 1-5 ul E. coli. Uygun antibiyotik içeren LB agar plakaları üzerinde seçici bir kaplama ile transforme soyun tek koloniler izole edin. </li><li> Doğru KILAVUZU dizisinin katılmasını doğrulamak için, koloni PCR ile elde edilen koloniler ekran. 200 ul bir pipet kullanılarak, COTek bir dönüştürülmüş koloniden küçük bir hücre miktarı llect. Mark ve doğrulamadan sonra aşağı kullanım için özgün koloni korumak. </li><li> mikrosantrifüj tüpü içinde nükleaz içermeyen su, 50 ul toplanan hücreler ekleyin. Yukarı ve aşağı pipetleme karıştırın. </li><li> bir tezgah üstü PCR ya da kaynar su banyosu kullanılarak, 2 dakika boyunca 95 ° C&#39;ye kadar ısıtılarak hücrelerin lize. </li><li> DNA şablonu olarak ısı ile lize edilmiş hücrelerden 1 ul kullanılarak fajmid bölge PCR ile amplifiye. PCR koşulları ve PCR protokolleri Tablo 6 ve 7&#39;de verilmiştir. Doğrulama astar dizileri için ek pAB.001 dizisi dosyasına bakın. </li><li> Doğru KILAVUZU dizisinin katılmasını doğrulamak için PCR ürünü sırası. </li><li> E. 5 ml&#39;lik bir kültürü inoküle dizisi doğrulanmış Srna ifade fajmid taşıyan E. coli klonu. Seçici LB ortamında, çalkalanarak 37 ° C&#39;de gece boyunca hücre büyütün. </li><li> Bir gliserol stok hazırlayındizisi doğrulanmış klonu. vida kapaklı bir kriyo tüpüne içinde% 60 gliserol, 250 ul, gece boyunca kültürün 750 ul ekle. </li><li> belirsiz bir süre -80 ° C&#39;de gliserol stokları saklayın. gece boyunca kültür kalan aşama 2&#39;de Srna sentezleme fajmid için bir kaynak olarak kullanılabilmektedir. </li></ol></li></ol> M13-paketlenmiş Fajemid Stoklar 2. Üretim ve Hasat <ol><li> E. 5 ml&#39;lik bir kültürden hazırlanması E. coli Srna sentezleme fajmid yapılması. uygun antibiyotikler ile LB ortamında, çalkalanarak 37 ° C&#39;de gece boyunca hücre büyütün. Not: Srna sentezleme fajemid aşama 1.1.5 de tarif edildiği gibi de novo klonlama yoluyla elde edilen, ya da tadil edilmiş olan bir fajmid gelen ve aşama 1.2.16 hasat edilebilir. </li><li> Benzer şekilde E. 5 ml&#39;lik bir kültür hazırlamak E. coli M13KO7 yardımcı plazmid taşıyan. Seçici LB ortamında, çalkalanarak 37 ° C&#39;de gece boyunca hücre büyütün. </li><li> Özü ve Srna expressio arındırmakn fagemit ve DNA ekstraksiyon kiti ya da benzer bir yöntem 12 ile yardımcı plazmid. </li><li> Cotransform satın alınabilir ya da 1 ul Srna sentezleme fajmid ve yardımcı plazmidin her biri ile 13 kimyasal olarak E. coli hazırlandı. Her iki yapı için seçici antibiyotik LB agar kaplama ile cotransformants için seçilir. </li><li> Seçici antibiyotiklerle LB birlikte dönüşmüş soyun tek bir koloni 10 ml kültür hazırlayın. 8-12 saat veya gece boyunca çalkalama ile 37 ° C&#39;de inkübe edin. </li><li> 10 dakika boyunca 3300 x g&#39;de kültürü santrifüj. 0.2 um&#39;lik bir filtreden süpernatan ve filtre toplayın. Dikkat: Medya sızıntısı durumunda, enfektif faj partikülleri yok etmek için seyreltilmiş çamaşır suyu (% 0.5) ile bölgeyi temizleyin. </li><li> 4 ° C &#39;de paketlenmiş fagemit Filtrat saklayın. Not: Örnekler aktivite kaybı olmadan günler, haftalar boyunca muhafaza edilebilir. </li></ol> Bayan + Hedef Hücreler 3. hazırlanması susturmak için <ol><li> Susturmak için hedeflenecek hücreleri F pilusun 14 ifade olmadığını belirleyin. F pilus zaten varsa, 4. adıma geçin. Not: E., olağan laboratuar suşları E. coli genomları ya da bir plasmid F pilus varlığını göstermek için F + ya da F &quot;olarak açıklanmış bulunmaktadır. </li><li> E. F + suşu elde edilir E. coli gibi TOP10F olarak &#39;. Not: Hedef streyn konjugasyondan sonra F-plazmid donörden ayrılması için benzersiz bir direnç işaretleyicisi taşıyan emin olun. </li><li> Bir F + suşu ile konjugasyon F pilusun tanıtmak için, hedef zorlanma ve F-plazmid donör 14 hem 5 ml kültür hazırlayın. uygun antibiyotikler ile LB ortamında, çalkalanarak 37 ° C&#39;de gece boyunca hücre büyütün. </li><li> Ertesi gün, her iki soy 1 seyreltilmiş 100 seçici LB 5 ml ve çalkalanarak 37 ° C&#39;de kültürlenmesini devam etmektedir. </li><li> opt ölçerek hücrelerin büyüme fazı belirlemebir tezgah üstü spektrofotometre kullanılarak 600 nm (OD 600) de kültür iCal&#39;ın yoğunluğu. Kültür 0.3 OD 600 kadar, yaklaşık 2 saat boyunca hücrelerin log-faz büyümesini 15 işaret sağlanır. </li><li> mikrosantrifüj tüpleri içinde 3 konjugasyon reaksiyonları hazırlayın: 0.5 mi, F-plazmid verici + 0.5 mi, hedef soyu, 0.5 mi, F-plazmid verici + 0.5 mi LB ortamı (negatif kontrol) ve 0.5 mi, hedef soyu + 0.5 mi LB ortamı (negatif kontrol). çekimi çalkalanarak 37 ° C&#39;de 2 saat devam etmesine izin verir. </li><li> Plaka F-plazmid özgü antibiyotik (genellikle tetrasiklin) ve hedef suşu ile seçici LB agar her konjugasyon reaksiyon 100 ul. ne alıcı veya verici suş hem antibiyotik dirençleri ifade onaylamak için negatif kontrol reaksiyonları Plate. </li></ol> Susturma ambalajlı fajmidler 4. Enfeksiyon <ol><li> LB Medi 5 ml&#39;lik bir kültür haline F + hedef hücrelerin tek bir koloni İnokülasyonUygun antibiyotik ile. çalkalanarak 37 ° C&#39;de gece boyunca inkübe edilir. </li><li> Ertesi gün, K + hedef hücreler 1 seyreltin: 100 seçici LB ortamı 5 ml ve çalkalanarak 37 ° C&#39;de kültüre devam etmektedir. </li><li> Bir tezgah üstü spektrofotometre kullanılarak 600 nm (OD 600) de, kültürün optik yoğunluğu ölçülerek hücre büyüme fazı belirler. Kültür 0.3 OD 600 kadar, yaklaşık 2 saat boyunca hücrelerin log-faz büyümesini 15 işaret sağlanır. Not: F pilus ve enfeksiyon verimliliği ifade log fazında yüksektir. </li><li> Hedef nüfusunun yaklaşık% 99 enfeksiyon elde etmek için 1: 100 arasında bir hacim oranında hedef hücrelere (adım 2.6) M 13 paketlenmiş fajmidleri ekleyin. Enfeksiyon, 30-60 dakika çalkalanarak 37 ° C&#39;de devam etmek için izin verin. </li><li> seçim yöntemine göre Srna sessizleştirme fenotip deneyi. Not: Bir floresan protein hedefi için, susturma etkisi belirlenebilirdoğrudan fluorometri 10 tarafından. Alternatif olarak, fenotipik deneyler gen yok etme 8 fenotipik sonuçlarını gözlemlemek için kullanılabilir. </li><li> adımlar 1.2.14-1.2.16 aşağıdaki Srna ifade eden fagemit konak için bir gliserol stok hazırlayın. Not: fagemit süresiz konakçı suşunda yayılması ve geleneksel bir plazmid antibiyotik benzeri bir muhafaza edilebilir. </li></ol>

<ol>
	<li>Ohkumo, T., Masutani, C., Eki, T., Hanaoka, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+RNAi+in+C.+elegans.">Use of RNAi in C. elegans.</a> RNAi. , 129-137 (2008).</li><li>Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A., Driver, S. E., Mello, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potent+and+specific+genetic+interference+by+double-stranded+RNA+in+Caenorhabditis+elegans.">Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans.</a> Nature. 391 (6669), 806-811 (1998).</li><li>Iordanou, E., Chandran, R. R., Blackstone, N., Jiang, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi+interference+by+dsRNA+injection+into+Drosophila+embryos.">RNAi interference by dsRNA injection into Drosophila embryos.</a> J Vis Exp. (50), e2477 (2011).</li><li>Ramadan, N., Flockhart, I., Booker, M., Perrimon, N., Mathey-Prevot, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design+and+implementation+of+high-throughput+RNAi+screens+in+cultured+Drosophila+cells.">Design and implementation of high-throughput RNAi screens in cultured Drosophila cells.</a> Nat Protoc. 2 (9), 2245-2264 (2007).</li><li>Tsong, T. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electroporation+of+cell+membranes.">Electroporation of cell membranes.</a> Biophys J. 60 (2), 297-306 (1991).</li><li>Kim, W. J., Chang, C. -. W., Lee, M., Kim, S. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+siRNA+delivery+using+water+soluble+lipopolymer+for+anti-angiogenic+gene+therapy.">Efficient siRNA delivery using water soluble lipopolymer for anti-angiogenic gene therapy.</a> J Control Release. 118 (3), 357-363 (2007).</li><li>Shi, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mammalian+RNAi+for+the+masses.">Mammalian RNAi for the masses.</a> Trends Genet. 19 (1), 9-12 (2003).</li><li>Na, D., Yoo, S. M., Chung, H., Park, H., Park, J. H., Lee, S. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metabolic+engineering+of+Escherichia+coli+using+synthetic+small+regulatory+RNAs.">Metabolic engineering of Escherichia coli using synthetic small regulatory RNAs.</a> Nat Biotechnol. 31 (2), 170-174 (2013).</li><li>Ceroni, F., Algar, R., Stan, G. -. B., Ellis, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantifying+cellular+capacity+identifies+gene+expression+designs+with+reduced+burden.">Quantifying cellular capacity identifies gene expression designs with reduced burden.</a> Nat Methods. 12 (5), 415-418 (2015).</li><li>Libis, V. K., Bernheim, A. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silencing+of+Antibiotic+Resistance+in+E.+coli+with+Engineered+Phage+Bearing+Small+Regulatory+RNAs.">Silencing of Antibiotic Resistance in E. coli with Engineered Phage Bearing Small Regulatory RNAs.</a> ACS Synth Biol. 3 (12), 1003-1006 (2014).</li><li>Ortiz, M. E., Endy, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineered+cell-cell+communication+via+DNA+messaging.">Engineered cell-cell communication via DNA messaging.</a> J Biol Eng. 6 (1), 16 (2012).</li><li>Edelheit, O., Hanukoglu, A., Hanukoglu, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simple+and+efficient+site-directed+mutagenesis+using+two+single-primer+reactions+in+parallel+to+generate+mutants+for+protein+structure-function+studies.">Simple and efficient site-directed mutagenesis using two single-primer reactions in parallel to generate mutants for protein structure-function studies.</a> BMC Biotechnol. 9 (1), 61 (2009).</li><li>Chung, C. T., Miller, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+and+storage+of+competent+Escherichia+coli+cells.">Preparation and storage of competent Escherichia coli cells.</a> Recombinant DNA Part I. , 621-627 (1993).</li><li>Phornphisutthimas, S., Thamchaipenet, A., Panijpan, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Conjugation+in+Escherichia+coli.">Conjugation in Escherichia coli.</a> Biochem Mol Biol Educ. 35 (6), 440-445 (2007).</li><li>Sezonov, G., Joseleau-Petit, D., D'Ari, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Escherichia+coli+Physiology+in+Luria-Bertani+Broth.">Escherichia coli Physiology in Luria-Bertani Broth.</a> J Bacteriol. 189 (23), 8746-8749 (2007).</li><li>Mittal, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improving+the+efficiency+of+RNA+interference+in+mammals.">Improving the efficiency of RNA interference in mammals.</a> Nat Rev Genet. 5 (5), 355-365 (2004).</li><li>Qi, L. S., Larson, M. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Repurposing+CRISPR+as+an+RNA-guided+platform+for+sequence-specific+control+of+gene+expression.">Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression.</a> Cell. 152 (5), 1173-1183 (2013).</li><li>Lu, T. K., Collins, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dispersing+biofilms+with+engineered+enzymatic+bacteriophage.">Dispersing biofilms with engineered enzymatic bacteriophage.</a> Proc Natl Acad Sci USA. 104 (27), 11197-11202 (2007).</li><li>Yosef, I., Manor, M., Kiro, R., Qimron, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Temperate+and+lytic+bacteriophages+programmed+to+sensitize+and+kill+antibiotic-resistant+bacteria.">Temperate and lytic bacteriophages programmed to sensitize and kill antibiotic-resistant bacteria.</a> Proc Natl Acad Sci USA. 112 (23), 7267-7272 (2015).</li><li>Karlsson, F., Malmborg-Hager, A. -. C., Albrekt, A. -. S., Borrebaeck, C. A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+comparison+of+phage+M13-infected+vs.+uninfected+Escherichia+coli.">Genome-wide comparison of phage M13-infected vs. uninfected Escherichia coli.</a> Can J Microbiol. 51 (1), 29-35 (2005).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Caveat+of+RNAi+in+plants:+the+off-target+effect.">Caveat of RNAi in plants: the off-target effect.</a> Methods in molecular biology. 744, 13-25 (2011).</li><li>Jackson, A. L., Linsley, P. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recognizing+and+avoiding+siRNA+off-target+effects+for+target+identification+and+therapeutic+application.">Recognizing and avoiding siRNA off-target effects for target identification and therapeutic application.</a> Nat Rev Drug Discov. 9 (1), 57-67 (2010).</li><li>Cho, S. W., Kim, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+off-target+effects+of+CRISPR/Cas-derived+RNA-guided+endonucleases+and+nickases.">Analysis of off-target effects of CRISPR/Cas-derived RNA-guided endonucleases and nickases.</a> Genome Res. 24 (1), 132-141 (2014).</li><li>Hagens, S., Blasi, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetically+modified+filamentous+phage+as+bactericidal+agents:+a+pilot+study.">Genetically modified filamentous phage as bactericidal agents: a pilot study.</a> Lett Appl Microbiol. 37 (4), 318-323 (2003).</li><li>Kasman, L. M., Kasman, A., Westwater, C., Dolan, J., Schmidt, M. G., Norris, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overcoming+the+phage+replication+threshold:+a+mathematical+model+with+implications+for+phage+therapy.">Overcoming the phage replication threshold: a mathematical model with implications for phage therapy.</a> J Virol. 76 (11), 5557-5564 (2002).</li><li>Chasteen, L., Ayriss, J., Pavlik, P., Bradbury, A. R. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Eliminating+helper+phage+from+phage+display.">Eliminating helper phage from phage display.</a> Nucleic Acids Res. 34 (21), e145 (2006).</li><li>Lu, T. K., Collins, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineered+bacteriophage+targeting+gene+networks+as+adjuvants+for+antibiotic+therapy.">Engineered bacteriophage targeting gene networks as adjuvants for antibiotic therapy.</a> Proc Natl Acad Sci USA. 106 (12), 4629-4634 (2009).</li><li>Bikard, D., Jiang, W., Samai, P., Hochschild, A., Zhang, F., Marraffini, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Programmable+repression+and+activation+of+bacterial+gene+expression+using+an+engineered+CRISPR-Cas+system.">Programmable repression and activation of bacterial gene expression using an engineered CRISPR-Cas system.</a> Nucleic Acids Res. 41 (15), 7429-7437 (2013).</li></ol>

The authors have nothing to disclose.

Mevcut metot hedefsiz kontrollerle karşılaştırıldığında mKate floresan seviyelerinde% 80 azalma sağlanmıştır. Bu komple susturma gözlenmemiştir ve% 50-90 verim 16,17 tipik başka RNA demonte yöntemleri ile uyumludur. fenotipik düzeyde, CAT-hedefli knockdowns anlamlı kloramfenikol direnci zayıflatır ve bazı şartlar altında onu ortadan kaldırmak için başardık. Demonte fenotip sadece birkaç saat sonrası enfeksiyon (Şekil 3B) sonra nüfus düzeyinde saptanabilir oldu. Bu faj tabanlı bir teslim önemli bir özellik gösterilmiştir: yüksek yok etme frekansı önceden genetik modifikasyon kesikli kültürde doğrudan elde edilebilir. Plazmid dönüşüme veya genomik entegrasyon kullanılarak geleneksel genetik modifikasyon farklı faj enfeksiyonu nüfus tek bir izole koloniden yeniden yetiştirilebilir gerektirmez. Bu faj enfeksiyonun etkileri Explor olmasını sağlar18 ya da genetik olarak karışık doğal nüfus 19 biyofilm gibi önceden var olan mekansal yapıları ile karmaşık mekansal dinamikleri 11 ile popülasyonlarında ed. Bu yöntemde kritik bir safha, yüksek titrede paketlenmiş fajmid üretimidir. faj parçacığı üretimi ile ilişkili metabolik yükü fajemid üretim familyasından mutasyon ya da plazmid kaybı yüksek oranda neden olabilir. Fagemit üretim suşu tek bir birlikte dönüşmüş koloniden doğrudan kültüre ve buzdolabında değil, dondurulmuş veya faj hasat öncesinde alt kültüre edilmesi tavsiye edilir. E. fagemit ve yardımcı plazmit sokulması sırasında eş-dönüşüm düşük verimliliği de gözlenebilir Aynı anda E. coli. Bu durumda, daha yüksek verim, daha sonra ilk olarak bir yardımcı plazmid transforme fajmid ile müteakip transformasyonu için yardımcı plasmidi taşıyan yetkin hücrelerin hazırlanması ile elde edilebilir. Phagemid enfeksiyon veya Srna sentezleme aynı zamanda, hedef hücreler üzerinde saptanabilir bir metabolik yük getirir ve bazı fenotipik pertürbasyon neden olabilir. Hücreler fagemit hedefleme CAT (Şekil 3) ile enfekte edilmiştir, örneğin, mKate2 floresan bir azalma da gözlenmiştir. M13 ile Enfeksiyon E. sistemik stres tepkileri tetiklemek için düşünce değil coli 20, ama dolaylı olarak transkripsiyonel desenleri değiştirebilir. Alternatif olarak, fajmid dahil GFP veya ampisilin direnç işaretçileri mKate2 ifade ve büyümeyi 9 azaltarak, hücresel kaynaklar için rekabet edebilir. Son olarak, Srna kaset kendisi küresel Hfq proteinini titre edilerek gen ekspresyon profillerini değiştirmek, ya da off-hedef mRNA susturma yoluyla olabilir. Kapalı hedef etkileri in vivo RNAi 21-23 hedefleyen yaygındır, ancak sistematik bu sistem için araştırılmalıdır henüz. Bu yöntemin bir sınırlama olduğu enfeksiyonun ka olduğuVerimliliği olmayan bazı enfekte olmuş bakteri popülasyonunda korunmasına izin az% 100&#39;dür. Bu çalışma ve daha önceki çalışmaları 10 sonuçları enfekte olmayan hücreler nihai nüfusun% 1-10 olarak öne sürmek, ve gözlenen nonsilenced fenotipleri çoğu sorumludur. M13-direnci verilmesi için muhtelif yollar pilus ifadesi 24 en yaygın olan mutasyon kaybı ile, bilinmektedir. Bu sınırlamaların ışığında, kontroller yüksek enfeksiyon oranları ve demonte verimliliğini doğrulamak için kullanılmalıdır. Bazı uygulamalar için bir başka potansiyel sınırlama yardımcı faj kontamine arada transferidir. M13K07 mutasyona uğramış bir paketleme sinyali içermesine rağmen, faj üretimi ve ilk enfeksiyon olayı 25 dışına faj yayılmaya devam etmesi için yetkin hücrelerin sonuçlanan düşük bir frekansta faj kapsid içine paketlenmiş ve enfekte popülasyonları aktarılabilir. yardımcı faj yapılan değişiklikler etkili olduğu kanıtlanmıştırAzaltılmış faj üretimi 26 pahasına olsa bazen, spesifik olmayan ambalaj azaltmayı. Engineered bakteriyofaj E. için vazgeçilmez bir araç haline gelmiştir büyüyen bir nüfusa yeni genlerin hızlı teslimat sağlayan coli sentetik biyoloji,. Yeni çalışmalar hücrelerarası iletişim devrelerini 11 üretilen ya da antibiyotik direncini bastırmak için transkripsiyon faktörlerini ifade 27 yolaklarıyla etti. Burada sunulan protokol programlanmış RNA&#39;lar yoluyla bakteriyel fizyolojisinin kontrolünü sağlayan araçları büyüyen bir koleksiyon ekler. Nükleaz aktivitesi ortadan kaldırmak için mutasyona uğradığı zaman CRISPR-Cas nükleazlar, RNA yönlendirmeli geni hedef 17,28 transkripsiyon bastırmak için gösterilmiştir. Bunun aksine, Srna susturulması translasyon düzeyinde çalışır ve dışsal protein ekspresyonunu gerektirmemektedir. Yeni nesil Biyoteknoloji kompleksi fenoksi program faj aracılı teslim transkripsiyonel ve çeviri kontrol birleşebilirlerGerçek zamanlı türleri.

RNA aracılı gen knockdowns iki aşamada devam edin. İlk olarak, bir RNA molekülü, bir hücre hattı veya çalışma organizmaya verilir. İkinci olarak, endojen RNA bağlayıcı proteinler, RNA hedef tanınmasını kolaylaştırmak ve susturma etkisi üretmek. Tüm RNA demonte teknolojileri kolayca ilgi belirli bir hedef maç için üretilebilir sentetik sRNAs özelleştirilebilir doğası, yarar. Ancak, RNA alımı ve sessizliğini moleküler ayrıntıları nerede ve nasıl RNA knockdowns uygulanabilir kısıtlayıcı, model sistem çok değişkendir. Nematod, iki-şeritli RNA (dsRNA) molekülleri ortamda veya dsRNA eksprese eden E. nüfuslu solucanlar beslenmesi ile doğrudan sokulabilir coli hücreleri 1,2. Drosophila olarak, RNAi, sadece kültür ortamı 4 dsRNA eklenerek dsRNA 3 embriyolar microinjecting elde ya da hücre hatları uygulanabilir. Memeli hücre hatlarında,Sentetik küçük müdahale RNA&#39;lar (siRNA&#39;lar), lipozomlar 3,6 paketlenmiş, elektroporasyon 1,2,5 canlı hücre teslim veya DNA plazmid vektörleri 4,7 eksprese edilebilir. RNA türlerinin sitozolde ulaştığında, RNAi yolu, dsRNA işlemek hedefin antisens tanınmasını kolaylaştırmak ve konak bağlı, translasyonel baskıyı, mRNA bozulmalarını veya heterokromatin oluşumunu katalize etmek için RISC kompleksi dayanır. Bu gereksinimler nedeniyle, klasik RNAi sadece verimli eksojen RNA sürebilir ve RISC veya RISC benzeri aktivite ifade organizmalar yapılabilir. Özellikle, bu model bakterisi E. dışlar RNAi yolu yoksun coli. Ancak, sentetik biyoloji son gelişmeler teslimat sorunu ve susturma sorunu hem çözmek için araçlar sağlar. Bu protokolde, Srna yapılar E. ifade edilir DNA vektöründen coli li teslimM13 fajemid / yardımcı sistemini kullanarak hücrelerin Ving. Bir fagemit replikasyon bir faj türevli F1 kökenli herhangi bir plazmiddir. Bir yardımcı plazmid, bu durumda M13KO, viral parçacıkları üretmek için gerekli tüm makine taşır, ama replikasyon ve paketleme için yeterli değildir kendisidir. Bir fajemid ve yardımcı plazmid-dönüştürülmüş co zaman, tek başına fagemit, f1 kökenli çoğaltılmış paketlenmiş ve salgılanır. Vectorized fagemit canlı E. enfekte sonra yetkili F pilus yoluyla E. coli. Bu sistemde, susturulması etkisi hedef bağlayıcı sekansı ile bir iskele sekansı birleştiren özel Srna kasetleri üretilmektedir. Hedef bağlayıcı dizi tipik ribozom bağlanma yeri (RBS) olarak, bir mRNA hedef antisens 24 baz çifttir. Na ve arkadaşları 8 tarafından geliştirilen iskele dizisi, MICC, E. endojen küçük bir düzenleyici RNA çıkarılan bir Hfq bağlayıcı motifini E. coli. Hfq proteini RNA-RNA-bağlanma uyarırg ve mRNA degradasyon, RNAi RISC benzer, bu sistemde bir amaca hizmet. Şekil 1 Srna kaseti yapısı, fagemit vektörleştirme ve susturma mekanizması dahil olmak üzere faj aracılı Srna knockdowns için tam bir şemayı göstermektedir. Bir yöntemde E. gen ifadesini modüle etmek için E. coli, Srna susturma, basit, hızlı ve çok yönlüdür. Hedeflenen E. E. coli fajemid yayma ve Srna ifade ötesinde yatar değildir. Bu büyük heterolog yapıları ifadesi hücresel kaynakları 9 zorlayabilir sentetik biyoloji veya temel araştırma kapsamında ilgili olabilir. Yeni hedeflerle fajmidler tek PCR ile üretilen ve fagemid dönüşüm bir gün sonra hasat edilebilir. Son olarak, hemen hemen her mRNA hedeflenebilir. Srna düzenlemesi kaseti (standart plazmit üzerinde)&gt;% 90, tipik 8 baskı düzeyleri ile metabolizma hedeflerin çeşitli çalışma gösterilmiştir. 10 kasetlerinin kullanarak daha önceki çalışmaları genişletir. İlk olarak, bir paket fagemit E. bir parti kültür ilave edilir E. coli hücreleri ve floresan protein mKate2 ekspresyonunu kapatmak için kullanılabilir. Sonradan floresan değişiklikleri gerçek zamanlı olarak takip edilmektedir. İkinci olarak, CAT genini aşağı vurma agar plakaları üzerinde fenotipik kloramfenikol direncini azaltmak için gösterilmiştir. Her iki durumda da, fagemit kendisi enfeksiyon oranı, bağımsız bir yok etme verimliliğinin ölçülmesine izin verecek şekilde, bir GFP işaretleyici taşımaktadır.

<table><tbody><tr><td>Plasmid Miniprep Kit</td><td>Qiagen</td><td>27104</td><td></td></tr><tr><td>DpnI Enzyme</td><td>NEB</td><td>R0176S</td><td></td></tr><tr><td>Phusion High Fidelity Polymerase</td><td>NEB</td><td>M0530S</td><td></td></tr><tr><td>Taq 2x Master Mix</td><td>NEB</td><td>M0270L</td><td></td></tr><tr><td>M13KO7 Helper Phage</td><td>NEB</td><td>N0315S</td><td></td></tr><tr><td>DH5&amp;alpha; Competent Cells</td><td>Life Technologies</td><td>18265-017</td><td></td></tr><tr><td>TOP10F&#039; Cells</td><td>Life Technologies</td><td>C3030-03</td><td></td></tr><tr><td>LB Broth</td><td>Sigma</td><td>L3022-250G</td><td></td></tr><tr><td>Ampicillin</td><td>Sigma</td><td>A9393-5G</td><td></td></tr><tr><td>Kanamycin</td><td>Sigma</td><td>60615-5G</td><td></td></tr><tr><td>Chloramphenicol</td><td>Sigma</td><td>C0378-5G</td><td></td></tr><tr><td>Tetracycline</td><td>Sigma</td><td>87128-25G</td><td></td></tr></tbody></table>

phage-mediated delivery of targeted srna constructs to knock down gene expression in e. coli

RNA aracılı knockdowns yaygın gen ifadesini kontrol etmek için kullanılır. teknikler Bu çok yönlü ailesi bir dizi ile sentezlenir ve susturma için hedeflenen bir geni tamamlayıcı tasarlanabilir kısa RNA (Srna) kullanır. Srna doğrudan bir çok hücre tipinde kişiye veya çeşitli vektörler kullanılarak olabilir inşa için, gen ekspresyonu zahmetli genetik modifikasyon olmadan canlı hücreler bastırılmış edilebilir. En yaygın RNA demonte teknolojisi, RNA interferans (RNAi), hedef mRNA&#39;nın endojen RNA kaynaklı kompleks (RISC) susturma aracılık sekans tanıma ve bölme merkezi kullanır. Bu teknik uygulamaları nedenle RISC sentezleyen organizmaların öncelikle ökaryotlar ile sınırlıdır. Son zamanlarda, RNA Biyo yeni nesil RNA vasıtasıyla gen ekspresyonunu kontrol etmek için alternatif bir mekanizmalar geliştirmişlerdir ve böylece bakteriler olası RNA aracılı gen knockdowns yapılmıştır. Burada gen Expres susturma için bir yöntem tarifE. sion coli işlevsel RNAi andırıyor. Bu sistemde, bir suni fajmid dizisini hedeflemek için tasarlanmış olabilir srna ifade etmek için tasarlanmıştır. Sentezleme konstruktu E. nüfusu teslim stabil bir plazmid gibi replike edebilmekte ve bundan sonra litik olmayan M13 fajı ile coli hücreleri. Antisens tanınması ve hedef mRNA&#39;nın susturulması E. endojen Hfq proteini aracılık etmektedir E. coli. Bu protokol, antisens Srna tasarımı fagemit vektör inşa, M13 bakteriyofaj içine fagemit ambalaj, enfeksiyon için bir canlı hücre popülasyonu hazırlanması ve enfeksiyon kendisi yapmak için yöntemler içerir. floresan protein mKate2 ve antibiyotik direnç geni kloramfenikol asetiltransferaz (CAT) temsilcisi verileri oluşturmak için ve demonte etkinliğini ölçmek için hedeflenir.

Sıvı Ortamda mKate2 Floresans susturma Şekil 1, Srna kaseti tasarım, fagemit vektörleştirme ve susturma mekanizması dahil olmak üzere bu çalışmada tarif Srna aracılı knockdowns için şemayı göstermektedir. protokol 1.2 ardından, plazmid pAB.001 bölgesinin Srna susturulması kaseti mKate hedef değiştirilmiştir. Srna kaseti sentezlenmiş ve fajmid Litmus28i_J23115-B0032-GFP, Monica Ortiz ve Drew EndY 11 bir hediye klonlanmıştır. Bu fagemit başarılı enfeksiyonu takip sağlayan, GFP tanımına ve kanamisin direnci için işaretleri taşır. Ambalajlı fagemit stokları protokole 2 Aşağıdaki hazırlanmıştır. E. bir türevi Bir yapıcı şekilde tanımlanmış, kromozomal olarak entegre mKate2 işaretleyici taşıyan E. coli K12 MG1655 konjugasyon ile faj enfeksiyonu için elde edilmiştir<html> mid log fazı ve fagemid enfeksiyondan sonra protokol 4. Aşağıdaki kişiye fajmid büyütülmüştür protokolü 3. Hücreler, aşağıdaki F plazmid donör soyu ile, 200 | il kültür bir floresan plaka okuyucu aktarılmış ve floresan, 24 saat boyunca sürekli olarak izlenmiştir. Şekil 3, mKate2 ifadesi üzerindeki Srna aracılı susturma etkisini göstermektedir. bir anti-mKate2 fajmid ile enfekte suş arka plan üzerinde saptanabilir mKate2 floresan gösterdi. Bunun aksine, bu suş fajmid başarıyla alımını göstermektedir GFP işaretleyici ifade yaptı. Enfekte olmamış kontrol hücrelerinin mKate2 floresan ancak GFP üretti. Anti-mKate2 hedef alan bir dizi hedef CAT ile ikame edildiği bir ek kontrol, mKate2 floresan üzerinde herhangi bir etki. Ağar Tabaklar üzerinde Kloramfenikol Direniş susturma İçerik: 1 &quot;&gt; protokol 1.1 takiben, Srna susturulması kaseti CAT hedef üretildi&quot; fo tutmak-together.within Sayfa = &quot;kurucu olarak ifade, kromozomal olarak entegre CAT markör için hazırlanan taşıyan E. coli K12 MG1655 bir türevi. protokol 3. hücreler, aşağıdaki F-plazmid donör soyu ile konjugasyon ile faj enfeksiyonu, orta log fazına büyüdükten ve fajmid, 37 ° C&#39;de inkübasyondan 1 saat sonra protokol 4. aşağıdaki kişiye, enfekte olmuş hücreler seri olarak seyreltildi ve kaplanmıştır kloramfenikol konsantrasyonları. Plakalar aralığı gece boyunca inkübe edildi ve her bir kloramfenikol konsantrasyonunda dirençli hücrelerin oranı koloni oluşturan birim (CFU) ertesi gün sayılması ile belirlenmiştir. Şekil 4, kloramfenikol direnç fenotipi Srna aracılı susturma etkisini göstermektedir. fagemit mKate2 hedeflemesi ile enfekte enfekte olmamış hücreleri, ya da hücreler, dirençli olduğutest edilen bütün konsantrasyonlarda kloramfenikol. Bunun aksine, hücre fagemit hedefleme CAT ile enfekte düşük kloramfenikol konsantrasyonlarında hayatta azalma görülmüştür ve yaklaşık% 99 daha yüksek konsantrasyonlarda öldürme. ampisilin eklenmesi, fagemit taşıyan bakterinin sadece seçmek için, tespit edilemez seviyelere kloramfenikol hayatta azaltmıştır. Bu faj enfeksiyonu o kaçış gösteren 10 susturmak kaçmak için ortak bir yol olduğunu daha önceki çalışmaları ile tutarlıdır. <img alt="Şekil 1" src="/files/ftp_upload/53618/53618fig1.jpg" /> Şekil 1: E. gen susturma Srna ifade kasetleri ile E. coli M13 fajı tarafından getirilen Srna kaseti 4 modülden oluşmaktadır. pR promoteri (bakteriyofaj lambda türetilmiş bir kurucu promoter), 24 bp&#39;lik bir hedefleme domeni, bir Hfq bağlama alanı MICC çıkarılır ve bir transkripsiyonel terminatör 8 </&gt; Sup. Kaset M13 f1 replikasyon orijini ihtiva eden bir fajmid dahil edilebilir ve yardımcı faj M13KO7 kullanılarak M13 kapsid paketlenir. Ambalajlı fajmidler E. enfekte edebiliyoruz E. coli Srna ifade başlar F Pilus dile getirdi. Srna sonra (kırmızı tasvir) Hfq proteinini acemi ve translasyonel baskı ve mRNA bozulması sonucu, ribozom bağlanma yeri yakınındaki bir antisens mRNA hedef bağlar. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/53618/53618fig1large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> <img alt="şekil 2" src="/files/ftp_upload/53618/53618fig2.jpg" /> Şekil 2:. Primer tasarımı ve Srna hedef bölgeye Site-directed mutagenesis iki primer, mevcut bir Srna kasetine kısmi homolojisi ile tasarlanmıştır. ileri primer, ardından 5 &#39;ucunda PR promoterinin, 20 bp homologu içerenYeni kılavuz sekansı temsil 24 bp 3 &#39;ucunda Hfq bağlanma alanı ile, daha sonra 18 bp homologu. ters primer yeni KILAVUZU dizisinin ters tamamlayıcı yan mevcut Srna kasetine homoloji bölgeleri ile ileri primer tam ters tamamlayıcısıdır. Tam primer sekansları, Tablo 3&#39;te verilmiştir. İleri ve geri primerler ile ayrı tek primeri PCR reaksiyonları istenen tadil edilmiş dizi ile lineer, tek sarmallı DNA üretir. Protokol açıklandığı gibi temiz-up ardından ileri tavlama ve reaksiyon ürünlerini ters istenen modifiye Srna kaseti taşıyan çift sarmallı plazmid DNA sonuçları. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/53618/53618fig2large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> <img alt="Şekil 3," src="/files/ftp_upload/53618/53618fig3.jpg" /> Şekil 3: KBir kromozomal olarak entegre mKate2 Floresan Reporter nockdown. E. mKate2 ifade coli MG1655 K12 vardı ya sol tedavi edilmezse (kırmızı çizgiler ve barlar), bir anti-mKate2 fajmid (yeşil çizgiler ve çubuklar) ile enfekte veya bir kontrol fajmid hedefleyen CAT (mavi çizgiler ve barlar) ile enfekte. (A) muamele edilmemiş E. koli faj enfeksiyona metabolik maliyeti gösteren yüksek doygunluk yoğunluklarına büyüdü. Noktalı çizgiler 3 çoğaltır standart sapmaları göstermektedir. (B) mKate2 sinyal anti mKate2 yakın düzeylere düşürülmüştür ancak kontrol suşunun, suş işlemden geçirildi. Ayrıca, fajmid tarafından taşınan (C), GFP floresans, sadece fagemit ile tedavi edilen kontrollere saptanabildi. (D, E) büyüme 24 saat OD normalize edildikten sonra Final floresan okumaları. GFP sinyali, fagemit enfeksiyonu gösteren muamele edilmemiş kontrollere yoktu, ama aynı zamanda esas olarak, anti-CAT p aşağıdaki düşükhagemid tedavisi. Bu fajemidin hedef dışı etkiler gösterebilir. mKate2 sinyali muamele edilmemiş kontroller ile karşılaştırıldığında, anti-mKate2 fagemit tedavi azaltılmıştır. CAT-hedefli kontrol fajmid mKate2 floresan üzerinde bir etki göstermemiştir. Hata çubukları 3 çoğaltır standart sapmasını temsil eder. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/53618/53618fig3large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> <img alt="Şekil 4," src="/files/ftp_upload/53618/53618fig4.jpg" /> Şekil 4: CAT demonte bir Genetiği Dayanıklı Nüfus Kloramfenikol Hassasiyet döndürür E.. Bir kromozomal olarak entegre CAT genini ifade eden E. coli MG1655 K12 mKate2 (yeşil çubuklar) hedefleyen bir kontrol fajmid, tedavi edilmeden (kırmızı çubuklar) sola ya da bir anti-CAT Srna (mavi sütunlar) eksprese eden bir fajmid ile muamele edilmiştir. belirtilen karıncanın 1 enfeksiyonu saat, canlılığı sonraibiotics seri seyreltme ve kaplama ile değerlendirildi. Kontrol tedavi etkilenmemiştir ise, anti-CAT fajmid ile muamele suşlar önemli ölçüde daha yüksek konsantrasyonlarda kloramfenikol ile (&gt;% 90) öldü. kültür plakalarına ekleme ampisilin olumlu fagemit enfeksiyon için seçer ve bulaşmamış hücreleri ortadan kaldırır. Bu koşullar altında, herhangi bir kloramfenikol dirençli koloniler, anti-CAT tedaviden sonra gözlenmiştir. Bu en kurtulan enfeksiyon bir başarısızlık yerine susturma bir arıza temsil ettiğini gösterir. Hata çubukları 3 çoğaltır standart sapmasını temsil eder. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/53618/53618fig4large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> CAT hedef sekans </td><td> 5 &#39;- ATGGAGAAAAAAATCACTGGATAT - 3&#39; </td></tr><tr><td> CAT KILAVUZU dizisi </td><td> 5 &#39;- ATATCCAGTGATTTTTTTCTCCAT - 3&#39; </td></tr></tbody></table> Tablo 1:. CAT gen için bir örnek olarak, hedef ve rehber sekans ters tamamlayıcı ilişkiyi not edin. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> pR promoterinin </td><td colspan="5"> TAACACCGTGCGTGTTGACTATTTTACCTCTGGCGGTGATAATGGTTGC </td></tr><tr><td> rehber sekans </td><td colspan="5"> ATATCCAGTGATTTTTTTCTCCAT </td></tr><tr><td> Hfq bağlama alanı </td><td colspan="5"> TTTCTGTTGGGCCATTGCATTGCCACTGATTTTCCAACATATAAAAAGACAAGCCCGAACAGTCGTCCGGGCTTTTTT TCTCGAG </td></tr><tr><td> T1 / TE sonlandırıcı </td><td colspan="5"> CTCGAGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTTTTGTCGGTGAA CGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATA </td></tr></tbody></table>Tablo 2:. Srna Kaset sırası Bileşenleri Her dizisi 5&#39;-3 &#39;yazılır. tam kaset için bu 4 element birleştirme ve 292 bp içermektedir. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> İleri Astar </td><td> 5 &#39;- CTGGCGGTGATAATGGTTGC [REHBER] TTTCTGTTGGGCCATTGC - 3&#39; </td></tr><tr><td> Ters Primer </td><td> 5 &#39;- GCAATGGCCCAACAGAAA [HEDEF] GCAACCATTATCACCGCCAG - 3&#39; </td></tr></tbody></table> Tablo 3: Primer tasarımı, mevcut kılavuz elemanları Alter ileri primer Pr arttırıcının içinden son 20 bp, yeni rehber sekans ve Hfq bağlayıcı alan ilk 18 bp içerir.. HEDEF dizisi KILAVUZU dizisinin tam ters tamamlayıcısıdır. ters primer ileri primer tam ters tamamlayıcısıdır. </p&gt; <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Bileşen </td><td> hacim </td></tr><tr><td> Şablon plazmit </td><td> 500 ng </td></tr><tr><td> 10 mM oncul </td><td> 2.5 ul </td></tr><tr><td> 10 mM dNTP </td><td> 0.4 ul </td></tr><tr><td> Yüksek sadakat Polimeraz (2 U / ul) </td><td> 0.5 ul </td></tr><tr><td> 5x PCR Tampon </td><td> 10 ul </td></tr><tr><td> Toplam ses </td><td> 50 ul </td></tr></tbody></table> Tablo 4: Tek Primer mutajenik PCR için önerilen koşullar. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Adım </td><td> Sıcaklık </td><td> Zaman </td></tr><tr><td> ilk denatürasyon </td><td> 98 ° C </td><td> 30 sn </td></tr><tr><td rowspan="3"> 30 döngü </td><td> 98 ° C </td><td> 10 sn </td></tr><tr><td> 55 ° C </td><td> 30 sn </td></tr><tr><td> 72 ° C </td><td> 120 sn </td></tr><tr><td> nihai Uzatma </td><td> 72 ° C </td><td> 300 sn </td></tr><tr><td> Depolama </td><td> 10 ° C </td><td></td></tr></tbody></table> Tablo 5: Tek Primer mutajenik PCR için Termosikler Protokolü önerdi. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Bileşen </td><td> hacim </td></tr><tr><td> Şablon DNA, </td><td> 1 ul </td></tr><tr><td> 10 uM Düz Primer </td><td> 0.5 ul </td></tr><tr><td> 10 uM Ters Primer </td><td> 0.5 ul </td></tr><tr><td> Taq 2X Master Mix </td><td> 25 ul </td></tr><tr><td> Nukleazsız water </td><td> 23 ul </td></tr><tr><td> Toplam ses </td><td> 50 ul </td></tr></tbody></table> Tablo 6: Dizi Doğrulama PCR için önerilen koşullar. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Adım </td><td> Sıcaklık </td><td> Zaman </td></tr><tr><td> ilk denatürasyon </td><td> 95 ° C </td><td> 30 sn </td></tr><tr><td rowspan="3"> 30 döngü </td><td> 95 ° C </td><td> 30 sn </td></tr><tr><td> 55 ° C </td><td> 30 sn </td></tr><tr><td> 68 ° C </td><td> 30 sn </td></tr><tr><td> nihai Uzatma </td><td> 68 ° C </td><td> 300 sn </td></tr><tr><td> Depolama </td><td> 10 ° C </td><td></td></tr></tbody></table> Tablo 7: Termosikler Pro ÖnerilenDizi Doğrulama PCR için tokol.

Watch this Scientific Journal Video about Phage-mediated Delivery of Targeted sRNA Constructs to Knock Down Gene Expression in E. coli at JoVE.com

Phage-mediated Delivery of Targeted sRNA Constructs to Knock Down Gene Expression in E. coli

We describe a method to knock down gene expression in a growing population of E. coli cells using sequence-targeted sRNA expression cassettes delivered by an M13 phagemid vector.

Hedeflenen Srna faj aracılı teslim Gen İfade Knock Down için oluşturur<em&gt; E. E. coli</em

RNA-mediated knockdowns are widely used to control gene expression. This versatile family of techniques makes use of short RNA (sRNA) that can be ...

phage-mediated-delivery-targeted-srna-constructs-to-knock-down-gene

Universidad de Cartagena UDEC

Research

JoVE Journal

Biology

Phage-mediated Delivery of Targeted sRNA Constructs to Knock Down Gene Expression in E. coli

12.6K Görüntüleme.  Institut National de la Santé et de la Recherche Médicale (INSERM), Université Paris Descartes. We describe a method to knock down gene expression in a growing population of E. coli cells using sequence-targeted sRNA expression cassettes delivered by an M13 phagemid vector.

Video: Phage-mediated Delivery of Targeted sRNA Constructs to Knock Down Gene Expression in E. coli

High efficiency, Site-specific Transfection of Adherent Cells with siRNA Using Microelectrode Arrays (MEA)

The discovery of RNAi pathway in eukaryotes and the subsequent development of RNAi agents, such as siRNA and shRNA, have achieved a potent method for silencing specific genes1-8 for functional genomics and therapeutics. A major challenge involved in RNAi based studies is the delivery of RNAi agents to targeted cells. Traditional non-viral delivery techniques, such as bulk electroporation and chemical transfection methods often lack the necessary spatial control over delivery and afford poor transfection efficiencies9-12. Recent advances in chemical transfection methods such as cationic lipids, cationic polymers and nanoparticles have resulted in highly enhanced transfection efficiencies13. However, these techniques still fail to offer precise spatial control over delivery that can immensely benefit miniaturized high-throughput technologies, single cell studies and investigation of cell-cell interactions. 
Recent technological advances in gene delivery have enabled high-throughput transfection of adherent cells14-23, a majority of which use microscale electroporation. Microscale electroporation offers precise spatio-temporal control over delivery (up to single cells) and has been shown to achieve high efficiencies19, 24-26. Additionally, electroporation based approaches do not require a prolonged period of incubation (typically 4 hours) with siRNA and DNA complexes as necessary in chemical based transfection methods and lead to direct entry of naked siRNA and DNA molecules into the cell cytoplasm. As a consequence gene expression can be achieved as early as six hours after transfection27. Our lab has previously demonstrated the use of microelectrode arrays (MEA) for site-specific transfection in adherent mammalian cell cultures17-19. In the MEA based approach, delivery of genetic payload is achieved via localized micro-scale electroporation of cells. An application of electric pulse to selected electrodes generates local electric field that leads to electroporation of cells present in the region of the stimulated electrodes. The independent control of the micro-electrodes provides spatial and temporal control over transfection and also enables multiple transfection based experiments to be performed on the same culture increasing the experimental throughput and reducing culture-to-culture variability. 
Here we describe the experimental setup and the protocol for targeted transfection of adherent HeLa cells with a fluorescently tagged scrambled sequence siRNA using electroporation. The same protocol can also be used for transfection of plasmid vectors. Additionally, the protocol described here can be easily extended to a variety of mammalian cell lines with minor modifications. Commercial availability of MEAs with both pre-defined and custom electrode patterns make this technique accessible to most research labs with basic cell culture equipment.

High efficiency, Site-specific Transfection of Adherent Cells with siRNA Using Microelectrode Arrays MEA

The article details the protocol for site-specific transfection of scrambled sequence of siRNA in an adherent mammalian cell culture using a microelectrode array (MEA).

Mikroelektrod Diziler Kullanarak siRNA Bağlanan Hücre Yüksek verim, Siteye özgü Transfeksiyon (MEA)

The discovery of RNAi pathway in eukaryotes and the subsequent development of RNAi agents, such as siRNA and shRNA, have achieved a potent method for ...

Biyomühendislik

CRISPR Guide RNA Cloning for Mammalian Systems

The outlined protocol describes streamlined methods for the efficient and cost-effective generation of Cas9-associated guide RNAs. Two alternative strategies for guide RNA (gRNA) cloning are outlined based on the usage of the Type IIS restriction enzyme BsmBI in combination with a set of compatible vectors. Outside of the access to Sanger sequencing services to validate the generated vectors, no special equipment or reagents are required aside from those that are standard to modern molecular biology laboratories. The outlined method is primarily intended for cloning one single gRNA or one paired gRNA-expressing vector at a time. This procedure does not scale well for the generation of libraries containing thousands of gRNAs. For those purposes, alternative sources of oligonucleotide synthesis such as oligo-chip synthesis are recommended. Finally, while this protocol focuses on a set of mammalian vectors, the general strategy is plastic and is applicable to any organism if the appropriate gRNA vector is available.

Here, a simple, efficient, and cost-effective method of sgRNA cloning is outlined.

CRISPR Kılavuzu RNA memeli sistemler için klonlama

The outlined protocol describes streamlined methods for the efficient and cost-effective generation of Cas9-associated guide RNAs. Two alternative ...

Genetik

Producing Gene Deletions in Escherichia coli by P1 Transduction with Excisable Antibiotic Resistance Cassettes

A first approach to study the function of an unknown gene in bacteria is to create a knock-out of this gene. Here, we describe a robust and fast protocol for transferring gene deletion mutations from one Escherichia coli strain to another by using generalized transduction with the bacteriophage P1. This method requires that the mutation be selectable (e.g., based on gene disruptions using antibiotic cassette insertions). Such antibiotic cassettes can be mobilized from a donor strain and introduced into a recipient strain of interest to quickly and easily generate a gene deletion mutant. The antibiotic cassette can be designed to include flippase recognition sites that allow the excision of the cassette by a site-specific recombinase to produce a clean knock-out with only a ~100-base-pair-long scar sequence in the genome. We demonstrate the protocol by knocking out the tamA gene encoding an assembly factor involved in autotransporter biogenesis and test the effect of this knock-out on the biogenesis and function of two trimeric autotransporter adhesins. Though gene deletion by P1 transduction has its limitations, the ease and speed of its implementation make it an attractive alternative to other methods of gene deletion.

Producing Gene Deletions in Escherichia coli by P1 Transduction with Excisable Antibiotic Resistance Cassettes

Here we present a protocol for the use of pre-existing antibiotic resistance-cassette deletion constructs as a basis for making deletion mutants in other E. coli strains. Such deletion mutations can be mobilized and inserted into the corresponding locus of a recipient strain using P1 bacteriophage transduction.

Escherichia coli Excisable antibiyotik direnci kasetleri ile P1 iletim tarafından üreten gen silme

A first approach to study the function of an unknown gene in bacteria is to create a knock-out of this gene. Here, we describe a robust and fast protocol ...

DNA Vector-based RNA Interference to Study Gene Function in Cancer

RNA interference (RNAi) inhibits gene expression by specifically degrading target mRNAs. Since the discovery of double-stranded small interference RNA (siRNA) in gene silencing1, RNAi has become a powerful research tool in gene function studies. Compared to genetic deletion, RNAi-mediated gene silencing possesses many advantages, such as the ease with which it is carried out and its suitability to most cell lines. Multiple studies have demonstrated the applications of RNAi technology in cancer research. In particular, the development of the DNA vector-based technology to produce small hairpin RNA (shRNA) driven by the U6 or H1 promoter has made long term and inducible gene silencing possible2,3. Its use in combination with genetically engineered viral vectors, such as lentivirus, facilitates high efficiencies of shRNA delivery and/or integration into genomic DNA for stable shRNA expression. 
We describe a detailed procedure using the DNA vector-based RNAi technology to determine gene function, including construction of lentiviral vectors expressing shRNA, lentivirus production and cell infection, and functional studies using a mouse xenograft model. 
Various strategies have been reported in generating shRNA constructs. The protocol described here employing PCR amplification and a 3-fragment ligation can be used to directly and efficiently generate shRNA-containing lentiviral constructs without leaving any extra nucleotide adjacent to a shRNA coding sequence. Since the shRNA-expression cassettes created by this strategy can be cut out by restriction enzymes, they can be easily moved to other vectors with different fluorescent or antibiotic markers. Most commercial transfection reagents can be used in lentivirus production. However, in this report, we provide an economic method using calcium phosphate precipitation that can achieve over 90% transfection efficiency in 293T cells. Compared to constitutive shRNA expression vectors, an inducible shRNA system is particularly suitable to knocking down a gene essential to cell proliferation. We demonstrate the gene silencing of Yin Yang 1 (YY1), a potential oncogene in breast cancer4,5, by a Tet-On inducible shRNA system and its effects on tumor formation. Research using lentivirus requires review and approval of a biosafety protocol by the Biosafety Committee of a researcher's institution. Research using animal models requires review and approval of an animal protocol by the Animal Care and Use Committee (ACUC) of a researcher's institution.

RNA interference (RNAi) possesses many advantages over gene knockout and has been broadly used as a tool in gene functional studies. The invention of DNA vector-based RNAi technology has made long term and inducible gene knockdown possible, and also increased the feasibility of gene silencing in vivo.

Kanser gen Fonksiyon Eğitim için DNA vektör tabanlı RNA Girişim

RNA interference (RNAi) inhibits gene expression by specifically degrading target mRNAs. Since the discovery of double-stranded small interference RNA ...

Tıp

Application of CRISPR Interference (CRISPRi) for Gene Silencing in Pathogenic Species of Leptospira

Leptospirosis is a global neglected zoonosis, responsible for at least 1 million cases per year and almost 60 thousand deaths. The disease is caused by pathogenic and virulent bacteria of the genus Leptospira, either by direct contact with the bacteria or indirectly by exposure to contaminated water or soil. Domestic and wild animals act as reservoir hosts of infection, shedding leptospires from colonized renal tubules of the kidney, via urine, into the environment. The generation of mutant strains of Leptospira is critical to evaluate and understand pathogenic mechanisms of infection. CRISPR interference (CRISPRi) has proven to be a straightforward, affordable, and specific tool for gene silencing in pathogenic Leptospira. Therefore, the methodological details of obtaining the plasmid constructs containing both dCas9 and guide RNA, delivery of plasmids to Leptospira by conjugation with the E. coli strain &#946;2163, and transconjugant recovery and evaluation, will be described. In addition, the recently described Hornsby-Alt-Nally (HAN) media allows for the relatively rapid isolation and selection of mutant colonies on agar plates.

Application of CRISPR Interference CRISPRi for Gene Silencing in Pathogenic Species of Leptospira

Here, the application of CRISPR interference (CRISPRi) for specific gene silencing in Leptospira species is described. Leptospira cells are transformed by conjugation with plasmids expressing dCas9 (catalytically "dead" Cas9) and a single-guide RNA (sgRNA), responsible for base pairing to the desired genomic target. Methods to validate gene silencing are presented.

Leptospira'nın Patojenik Türlerinde Gen Susturma için CRISPR Parazitinin (CRISPRi) Uygulanması

Leptospirosis is a global neglected zoonosis, responsible for at least 1 million cases per year and almost 60 thousand deaths. The disease is caused by ...

Bacterial Delivery of RNAi Effectors: Transkingdom RNAi

RNA interference (RNAi) represents a high effective mechanism for specific inhibition of mRNA expression. Besides its potential as a powerful laboratory tool, the RNAi pathway appears to be promising for therapeutic utilization. For development of RNA interference (RNAi)-based therapies, delivery of RNAi-mediating agents to target cells is one of the major obstacles. A novel strategy to overcome this hurdle is transkingdom RNAi (tkRNAi). This technology uses non-pathogenic bacteria, e.g. Escherichia coli, to produce and deliver therapeutic short hairpin RNA (shRNA) into target cells to induce RNAi. A first-generation tkRNAi-mediating vector, TRIP, contains the bacteriophage T7 promoter for expression regulation of a therapeutic shRNA of interest. Furthermore, TRIP has the Inv locus from Yersinia pseudotuberculosis that encodes invasin, which permits natural noninvasive bacteria to enter &beta;1-integrin-positive mammalian cells and the HlyA gene from Listeria monocytogenes, which produces listeriolysin O. This enzyme allows the therapeutic shRNA to escape from entry vesicles within the cytoplasm of the target cell. TRIP constructs are introduced into a competent non-pathogenic Escherichia coli strain, which encodes T7 RNA polymerase necessary for the T7 promoter-driven synthesis of shRNAs. A well-characterized cancer-associated target molecule for different RNAi strategies is ABCB1 (MDR1/P-glycoprotein, MDR1/P-gp). This ABC-transporter acts as a drug extrusion pump and mediates the "classical" ABCB1-mediated multidrug resistance (MDR) phenotype of human cancer cells which is characterized by a specific cross resistance pattern. Different ABCB1-expressing MDR cancer cells were treated with anti-ABCB1 shRNA expression vector bearing E. coli. This procedure resulted in activation of the RNAi pathways within the cancer cells and a considerable down regulation of the ABCB1 encoding mRNA as well as the corresponding drug extrusion pump. Accordingly, drug accumulation was enhanced in the pristine drug-resistant cancer cells and the MDR phenotype was reversed. By means of this model the data provide the proof-of-concept that tkRNAi is suitable for modulation of cancer-associated factors, e.g. ABCB1, in human cancer cells.

For development of RNA interference (RNAi)-based therapies, a novel strategy was developed, transkingdom RNAi (tkRNAi). This technology uses non-pathogenic bacteria to produce and deliver therapeutic short hairpin RNA (shRNA) into target cells. Here, tkRNAi was successfully applied for reversal of classical ABCB1-mediated multidrug resistance (MDR) of cancer cells.

RNAi Efektör Bakteriyel Teslim Tarihi: Transkingdom RNAi

RNA interference (RNAi) represents a high effective mechanism for specific inhibition of mRNA expression. Besides its potential as a powerful laboratory ...

Biyoloji

In Vitro Selection of Engineered Transcriptional Repressors for Targeted Epigenetic Silencing

Gene inactivation is instrumental to study gene function and represents a promising strategy for the treatment of a broad range of diseases. Among traditional technologies, RNA interference suffers from partial target abrogation and the requirement for life-long treatments. In contrast, artificial nucleases can impose stable gene inactivation through induction of a DNA double strand break (DSB), but recent studies are questioning the safety of this approach. Targeted epigenetic editing via engineered transcriptional repressors (ETRs) may represent a solution, as a single administration of specific ETR combinations can lead to durable silencing without inducing DNA breaks.
ETRs are proteins containing a programmable DNA-binding domain (DBD) and effectors from naturally occurring transcriptional repressors. Specifically, a combination of three ETRs equipped with the KRAB domain of human ZNF10, the catalytic domain of human DNMT3A and human DNMT3L, was shown to induce heritable repressive epigenetic states on the ETR-target gene. The hit-and-run nature of this platform, the lack of impact on the DNA sequence of the target, and the possibility to revert to the repressive state by DNA demethylation on demand, make epigenetic silencing a game-changing tool. A critical step is the identification of the proper ETRs&#39; position on the target gene to maximize on-target and minimize off-target silencing. Performing this step in the final ex vivo or in vivo preclinical setting can be cumbersome.
Taking the CRISPR/catalytically dead Cas9 system as a paradigmatic DBD for ETRs, this paper describes a protocol consisting of the in vitro screen of guide RNAs (gRNAs) coupled to the triple-ETR combination for efficient on-target silencing, followed by evaluation of the genome-wide specificity profile of top hits. This allows for reduction of the initial repertoire of candidate gRNAs to a short list of promising ones, whose complexity is suitable for their final&#160;evaluation in the therapeutically relevant setting of interest.

In Vitro Selection of Engineered Transcriptional Repressors for Targeted Epigenetic Silencing

Here, we present a protocol for the in vitro selection of engineered transcriptional repressors (ETRs) with high, long-term, stable, on-target silencing efficiency and low genome-wide, off-target activity. This workflow allows for reducing an initial, complex repertoire of candidate ETRs to a short list, suitable for further evaluation in therapeutically relevant settings.

In Vitro Hedeflenen Epigenetik Susturma için Tasarlanmış Transkripsiyonel Baskılayıcıların Seçimi

Gene inactivation is instrumental to study gene function and represents a promising strategy for the treatment of a broad range of diseases. Among ...

Effective Oral RNA Interference (RNAi) Administration to Adult Anopheles gambiae Mosquitoes

RNA interference has been a heavily utilized tool for reverse genetic analysis for two decades. In adult mosquitoes, double-stranded RNA (dsRNA) administration has been accomplished primarily via injection, which requires significant time and is not suitable for field applications. To overcome these limitations, here we present a more efficient method for robust activation of RNAi by oral delivery of dsRNA to adult Anopheles gambiae. Long dsRNAs were produced in Escherichia coli strain HT115 (DE3), and a concentrated suspension of heat-killed dsRNA-containing bacteria in 10% sucrose was offered on cotton balls ad-libitum to adult mosquitoes. Cotton balls were replaced every 2 days for the duration of the treatment. Use of this method to target doublesex (a gene involved in sex differentiation) or fork head (which encodes a salivary gland transcription factor) resulted in reduced target gene expression and/or protein immunofluorescence signal, as measured by quantitative Real-Time PCR (qRT-PCR) or fluorescence confocal microscopy, respectively. Defects in salivary gland morphology were also observed. This highly flexible, user-friendly, low-cost, time-efficient method of dsRNA delivery could be broadly applicable to target genes important for insect vector physiology and beyond.

Effective Oral RNA Interference RNAi Administration to Adult Anopheles gambiae Mosquitoes

The oral administration of dsRNA produced by bacteria, a delivery method for RNA interference (RNAi) that is routinely used in Caenorhabditis elegans, was successfully applied here to adult mosquitoes. Our method allows for robust reverse genetics studies and transmission-blocking vector studies without the use of injection.

Yetişkin Anofeller gambiae Sivrisineklerine Etkili Oral RNA İnferferi (RNAi) Uygulaması

RNA interference has been a heavily utilized tool for reverse genetic analysis for two decades. In adult mosquitoes, double-stranded RNA (dsRNA) ...

Phage Transduction: A Method to Transfer Ampicillin Resistance from Donor to Recipient E. coli

Source: Alexander S. Gold1, Tonya M. Colpitts1 
1 Department of Microbiology, Boston University School of Medicine, National Emerging Infections Diseases Laboratories, Boston, MA
Transduction is a form of genetic exchange between bacteria that utilizes bacteriophages, or phages, a class of virus that infects exclusively prokaryotic organisms. This form of DNA transfer, from one bacterium to another by way of a phage, was discovered in 1951 by Norton Zinder and Joshua Ledererg, who termed the process &#34;transduction&#34; (1). Bacteriophages were first discovered in 1915 by British bacteriologist Frederick Twort, then independently discovered again in 1917 by French-Canadian microbiologist Felix d&#39;Herelle (2). Since then, the structure and function of these phages have been widely characterized (3), dividing these phages into two classes. The first of these classes are the lytic phages which upon infection multiply within the host bacterium, disrupting the bacterial metabolism, lysing the cell, and releasing progeny phage (4). As a result of this anti-bacterial activity and the increasing prevalence of antibiotic-resistant bacteria, these lytic phages have recently proved useful as a substitute treatment for antibiotics. The second of these classes are the lysogenic phages which can either multiply within the host via the lytic cycle or enter a quiescent state in which their genome is integrated into that of the host (Figure 1), a process known as lysogeny, with the ability for phage production to be induced in multiple later generations (4).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/10517/10517fig1.jpg" /> 
Figure 1: Infection of host cell by bacteriophage. Adsorption by the phage to the bacterial cell wall via interactions between the tail fibers and receptor (purple). Once on the cell surface, the phage is irreversibly attached to the bacterial cell using the base plate (black) which is moved to the cell wall by the contractile sheath (yellow). Phage genome (red) then enters the cell and integrates into the host cell genome.
While bacterial transduction is a naturally occurring process, using modern technology it has been manipulated for the transfer of genes into bacteria in the laboratory setting. By inserting genes of interest into the genome of a lysogenic phage, such as phage, one is able to transfer these genes into the genomes of bacteria and consequently express them within these cells. While other methods of gene transfer, such as transformation, use a plasmid for gene transfer and expression, the insertion of the phage genome into that of the recipient bacterium not only has the potential to confer new traits to this bacterium, but also allows for naturally occurring mutations and other factors of the cellular environment to alter the function of the transferred gene.
Compared to other methods of horizontal gene transfer, such as conjugation, transduction is fairly flexible in the criteria required for donor and recipient cells. Any genetic element that can fit inside the genome of the phage being used can be transferred from any strain of donor bacteria to any strain of recipient bacteria as long as both are permissive to the phage, requiring the expression of necessary phage receptors on the cell surfaces. Once this gene is moved out of the donor genome and packaged into the phage, it can be transferred to the recipient. Following transduction, it is necessary to select for recipient bacteria that contain the gene of interest have to be selected for. This could be done by use of a genetic marker, such as a FLAG-tag or polyhistidine-tag, to mark the gene of interest, or the intrinsic function of the gene, in the case of genes that encode for antibiotic resistance. Additionally, PCR could be used to further confirm successful transduction. By using primers for a region within the gene of interest and comparing signal to a positive control, bacteria that has the gene of interest, and a negative control, bacteria that underwent the same steps as the transduction reaction with no phage. While bacterial transduction is a useful tool in molecular biology, it has and continues to play an important role in the evolution of bacteria, particularly with regard to the recent rise of antibiotic resistance.
In this experiment, bacterial transduction was used to transfer the gene encoding for resistance to the antibiotic ampicillin from the W3110 strain of E.coli to the J53 strain via the P1 bacteriophage (5). This experiment consisted of two main steps. First, the preparation of P1 phage containing the ampicillin resistance gene from the donor strain. Second, the transfer of this gene to the recipient strain by transduction with the P1 phage (Figure 1). Once carried out, the successful transfer of the ampicillin resistance gene could be determined by qPCR (Figure 2). If transduction was successful, the J53 strain of E. coli would be resistant to ampicillin, and the gene conferring this resistance detectable by qPCR. If unsuccessful, there would be no detection of the ampicillin resistance gene and ampicillin would still function as an effective antibiotic against the J53 strain.

<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/10517/10517fig2.jpg" /> 
Figure 2: The confirmation of successful transduction by qPCR. By comparing the Cq values detected for the gene of interest from the transduction reaction and the negative control reaction, and normalizing these values against a housekeeping gene, one was able to confirm that bacterial transduction was successful.

Phage Transduction: Transferring Ampicillin Resistance in E. coli

Source: Alexander S. Gold1, Tonya M. Colpitts1
1 Department of Microbiology, Boston University School of Medicine, National Emerging Infections Diseases ...

Education

JoVE Science Education

İleri Biyoloji

Mikrobiyoloji

RNAi Plating for C. elegans Feeding: A Technique to Induce Target dsRNA Expression in E. coli

Source: Kolundzic, E., et al. <a href="https://jove.unicartagenaproxy.elogim.com/video/56889/application-rnai-heat-shock-induced-transcription-factor-expression">Application of RNAi and Heat-shock-induced Transcription Factor Expression to Reprogram Germ Cells to Neurons in&#160;C. elegans</a>.&#160;J. Vis. Exp.&#160;(2018).
This video describes the principles behind RNAi treatment in C. elegans and demonstrates a protocol to knockdown lin-35 in a transgenic worm strain.

C. elegans Beslemesi için RNAi Kaplama: E. coli'de Hedef dsRNA Ekspresyonunu İndüklemek İçin Bir Teknik

Source: Kolundzic, E., et al. Application of RNAi and Heat-shock-induced Transcription Factor Expression to Reprogram Germ Cells to Neurons in&#160;C. ...

Hedeflenen Srna faj aracılı teslim Gen İfade Knock Down için oluşturur

Özet

Daha Fazla Video Keşfet

Bu videodaki bölümler