מימון עבור עבודה זו סופק על ידי Fondation בטנקור שולר בתמיכה של צוות פריז בטנקור iGEM. אנו מודים ביחידת המחקר U1001 INSERM ושנטל Lotton לקבלת סיוע טכני וייעוץ. Phagemid Litmus28i_J23115-B0032-GFP סופק על ידי מוניקה אורטיז דרו Endy של סטנפורד.

עיצוב 1. בניית וקטורי phagemid Bearing Srna השתקת קלטות <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> דה נובו עיצוב Srna השתקת קלטות 8 <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> זהה את הרצף השלם של mRNA להיות מושתק באמצעות מסד נתוני רצף DNA. כדי ליצור רצף היעד, לציין את 24 נ&quot;ב הראשונים של רצף קידוד, מעמדת 1-24 החל קודון ההתחלה (למשל, ATG). הערה: ההשתקה היא פחות יעילה כאשר אתרים או מקטעים נוספים של mRNA ממוקדות 8. </li><li style=";text-align:right;direction:rtl"> קח את המשלים השני של רצף היעד לייצר רצף מורה קלטת Srna. ראה טבלה מס &#39;1 עבור דוגמאות של רצפי היעד ומדריך עבור acetyltransferase chloramphenicol (CAT). </li><li style=";text-align:right;direction:rtl"> כדי לעצב את הביטוי Srna קלטת להשלים 292 נ&quot;ב, לארגן האמרגן PR, רצף GUIDE, Hfq חלבון מושלם מחייב T1 / TE רצפים terminator תעתיק בסדרה (טבלה 2). </li><li style=";text-align:right;direction:rtl"> הוסף אתרי שיבוט נוספים של בחירה כדי להקל שיבוט של קלטת Srna לתוך וקטור היעד. </li><li style=";text-align:right;direction:rtl"> השג את קלטת Srna להשלים באמצעות סינתזת גן מסחרית או שיטה דומה ולשכפל אותו לתוך כל וקטור phagemid עם ממוצא שכפול F1 התפקודי 11. ראה מידע תומך עבור הרצף השלם של וקטור phagemid הסופי. </li></ol></li><li style=";text-align:right;direction:rtl"> לשנות את הרצף הממוקד על ידי קלטת ביטוי Srna קיים באמצעות PCR מבוסס אתר הבימוי mutagenesis 12 <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> זהה את רצף GUIDE 24 נ&quot;ב קלטת ביטוי Srna קיימת. הערה: הפלסמיד pAB.001 המבואר, המשמש בעבודה זו, זמין כקובץ רצף משלים. </li><li style=";text-align:right;direction:rtl"> עיצוב קדימה ולהפוך פריימרים עם אזורים קצרים הומולוגיה לקסטת Srna קיימת איגוף רצף GUIDE 24 נ&quot;ב החדש. השג את פריימרים באמצעות סינתזת oligonucleotide מסחרית. הערה: עיצוב פריימר עבור mutagenesis אתר מכוון הוא depicטד באיור 2. רצפי תבנית המדויק פריימר ניתנים בטבלה 3. </li><li style=";text-align:right;direction:rtl"> הכן תרבות 5 מ&quot;ל של E. coli נושאת את phagemid ביטוי Srna תבנית. לגדל את התאים לילה בשעה 37 ° C עם רעד, בתקשורת LB עם אנטיביוטיקה מתאימה. </li><li style=";text-align:right;direction:rtl"> חלץ ולטהר את phagemid ביטוי תבנית Srna מן התרבות חיידקים 5 מ&quot;ל באמצעות ערכת DNA miniprep או שיטה דומה 12. </li><li style=";text-align:right;direction:rtl"> הכן שתי תגובות PCR באמצעות phagemid ביטוי Srna תבנית פולימראז באיכות גבוהה, אחד עם קדימה ואחד עם פריימר ההפוך (לוח 4). השתמש תנאי PCR כפי שהומלץ על ידי ספק פולימראז (לוח 5). להגדיל את ריכוז תבנית 10-50x גבוה יותר מאשר תגובה סטנדרטית להסביר את העובדה שהתגובה פריימר היחידה אינה מייצרת הגברת מעריכים. </li><li style=";text-align:right;direction:rtl"> מערבב את תגובות PCR מעל השנייה בתוך שפופרת microcentrifuge. Anneal המוצרים על ידי חימום עד 98 מעלות צלזיוס באמבט מים רותחים. מיד לאחר הנחת הצינור microcentrifuge באמבט מים, להסיר את מקור החום ולאפשר באמבטיה לחזור לאט לטמפרטורת החדר במשך 1-2 שעות. </li><li style=";text-align:right;direction:rtl"> על מנת לפסול את phagemid ביטוי תבנית Srna unmutated, להוסיף 1 μl. אנזים הגבלה DpnI לתערובת לדגור על 37 מעלות צלזיוס במשך שעה 1, או הזמן המומלץ על ידי היצרן לעיכול שלם. הערה: DpnI מעכל רק לנקודות היעד מפוגל, אשר נמצאים על phagemids מאכסן משוכפל אבל לא מוצרי ה- PCR. </li><li style=";text-align:right;direction:rtl"> להפוך לרכוש או מוכן 13 כימית המוסמכות E. coli עם 1-5 μl של מוצר ה- PCR המרותק. לבודד מושבות אחת של המתח הפך על ידי ציפוי סלקטיבי על צלחות אגר LB המכיל אנטיביוטיקה מתאימה. </li><li style=";text-align:right;direction:rtl"> כדי לאמת את ההתאגדות של רצף GUIDE הנכון, מסך המושבות שהתקבלו על ידי מושבת PCR. בעזרת קצה פיפטה 200 μl, שיתוףllect כמות קטנה של תאים ממושבת טרנספורמציה יחידה. מארק ולשמר את המושבה המקורית לשימוש במורד הזרם לאחר אימות. </li><li style=";text-align:right;direction:rtl"> מוסיפים את התאים שנאספו עד 50 μl של מים nuclease ללא בצינור microcentrifuge. מערבבים על ידי pipetting למעלה ולמטה. </li><li style=";text-align:right;direction:rtl"> באמצעות thermocycler הספסל העליון או באמבט מים רותחים, lyse התאים על ידי חימום עד 95 מעלות צלזיוס למשך 2 דקות. </li><li style=";text-align:right;direction:rtl"> PCR-להגביר את האזור phagemid באמצעות 1 μl של תאים lysed חום כתבנית DNA. תנאי PCR ופרוטוקולי thermocycler ניתנים בלוחות 6 ו -7. ראה את קובץ הרצף pAB.001 משלים עבור רצפים פריימר אימות. </li><li style=";text-align:right;direction:rtl"> רצף מוצר PCR לאמת התאגדות של רצף GUIDE הנכון. </li><li style=";text-align:right;direction:rtl"> לחסן תרבות 5 מ&quot;ל של E. שיבוט coli נושא את phagemid Srna הביטוי מאומת הרצף. לגדל את התאים לילה בשעה 37 ° C עם רעד, בתקשורת LB סלקטיבית. </li><li style=";text-align:right;direction:rtl"> הכנתי מלאה גליצרולשל שיבוט רצף-מאומת. הוסף 750 μl של תרבות לילה 250 μl של גליצרול 60% בתוך שפופרת קריו בורג מכסה. </li><li style=";text-align:right;direction:rtl"> אחסן את המניה גליצרול ב -80 ° C ללא הגבלת זמן. שאר תרבות הלילה ניתן להשתמש כמקור עבור phagemid ביטוי Srna בשלב 2. </li></ol></li></ol> 2. ייצור קציר של מניות phagemid ארוזים M13 <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הכן תרבות 5 מ&quot;ל של E. coli נושאת את phagemid ביטוי Srna. לגדל את התאים לילה בשעה 37 ° C עם רעד, בתקשורת LB עם אנטיביוטיקה מתאימה. הערה: phagemid הביטוי Srna ניתן לקבל באמצעות שיבוט דה נובו כמתואר בשלב 1.1.5, או שונה מן phagemid קיים וקצר בשלב 1.2.16. </li><li style=";text-align:right;direction:rtl"> באופן דומה להכין תרבות 5 מ&quot;ל של E. coli נושאת פלסמיד עוזר M13KO7. לגדל את התאים לילה בשעה 37 ° C עם רעד, בתקשורת LB סלקטיבית. </li><li style=";text-align:right;direction:rtl"> חלץ ולטהר את expressio Srnan phagemid ו פלסמיד עוזר באמצעות ערכת חילוץ DNA או שיטה דומה 12. </li><li style=";text-align:right;direction:rtl"> Cotransform שנרכש או מוכן 13 חיידק מוסמך כימי עם 1 μl כל אחד phagemid ביטוי Srna ו פלסמיד עוזר. בחר עבור cotransformants ידי ציפוי על אגר LB עם אנטיביוטיקה סלקטיבית עבור שני המבנים. </li><li style=";text-align:right;direction:rtl"> הכן תרבות 10 מיליליטר ממושבה אחת של זן cotransformed ב LB עם אנטיביוטיקה סלקטיבית. לדגור על 37 מעלות צלזיוס עם רעד במשך 8-12 שעות או לילה. </li><li style=";text-align:right;direction:rtl"> צנטריפוגה התרבות ב 3,300 XG במשך 10 דקות. אסוף את supernatant ולסנן דרך פילטר 0.2 מיקרומטר. זהירות: במקרה של דליפת תקשורת, לנקות את האזור עם אקונומיקה מדוללת (0.5%) להרוס חלקיקים הפאג זיהומיות. </li><li style=";text-align:right;direction:rtl"> אחסן את התסנין הארוז phagemid על 4 מעלות צלזיוס. הערה: דוגמאות יכולות להישמר במשך ימים עד שבועות ללא הפסד של פעילות. </li></ol> 3. הכנת תאי F + יעד השתקה <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לקבוע אם התאים להיות ממוקד עבור השתקה לבטא את pilus F 14. אם pilus F קיים כבר, המשך לשלב 4. הערה: זני מעבדה משותפים של E. coli הוא מבואר כמו F + או F &#39;כדי לציין את נוכחותו של pilus F בגנום שלהם או על פלסמיד. </li><li style=";text-align:right;direction:rtl"> השג זן F + של E. coli כגון TOP10F &#39;. הערה: ודא כי מתח יעד נושא סמן התנגדות ייחודי כדי להפריד בין תורם F-פלסמיד לאחר הצמיד. </li><li style=";text-align:right;direction:rtl"> כדי להציג pilus F על ידי נטיה עם זן F +, להכין 5 מ&quot;ל תרבויות הן של זן היעד התורם F-פלסמיד 14. לגדל את התאים לילה בשעה 37 ° C עם רעד, בתקשורת LB עם אנטיביוטיקה מתאימה. </li><li style=";text-align:right;direction:rtl"> למחרת, לדלל שני זני 1: 100 ב 5 מ&quot;ל של LB סלקטיבית ולהמשיך culturing על 37 מעלות צלזיוס עם רעד. </li><li style=";text-align:right;direction:rtl"> לקבוע את שלב הצמיחה של תאים על ידי מדידת optצפיפות iCal של התרבות ב 600 ננומטר (OD 600) באמצעות ספקטרופוטומטר המעבדתיים. תרבות התאים למשך כ -2 שעות עד OD 600 של 0.3 מושגת, על צמיחת יומן פאזיים 15. </li><li style=";text-align:right;direction:rtl"> כן 3 תגובות נטיית צינורות microcentrifuge: 0.5 מיליליטר F-פלסמיד תורם + 0.5 מיליליטר זן יעד, 0.5 מיליליטר תורם F-פלסמיד + 0.5 מיליליטר תקשורת LB (שליטה שלילית) ו -0.5 מיליליטר זן יעד + 0.5 מיליליטר תקשורת LB (שליטה שלילית). אפשר הנטייה להמשיך במשך שעה 2 ב 37 מעלות צלזיוס עם רעד. </li><li style=";text-align:right;direction:rtl"> פלייט 100 μl של כל תגובה נטיה על אגר LB סלקטיבית עם אנטיביוטיקה ספציפית-פלסמיד F (בדרך כלל טטרציקלין) ומתח היעד. פלייט תגובות הבקרה השליליות על מנת לאשר כי לא תורמים או זן נמען מבטא הוא התנגדויות אנטיביוטיות. </li></ol> 4. זיהום עם Phagemids הארוז עבור השתקה <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לחסן מושבה אחת של תאים היעד F + לתוך תרבות 5 מ&quot;ל של Medi LBA עם אנטיביוטיקה מתאימה. דגירה לילה בשעה 37 ° C עם רעד. </li><li style=";text-align:right;direction:rtl"> למחרת, לדלל את תאי יעד F + 1: 100 ב 5 מיליליטר של תקשורת LB סלקטיבית ולהמשיך תרבות על 37 מעלות צלזיוס עם רעד. </li><li style=";text-align:right;direction:rtl"> לקבוע את שלב הצמיחה של התאים על ידי מדידת הצפיפות האופטית של התרבות ב 600 ננומטר (OD 600) באמצעות ספקטרופוטומטר המעבדתיים. תרבות התאים למשך כ -2 שעות עד OD 600 של 0.3 מושגת, על צמיחת יומן פאזיים 15. הערה: הביטוי של יעילות pilus וזיהום F הוא הגבוה ביותר בשלב יומן. </li><li style=";text-align:right;direction:rtl"> מוסיף את phagemids ארוז M13 (משלב 2.6) על תאי היעד ביחס נפח של 1: 100 להשיג כמעט זיהום 99% של אוכלוסיית היעד. אפשר הזיהום להמשיך ב 37 מעלות צלזיוס עם רעד במשך 30-60 דקות. </li><li style=";text-align:right;direction:rtl"> Assay הפנוטיפ Srna-השתקה לפי שיטת הבחירה. הערה: יעד חלבון פלואורסצנטי, השפעת ההשתקה ניתן לכמתישירות על ידי fluorometry 10. לחלופין, מבחני פנוטיפי ניתן להשתמש כדי לבחון את ההשלכות פנוטיפי של גן מציאת 8. </li><li style=";text-align:right;direction:rtl"> הכינו מלאי גליצרול עבור המארח phagemid Srna להביע ביצוע השלבים 1.2.14-1.2.16. הערה: phagemid יהיה להפיץ זן המארח ללא הגבלת זמן יכול להישמר עם אנטיביוטיקה דומה פלסמיד קונבנציונאלי. </li></ol>

<ol>
	<li>Ohkumo, T., Masutani, C., Eki, T., Hanaoka, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+RNAi+in+C.+elegans.">Use of RNAi in C. elegans.</a> RNAi. , 129-137 (2008).</li><li>Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A., Driver, S. E., Mello, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potent+and+specific+genetic+interference+by+double-stranded+RNA+in+Caenorhabditis+elegans.">Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans.</a> Nature. 391 (6669), 806-811 (1998).</li><li>Iordanou, E., Chandran, R. R., Blackstone, N., Jiang, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi+interference+by+dsRNA+injection+into+Drosophila+embryos.">RNAi interference by dsRNA injection into Drosophila embryos.</a> J Vis Exp. (50), e2477 (2011).</li><li>Ramadan, N., Flockhart, I., Booker, M., Perrimon, N., Mathey-Prevot, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design+and+implementation+of+high-throughput+RNAi+screens+in+cultured+Drosophila+cells.">Design and implementation of high-throughput RNAi screens in cultured Drosophila cells.</a> Nat Protoc. 2 (9), 2245-2264 (2007).</li><li>Tsong, T. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electroporation+of+cell+membranes.">Electroporation of cell membranes.</a> Biophys J. 60 (2), 297-306 (1991).</li><li>Kim, W. J., Chang, C. -. W., Lee, M., Kim, S. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+siRNA+delivery+using+water+soluble+lipopolymer+for+anti-angiogenic+gene+therapy.">Efficient siRNA delivery using water soluble lipopolymer for anti-angiogenic gene therapy.</a> J Control Release. 118 (3), 357-363 (2007).</li><li>Shi, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mammalian+RNAi+for+the+masses.">Mammalian RNAi for the masses.</a> Trends Genet. 19 (1), 9-12 (2003).</li><li>Na, D., Yoo, S. M., Chung, H., Park, H., Park, J. H., Lee, S. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metabolic+engineering+of+Escherichia+coli+using+synthetic+small+regulatory+RNAs.">Metabolic engineering of Escherichia coli using synthetic small regulatory RNAs.</a> Nat Biotechnol. 31 (2), 170-174 (2013).</li><li>Ceroni, F., Algar, R., Stan, G. -. B., Ellis, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantifying+cellular+capacity+identifies+gene+expression+designs+with+reduced+burden.">Quantifying cellular capacity identifies gene expression designs with reduced burden.</a> Nat Methods. 12 (5), 415-418 (2015).</li><li>Libis, V. K., Bernheim, A. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silencing+of+Antibiotic+Resistance+in+E.+coli+with+Engineered+Phage+Bearing+Small+Regulatory+RNAs.">Silencing of Antibiotic Resistance in E. coli with Engineered Phage Bearing Small Regulatory RNAs.</a> ACS Synth Biol. 3 (12), 1003-1006 (2014).</li><li>Ortiz, M. E., Endy, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineered+cell-cell+communication+via+DNA+messaging.">Engineered cell-cell communication via DNA messaging.</a> J Biol Eng. 6 (1), 16 (2012).</li><li>Edelheit, O., Hanukoglu, A., Hanukoglu, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simple+and+efficient+site-directed+mutagenesis+using+two+single-primer+reactions+in+parallel+to+generate+mutants+for+protein+structure-function+studies.">Simple and efficient site-directed mutagenesis using two single-primer reactions in parallel to generate mutants for protein structure-function studies.</a> BMC Biotechnol. 9 (1), 61 (2009).</li><li>Chung, C. T., Miller, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+and+storage+of+competent+Escherichia+coli+cells.">Preparation and storage of competent Escherichia coli cells.</a> Recombinant DNA Part I. , 621-627 (1993).</li><li>Phornphisutthimas, S., Thamchaipenet, A., Panijpan, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Conjugation+in+Escherichia+coli.">Conjugation in Escherichia coli.</a> Biochem Mol Biol Educ. 35 (6), 440-445 (2007).</li><li>Sezonov, G., Joseleau-Petit, D., D'Ari, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Escherichia+coli+Physiology+in+Luria-Bertani+Broth.">Escherichia coli Physiology in Luria-Bertani Broth.</a> J Bacteriol. 189 (23), 8746-8749 (2007).</li><li>Mittal, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improving+the+efficiency+of+RNA+interference+in+mammals.">Improving the efficiency of RNA interference in mammals.</a> Nat Rev Genet. 5 (5), 355-365 (2004).</li><li>Qi, L. S., Larson, M. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Repurposing+CRISPR+as+an+RNA-guided+platform+for+sequence-specific+control+of+gene+expression.">Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression.</a> Cell. 152 (5), 1173-1183 (2013).</li><li>Lu, T. K., Collins, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dispersing+biofilms+with+engineered+enzymatic+bacteriophage.">Dispersing biofilms with engineered enzymatic bacteriophage.</a> Proc Natl Acad Sci USA. 104 (27), 11197-11202 (2007).</li><li>Yosef, I., Manor, M., Kiro, R., Qimron, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Temperate+and+lytic+bacteriophages+programmed+to+sensitize+and+kill+antibiotic-resistant+bacteria.">Temperate and lytic bacteriophages programmed to sensitize and kill antibiotic-resistant bacteria.</a> Proc Natl Acad Sci USA. 112 (23), 7267-7272 (2015).</li><li>Karlsson, F., Malmborg-Hager, A. -. C., Albrekt, A. -. S., Borrebaeck, C. A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+comparison+of+phage+M13-infected+vs.+uninfected+Escherichia+coli.">Genome-wide comparison of phage M13-infected vs. uninfected Escherichia coli.</a> Can J Microbiol. 51 (1), 29-35 (2005).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Caveat+of+RNAi+in+plants:+the+off-target+effect.">Caveat of RNAi in plants: the off-target effect.</a> Methods in molecular biology. 744, 13-25 (2011).</li><li>Jackson, A. L., Linsley, P. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recognizing+and+avoiding+siRNA+off-target+effects+for+target+identification+and+therapeutic+application.">Recognizing and avoiding siRNA off-target effects for target identification and therapeutic application.</a> Nat Rev Drug Discov. 9 (1), 57-67 (2010).</li><li>Cho, S. W., Kim, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+off-target+effects+of+CRISPR/Cas-derived+RNA-guided+endonucleases+and+nickases.">Analysis of off-target effects of CRISPR/Cas-derived RNA-guided endonucleases and nickases.</a> Genome Res. 24 (1), 132-141 (2014).</li><li>Hagens, S., Blasi, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetically+modified+filamentous+phage+as+bactericidal+agents:+a+pilot+study.">Genetically modified filamentous phage as bactericidal agents: a pilot study.</a> Lett Appl Microbiol. 37 (4), 318-323 (2003).</li><li>Kasman, L. M., Kasman, A., Westwater, C., Dolan, J., Schmidt, M. G., Norris, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overcoming+the+phage+replication+threshold:+a+mathematical+model+with+implications+for+phage+therapy.">Overcoming the phage replication threshold: a mathematical model with implications for phage therapy.</a> J Virol. 76 (11), 5557-5564 (2002).</li><li>Chasteen, L., Ayriss, J., Pavlik, P., Bradbury, A. R. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Eliminating+helper+phage+from+phage+display.">Eliminating helper phage from phage display.</a> Nucleic Acids Res. 34 (21), e145 (2006).</li><li>Lu, T. K., Collins, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineered+bacteriophage+targeting+gene+networks+as+adjuvants+for+antibiotic+therapy.">Engineered bacteriophage targeting gene networks as adjuvants for antibiotic therapy.</a> Proc Natl Acad Sci USA. 106 (12), 4629-4634 (2009).</li><li>Bikard, D., Jiang, W., Samai, P., Hochschild, A., Zhang, F., Marraffini, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Programmable+repression+and+activation+of+bacterial+gene+expression+using+an+engineered+CRISPR-Cas+system.">Programmable repression and activation of bacterial gene expression using an engineered CRISPR-Cas system.</a> Nucleic Acids Res. 41 (15), 7429-7437 (2013).</li></ol>

The authors have nothing to disclose.

השיטה הנוכחית השיגה 80 הפחתת% ברמות קרינת mKate בהשוואה לקבוצת ביקורת לא ממוקדת. זו עולה בקנה אחד עם שיטות מציאה RNA אחרים, שבהם השתקה מוחלטת לא נצפו ויעילות 50-90% אופייני 16,17. ברמת פנוטיפי, knockdowns במיקוד CAT הצליח להחליש התנגדות chloramphenicol משמעותית, ולחסל אותו בתנאים מסוימים. פנוטיפ המציאה לא הורגש ברמת האוכלוסייה רק לאחר כמה שעות לאחר הדבקה (איור 3 ב). זה ממחיש תכונה חשובה של משלוח מבוסס הפאג: תדר מציאה גבוה ניתן להשיג ישירות בתרבות תצווה ללא הנדסה גנטית מוקדמת. בניגוד שינויים גנטיים קונבנציונליים באמצעות טרנספורמציה פלסמיד או אינטגרציה הגנומי, זיהום הפאג אינו מחייב כי אוכלוסייה מחדש גדלה ממושבה אחת מבודדת. זה מאפשר את ההשפעות של זיהום הפאג להיות Explored באוכלוסיות עם דינמיקה מרחבית מורכבת 11, עם מבנים מרחביים קיימים כמו biofilms 18, או באוכלוסיות טבעיות מעורבות גנטי 19. שלב קריטי שיטה זו הוא ייצור של phagemid ארוז ב כייל גבוה. נטל מטבוליות הקשורות ייצור החלקיקים הפאג עלול להוביל שיעור גבוה של מוטציה או הפסד פלסמיד ב זן הייצור phagemid. מומלץ כי זן ייצור phagemid להיות מתורבת ישירות ממושבת cotransformed יחידה ולא בקירור, קפוא או תת תרבות לפני הקציר הפאג. יעילות נמוכה של שינוי שיתוף יכול להיות גם ציין בעת השקת הפלסמיד phagemid ועוזרו כדי E. coli זמנית. במקרה זה, יעילות גבוהה יותר ניתן לקבל על ידי הפיכת פלסמיד עזר הראשונה, ולאחר מכן הכנת תאים מוסמכים הנושאת את הפלסמיד עוזר לטרנספורמציה הבא עם phagemid. Phaזיהום gemid או ביטוי Srna גם מטיל עומס מטבולים לזיהוי על תאי המטרה, ועלול לגרום לכך שחלק הפרעות פנוטיפי. לדוגמא, צמצום קרינת mKate2 נצפה גם כאשר תאים נדבקו עם CAT מיקוד phagemid (איור 3). זיהום עם M13 ככל הנראה אינו לעורר תגובות לחץ מערכתיות ב E. 20 coli, אך הוא עשוי לשנות את דפוסי תעתיק בעקיפין. לחילופין, סמנים GFP או התנגדות אמפיצילין כלל על phagemid עשויים להתחרות על משאבים הסלולר, הפחתת mKate2 ביטוי וצמיחה 9. לבסוף, קלטת Srna עצמו עשויה גלובלי לשנות פרופילי ביטוי גנים על ידי titrating חלבון Hfq, או באמצעות השתקת mRNA מחוץ יעד. תופעות יעד כבויות נפוצות in vivo RNAi מיקוד 21-23, אבל הם עדיין צריכים להיחקר באופן שיטתי עבור מערכת זו. מגבלה אחת של שיטה זו היא כי אפי זיהוםciency הוא פחות מ -100%, המאפשר כמה חיידקים שאינם נגועים להתמיד האוכלוסייה. את התוצאות של העבודה הזאת קודם לכן העבודה 10 מראים כי תאי noninfected לייצג 1-10% מהאוכלוסייה הסופי, וכן הם אחראים ביותר של פנוטיפים nonsilenced ציין. מגוון מסלולים-התנגדות M13 ידוע, עם אובדן מוטציוני להיות הנפוץ ביותר של ביטוי pilus 24. לאור המגבלות הללו, שולטים יש להשתמש כדי לאמת את שערי זיהום גבוהים ויעילות מציאה. הגבלת פוטנציאל נוספת עבור יישומים מסוימים היא העברת המזדמנים של זיהום הפאג עוזר. למרות M13K07 מכיל אות אריזת מוטציה, זה יכול להיות ארוז לתוך קפסיד הפאג בתדירות נמוכה והועבר אוכלוסיות נגועות, וכתוצאה מכך תאים מוסמכים לייצור הפאג והתפשטות משך הפאג מעבר לאירוע הזיהום הראשוני 25. עשיית שינויים הפאג עוזר הוכיחו יעילותלצמצם אריזה ספציפית, אם כי לפעמים על חשבון ייצור הפאג מופחת 26. בקטריופאג מהונדסים הפכו לכלי הכרחי עבור E. ביולוגיה סינתטית coli, המאפשר אספקה ​​מהירה של גנים חדשים הגידול באוכלוסייה. מחקר שנערך לאחרונה הפיק מעגלים תקשורת בין תאית 11 או הביעו גורמי שעתוק לדכא עמידות לאנטיביוטיקה מסלולים 27. הפרוטוקול המובא כאן מוסיף אוסף גדל והולך של כלים המאפשרים שליטת פיזיולוגית חיידקים באמצעות RNAs המתוכנת. Nucleases CRISPR-קאש, כאשר מוטציה לחסל פעילות nuclease, הוכחו להדחיק שעתוק לעבר מטרות הגן מונחה RNA 17,28. לעומת זאת, השתקת Srna עובדת ברמת translational ואינה דורשת ביטוי חלבון אקסוגני. ביוטכנולוגיות הדור הבא עשויה להתאחד מלאת translational ו תעתיק עם משלוח בתיווך הפאג לתכנת pheno מורכבסוגים בזמן אמת.

knockdowns הגן בתיווך RNA להמשיך בשני שלבים. ראשית, מולקולת רנ&quot;א הוא הציג קו תא או אורגניזם של המחקר. שנית, חלבונים קושרי RNA אנדוגני להקל הכרה RNA-היעד ולייצר אפקט השתקה. כל טכנולוגיות מציאת RNA ליהנות מן הטבע להתאמה האישי של sRNAs הסינטטי, אשר ניתן להפיק בקלות כדי להתאים למטרה ספציפית של עניין. עם זאת, את הפרטים המולקולריים של ספיגת RNA והשתקה להשתנות משמעותי על פני מערכת מודל, מגבילים איפה ואיך knockdowns RNA יכול להיות מיושם. נמטודות, RNA פעמיים תקועים (dsRNA) מולקולות יכול להיות מוצג באופן ישיר בתקשורת או על ידי האכלה תולעים עם אוכלוסייה של dsRNA להביע E. 1,2 קולי תאים. תסיסנית, RNAi יכול להיות מושגת על ידי microinjecting עוברים עם dsRNA 3, או מיושם שורות תאים פשוט על ידי הוספת dsRNA עד בינוני התרבות 4. בשורות תאי יונקים,RNAs התערבות קטנה סינתטי (siRNAs) עשויה להיות מועברת לתאים חיים על ידי electroporation 1,2,5, ארוזים ליפוזומים 3,6, או לידי ביטוי מתוך וקטורים פלסמיד דנ&quot;א 4,7. לאחר מינים RNA מגיע cytosol, מסלול RNAi מסתמך על מורכבות RISC לעבד dsRNA, להקל הכרה antisense של היעד, ולזרז את דיכוי translational, השפלה mRNA, או היווצרות heterochromatin, תלוי המארח. בגלל דרישות אלה, קלסי RNAi יכול להתבצע רק באורגניזמים כי תופסי RNA אקסוגניים ביעילות ולהביע RISC או פעילות RISC דמוית. יש לציין, זו אינה כוללת את חיידק מודל E. coli, אשר חסרה את מסלול RNAi. עם זאת, התקדמות ביולוגיה סינטתית לספק את הכלים לפתור גם את בעית המשלוח ובעית ההשתקה. בפרוטוקול זה, בונה Srna באים לידי ביטוי E. coli מן וקטור DNA נמסר liוינג התאים באמצעות מערכת phagemid / עוזר M13. Phagemid הוא כל פלסמיד עם ממוצא F1 הנגזרות הפאג של שכפול. פלסמיד עוזר, במקרה זה M13KO, נושאת את כל המנגנון הנדרש כדי לייצר חלקיקים נגיפיים, אך היא עצמה אינה מוסמכת לשכפול ואריזה. כאשר phagemid ו פלסמיד עוזר משתפים טרנספורמציה, phagemid לבד משוכפל בראשית הצירים F1, ארוז ומופרשת. Phagemid vectorized אז המוסמכות להדביק חי E. coli באמצעות pilus F. במערכת זו, ההשפעה השתקה מופק על ידי קלטות מנהג Srna שילוב רצף פיגום עם רצף מחייב היעד. רצף מחייב היעד הוא 24 זוגות בסיסים antisense כדי יעד mRNA, בדרך כלל באתר מחייב הריבוזום (RBS). רצף הפיגום, שפותח על ידי Na ועמיתיו 8, מכיל מוטיב מחייב Hfq מופק MICC, RNA רגולטוריים קטן אנדוגני E. coli. החלבון Hfq מגרה RNA-RNA bindin<html> g והשפלה mRNA, ממלאת את תפקידי במערכת זו דומה RISC ב RNAi. איור 1 מתאר תוכנית מלאה הנוקאוט Srna בתיווך הפאג, לרבות המבנה קלטת Srna, vectorization phagemid, ומנגנון השתקה. כשיטה לווסת ביטוי גנים א השתקת coli, Srna היא פשוטה, מהירה צדדית. וממוקדי E. coli הוא לא עמוס מעבר להפצת phagemid ומבטא את Srna. זה עשוי להיות רלוונטי בהקשר של ביולוגיה סינתטית או מחקר בסיסי מה מקור הביטוי של מבנים Heterologous גדול יכול להתאמץ משאבים הסלולר 9. Phagemids עם מטרות חדשות יכול להיות מיוצר עם יחיד PCR וקצר יום אחד לאחר שינוי phagemid. לבסוף, כמעט כל mRNA יכול להיות ממוקד. הקלטת תקנת Srna (על פלסמיד סטנדרטי) הוכחה לעבוד על מגוון רחב של מטרות במטבוליזם עם רמות דיכוי טיפוסיות&gt; 90% 8. ss = &quot;jove_content&quot;&gt; פרוטוקול זה מתרבה ומרחיב על העבודה קודמת באמצעות phagemid יליד Srna קלטות 10. ראשית, phagemid ארוז הוא הציג את התרבות אצווה של E. קולי תאים והשתמשו להשתיק ביטוי של חלבון פלואורסצנטי mKate2. שינויי קרינה לאחר מנוטר בזמן אמת. שנית, דריסת גן CAT מוצג להפחית התנגדות chloramphenicol פנוטיפי על צלחות אגרו. בשני המקרים, phagemid עצמה נושאת סמן GFP, המאפשר שיעור זיהום להימדד באופן בלתי תלוי את יעילות מציאה.

<table><tbody><tr><td>Plasmid Miniprep Kit</td><td>Qiagen</td><td>27104</td><td></td></tr><tr><td>DpnI Enzyme</td><td>NEB</td><td>R0176S</td><td></td></tr><tr><td>Phusion High Fidelity Polymerase</td><td>NEB</td><td>M0530S</td><td></td></tr><tr><td>Taq 2x Master Mix</td><td>NEB</td><td>M0270L</td><td></td></tr><tr><td>M13KO7 Helper Phage</td><td>NEB</td><td>N0315S</td><td></td></tr><tr><td>DH5&amp;alpha; Competent Cells</td><td>Life Technologies</td><td>18265-017</td><td></td></tr><tr><td>TOP10F&#039; Cells</td><td>Life Technologies</td><td>C3030-03</td><td></td></tr><tr><td>LB Broth</td><td>Sigma</td><td>L3022-250G</td><td></td></tr><tr><td>Ampicillin</td><td>Sigma</td><td>A9393-5G</td><td></td></tr><tr><td>Kanamycin</td><td>Sigma</td><td>60615-5G</td><td></td></tr><tr><td>Chloramphenicol</td><td>Sigma</td><td>C0378-5G</td><td></td></tr><tr><td>Tetracycline</td><td>Sigma</td><td>87128-25G</td><td></td></tr></tbody></table>

phage-mediated delivery of targeted srna constructs to knock down gene expression in e. coli

knockdowns בתיווך RNA נמצא בשימוש נרחב לשלוט ביטוי גנים. המשפחה צדדי זה של טכניקות עושה שימוש RNA קצר (Srna) כי יכול להיות מסונתז עם כל רצף שנועדו להשלים כל הגן ממוקד עבור השתקה. בגלל Srna בונה יכולה להיות מוצגת בפני סוגי תאים רבים ישירות או באמצעות מגוון של וקטורים, ביטוי גנים יכול להיות מודחק בתאים חיים ללא הנדסה גנטית מייגעת. הטכנולוגיה הנפוצה ביותר RNA מציאה, התערבות RNA (RNAi), עושה שימוש מושרה RNA אנדוגני השתקה מורכב (RISC) לתווך רצף הכרת המחשוף של mRNA היעד. יישומים של הטכניקה הזו ולכן מוגבלים RISC להביע אורגניזמים, אאוקריוטים בעיקר. לאחרונה, דור חדש של biotechnologists RNA פתח מנגנונים חלופיים לשליטת ביטוי גנים באמצעות RNA, וכך מתאפשר knockdowns גן בתיווך RNA בחיידקים. כאן אנו מתארים שיטה להשתקת הבעת גןשיאון ב E. coli מבחינה תיפקודית דומה RNAi. במערכת זו יש phagemid סינתטי נועד להביע Srna, אשר עשוי שנועד למקד כל רצף. בונת הביטוי מועברת לאוכלוסייה של E. קולי תאים עם הפאג M13 לא אלים, שלאחריו הוא מסוגל לשכפל כמו פלסמיד ביציבות. הכרה והשתקה אנטיסנס של mRNA היעד מתווכת על ידי חלבון Hfq, אנדוגני E. coli. פרוטוקול זה כולל שיטות לעיצוב antisense Srna, בניית וקטור phagemid, אריזת phagemid לתוך bacteriophage M13, הכנת האוכלוסייה תא חי עבור זיהום, וביצוע הזיהום עצמו. חלבון פלואורסצנטי mKate2 ואת acetyltransferase chloramphenicol גן עמידות לאנטיביוטיקה (CAT) ממוקדות להפיק נתונים נציג לכמת האפקטיביות מציאה.

השתקת mKate2 קרינת מדיה נוזלית איור 1 מתאר את ערכת הנוקאוט בתיווך Srna המתואר בעבודה זו, לרבות עיצוב קלטת Srna, vectorization phagemid, ומנגנון השתקה. בעקבות פרוטוקול 1.2, את הקלטת השתקה Srna של פלסמיד pAB.001 שונתה למקד mKate. הקלטת Srna היה synthetized ו משובטים לתוך phagemid Litmus28i_J23115-B0032-GFP, מתנת מוניקה אורטיז דרו אנדי 11. phagemid זו נושאת סמנים לביטוי GFP והתנגדות kanamycin, המאפשרת זיהומים מוצלחים להיות במעקב. מניות phagemid ארוזים הוכנו לאחר פרוטוקול 2. הוא נגזר של E. coli K12 MG1655 נושאת הביע constitutively, סמן mKate2 משולב כרומוזומלית הוכנה עבור זיהום הפאג ידי נטייה<html> עם זן תורם פלסמיד F בעקבות פרוטוקול 3. התאים גדלו לשלב יומן אמצע ואת phagemid הציג בעקבות פרוטוקול 4. לאחר ההדבקה phagemid, 200 תרבויות μl הועברו קורא צלחת פלואורסצנטי הקרינה היה פיקוח רציף במשך 24 שעות. איור 3 מראה את ההשפעה של השתקה בתיווך Srna על הביטוי mKate2. הזן נגוע עם phagemid אנטי mKate2 לא הראה קרינת mKate2 לגילוי מעל ברקע. בניגוד לכך, זן זה עשה להביע את הסמן GFP, המציין ספיגת המוצלח של phagemid. לתאי קבוצה נגועים מיוצרים קרינת mKate2 אבל לא GFP. פקד נוסף, שבו תחום מיקוד אנטי mKate2 הוחלף CAT מיקוד רצף, לא הייתה השפעה על הקרינה mKate2. השתקה של Chloramphenicol התנגדות על צלחות אגרו התוכן &quot;FO: keep-together.within-page =&quot; 1 &quot;&gt; בעקבות פרוטוקול 1.1, קלטת השתקה Srna הופק למקד CAT הוא נגזרת של E. coli K12 MG1655 נושאת הביע constitutively, סמן CAT משולבת כרומוזומלית הוכן עבור. זיהום הפאג ידי נטיה עם זן תורם F-פלסמיד בעקבות פרוטוקול 3. התאים גדלו לשלב יומן אמצע ואת phagemid הציג בעקבות פרוטוקול 4. לאחר שעה 1 של דגירה על 37 מעלות צלזיוס, תאים נגועים דוללו באופן סדרתי מצופה טווח הריכוזים chloramphenicol. צלחות הודגרו לילה, ואת חלקם של תאים עמידים בכל ריכוז chloramphenicol נקבע על ידי ספירת יחידות המושבה להרכיב (CFUs) למחרת. איור 4 מראה את ההשפעה של השתקה בתיווך Srna על הפנוטיפ התנגדות chloramphenicol. תאים נגועים, או תאים נגועים עם phagemid מיקוד mKate2, היו עמידיםchloramphenicol בכלל ריכוזי נבדק. לעומת זאת, תאים נגועים מיקוד phagemid CAT הראו מופחת הישרדות בריכוזים chloramphenicol נמוך, וכמעט 99% להרוג בריכוזים גבוהים. התוספת של אמפיצילין, כדי לבחור עבור חיידקים רק נושאים את phagemid, מופחת הישרדות chloramphenicol לרמות בלתי מורגשות. זה עולה בקנה אחד עם עבודה קודמת מראה שבריחה מזיהום הפאג הוא מסלול משותף לברוח השתקת 10. <img alt="איור 1" src="/files/ftp_upload/53618/53618fig1.jpg" /> איור 1: ג&#39;ין השתקה ב E. coli עם Srna ביטוי קלטות נמסר על ידי M13 הפאג קלטת Srna מורכבת 4 מודולים:. אמרגן PR (אמרגן מכונן נגזר למבדה bacteriophage), תחום מיקוד 24 נ&quot;ב, תחום מחייב Hfq מופק MICC ו שליחות קטלנית 8 תעתיק </sup&gt;. הקלטת משולב לתוך phagemid הנושאת את המקור שכפול F1 M13 וארוז לתוך קפסיד M13 באמצעות M13KO7 הפאג עוזר. Phagemids ארוז מסוגל להדביק E. coli המבטא את pilus F, שבו ביטוי Srna מתחיל. Srna ואז מגייס חלבון Hfq (המתואר באדום) ונקשר מטרת mRNA antisense סמוך לאתר מחייב הריבוזום, וכתוצאה מכך הדחקת translational ושפלת mRNA. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/53618/53618fig1large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 2" src="/files/ftp_upload/53618/53618fig2.jpg" /> איור 2:. עיצוב פריימר ואת לאתר בימוי mutagenesis באתר Srna יעד שני פריימרים נועדו עם הומולוגיה חלקית קלטת Srna הקיים. פריימר קדימה מכיל 20 נ&quot;ב הומולוגי אמרגן PR בסוף &#39;5, ואחריו24 נ&quot;ב המייצג את רצף המדריך החדש, אז 18 נ&quot;ב הומולוגי לתחום מחייב Hfq בסוף &#39;3. פריימר ההפוכה הוא משלים הפוך המדויק של פריימר קדימה, עם אזורים של הומולוגיה לקסטת Srna קיימת איגוף המשלים השני של רצף המדריך החדש. רצפים פריימר מדויקים מובאים בטבלה 3. PCR תגובות יחידה פריימר נפרדות עם קדימה פריימרים הפוכים לייצר ליניארי, דנ&quot;א חד-גדילים עם הרצף השונה הרצוי. חישול קדימה ואחורה תוצרי תגובה, לאחר לנקות כמתואר בפרוטוקול, תוצאות ב- DNA פלסמיד פעמים תקועות הנושאים את קלטת Srna השונה הרצויה. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/53618/53618fig2large.jpg" target="_blank">אנא לחצו כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 3" src="/files/ftp_upload/53618/53618fig3.jpg" /> איור 3: Knockdown של כתב ניאון כרומוזומלית משולב mKate2. E. coli MG1655 K12 להביע mKate2 היו או לא מטפלים בהם (הקווים האדומים וברים), נגוע עם phagemid אנטי mKate2 (קווים ירוקים וברים), או נגוע CAT מיקוד שליטה phagemid (קווים כחולים וברים). (א) מטופל E. coli גדל לצפיפויות רוויות גבוהות יותר, מה שמעיד על עלות מטבולית לזיהום הפאג. קווים מקווקווים מצביעים סטיית התקן של 3 חזרות. (ב) אות mKate2 הופחתה לרמות רקע הקרובות-mKate2 אנטי מטופלים ניטלים, אך לא זנים שליטים. (C) GFP הקרינה, גם נישאה על ידי phagemid, לא הורגשה רק שולט phagemid שטופל. (D, E) קריאות קרינה סופיות לאחר 24 שעות של צמיחה היו מנורמלות OD. אות ה- GFP, המציין זיהום phagemid, נעדר שולטת ללא טיפול, אלא גם הקטינה באופן משמעותי בעקבות p אנטי-CATטיפול hagemid. הדבר עשוי להעיד על השפעות חוץ-היעד של phagemid. אות mKate2 הופחתה טיפול phagemid אנטי mKate2 בהשוואה לקבוצת ביקורת שלא טופלה. Phagemid השליטה במיקוד CAT לא הראתה כל השפעה על קרינת mKate2. ברי שגיאה מייצגים סטיית התקן של 3 חזרות. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/53618/53618fig3large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 4" src="/files/ftp_upload/53618/53618fig4.jpg" /> איור 4: מציאה של CAT משחזר רגישות Chloramphenicol לאוכלוסייה גנטית עמידה א. coli MG1655 K12 להביע גן CAT משולב כרומוזומלית נותר ללא טיפול (מוטות אדומות), שטופל phagemid מלא מיקוד mKate2 (פסים ירוקים), או שטופל phagemid בעת-CAT אנטי Srna (סורגים כחולים). אחרי שעת 1 של זיהום, כדאיות על הנמלה הצביעהibiotics הוערכה על ידי דילולים ציפוי סדרתי. זנים שטופלו phagemid אנטי-CAT נהרגו משמעותי (&gt; 90%) על ידי chloramphenicol בריכוזים גבוהים, בעוד טיפולים מלאים לא הושפעו. הוספת אמפיצילין אל צלחות התרבות בוחר באופן חיובי עבור זיהום phagemid ומונע תאים נגועים. בתנאים אלה, אין מושבות עמידות chloramphenicol נצפו לאחר טיפול אנטי-CAT. זה מצביע על כך שרוב ניצולי מייצגי כישלון של זיהום, ולא כשל של השתקה. ברים שגיאה מייצגים את סטיית התקן של 3 חזרות. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/53618/53618fig4large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td> רצף יעד CAT </td><td> 5 &#39;- ATGGAGAAAAAAATCACTGGATAT - 3&#39; </td></tr><tr><td> רצף GUIDE CAT </td><html><td> 5 &#39;- ATATCCAGTGATTTTTTTCTCCAT - 3&#39; </td></tr></tbody></table> טבלת 1:. דוגמא TARGET ומדריך רצף עבור CAT ג&#39;ין הערת היחסים השלמים ההפוכים. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td> אמרגן PR </td><td colspan="5"> TAACACCGTGCGTGTTGACTATTTTACCTCTGGCGGTGATAATGGTTGC </td></tr><tr><td> רצף GUIDE </td><td colspan="5"> ATATCCAGTGATTTTTTTCTCCAT </td></tr><tr><td> תחום מחייב Hfq </td><td colspan="5"> TTTCTGTTGGGCCATTGCATTGCCACTGATTTTCCAACATATAAAAAGACAAGCCCGAACAGTCGTCCGGGCTTTTTT TCTCGAG </td></tr><tr><td> T1 / Terminator TE </td><td colspan="5"> CTCGAGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTTTTGTCGGTGAA CGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATA </td></tr></tbody></table>ether.within-page = &quot;1&quot;&gt; טבלה 2:. רכיבי רצף של קלטת Srna כל רצף כתוב 5&#39;-3 &#39;. הקלטת המלאה היא השרשור של 4 אלמנטים אלה כדי וכוללת 292 נ&quot;ב. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td> פריימר קדימה </td><td> 5 &#39;- CTGGCGGTGATAATGGTTGC [מדריך] TTTCTGTTGGGCCATTGC - 3&#39; </td></tr><tr><td> פריימר הפוך </td><td> 5 &#39;- GCAATGGCCCAACAGAAA [TARGET] GCAACCATTATCACCGCCAG - 3&#39; </td></tr></tbody></table> טבלה 3: פריימר עיצוב לאלטר אלמנטי GUIDE קיימים פריימר קדימה כולל את 20 נ&quot;ב האחרונים של אמרגן PR, רצף המדריך החדש, ואת נ&quot;ב 18 הראשונים של התחום מחייב Hfq.. רצף היעד הוא משלים ההפוך המדויק של רצף GUIDE. פריימר ההפוכה הוא משלים הפוך המדויק של פריימר קדימה. </p&gt; <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td> רְכִיב </td><td> כֶּרֶך </td></tr><tr><td> פלסמיד תבנית </td><td> 500 ננוגרם </td></tr><tr><td> 10 מיקרומטר פריימר </td><td> 2.5 μl </td></tr><tr><td> 10 מ&quot;מ dNTPs </td><td> 0.4 μl </td></tr><tr><td> פולימראז באיכות גבוהה (2 U / μl) </td><td> 0.5 μl </td></tr><tr><td> 5x PCR הצפה </td><td> 10 μl </td></tr><tr><td> נפח כולל </td><td> 50 μl </td></tr></tbody></table> לוח 4: מוצע תנאים לסינגל-פריימר מוטגנים PCR. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td> שָׁלָב </td><td> Temp </td><td> זְמַן </td></tr><tr><td> denaturation הראשונית </td><td> 98 ° C </td><td> 30 שניות </td></tr><tr><td rowspan="3"> 30 מחזורים </td><td> 98 ° C </td><td> 10 שניות </td></tr><tr><td> 55 ° C </td><td> 30 שניות </td></tr><tr><td> 72 ° C </td><td> 120 שניות </td></tr><tr><td> רחבה סופית </td><td> 72 ° C </td><td> 300 שניות </td></tr><tr><td> אִחסוּן </td><td> 10 ° C </td><td></td></tr></tbody></table> לוח 5: מוצע thermocycler פרוטוקול עבור יחיד פריימר מוטגנים PCR. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td> רְכִיב </td><td> כֶּרֶך </td></tr><tr><td> DNA תבנית </td><td> 1 μl </td></tr><tr><td> פריימר 10 מיקרומטר קדימה </td><td> 0.5 μl </td></tr><tr><td> פריימר 10 מיקרומטר הפוך </td><td> 0.5 μl </td></tr><tr><td> מערבבים תקי 2X מאסטר </td><td> 25 μl </td></tr><tr><td> wate nuclease ללאr </td><td> 23 μl </td></tr><tr><td> נפח כולל </td><td> 50 μl </td></tr></tbody></table> לוח 6: מוצע תנאים עבור PCR אימות הרצף. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td> שָׁלָב </td><td> Temp </td><td> זְמַן </td></tr><tr><td> denaturation הראשונית </td><td> 95 ° C </td><td> 30 שניות </td></tr><tr><td rowspan="3"> 30 מחזורים </td><td> 95 ° C </td><td> 30 שניות </td></tr><tr><td> 55 ° C </td><td> 30 שניות </td></tr><tr><td> 68 ° C </td><td> 30 שניות </td></tr><tr><td> רחבה סופית </td><td> 68 ° C </td><td> 300 שניות </td></tr><tr><td> אִחסוּן </td><td> 10 ° C </td><td></td></tr></tbody></table> לוח 7: מוצע thermocycler Protocol עבור PCR אימות הרצף.

Watch this Scientific Journal Video about Phage-mediated Delivery of Targeted sRNA Constructs to Knock Down Gene Expression in E. coli at JoVE.com

Phage-mediated Delivery of Targeted sRNA Constructs to Knock Down Gene Expression in E. coli

We describe a method to knock down gene expression in a growing population of E. coli cells using sequence-targeted sRNA expression cassettes delivered by an M13 phagemid vector.

משלוח בתיווך הפאג של ממוקדת Srna בונה להפיל Gene Expression ב<em&gt; E. coli</em

RNA-mediated knockdowns are widely used to control gene expression. This versatile family of techniques makes use of short RNA (sRNA) that can be ...

phage-mediated-delivery-targeted-srna-constructs-to-knock-down-gene

Universidad de Cartagena UDEC

Research

JoVE Journal

Biology

Phage-mediated Delivery of Targeted sRNA Constructs to Knock Down Gene Expression in E. coli

12.5K Views.  Institut National de la Santé et de la Recherche Médicale (INSERM), Université Paris Descartes. We describe a method to knock down gene expression in a growing population of E. coli cells using sequence-targeted sRNA expression cassettes delivered by an M13 phagemid vector.

Video: Phage-mediated Delivery of Targeted sRNA Constructs to Knock Down Gene Expression in E. coli

High efficiency, Site-specific Transfection of Adherent Cells with siRNA Using Microelectrode Arrays (MEA)

The discovery of RNAi pathway in eukaryotes and the subsequent development of RNAi agents, such as siRNA and shRNA, have achieved a potent method for silencing specific genes1-8 for functional genomics and therapeutics. A major challenge involved in RNAi based studies is the delivery of RNAi agents to targeted cells. Traditional non-viral delivery techniques, such as bulk electroporation and chemical transfection methods often lack the necessary spatial control over delivery and afford poor transfection efficiencies9-12. Recent advances in chemical transfection methods such as cationic lipids, cationic polymers and nanoparticles have resulted in highly enhanced transfection efficiencies13. However, these techniques still fail to offer precise spatial control over delivery that can immensely benefit miniaturized high-throughput technologies, single cell studies and investigation of cell-cell interactions. 
Recent technological advances in gene delivery have enabled high-throughput transfection of adherent cells14-23, a majority of which use microscale electroporation. Microscale electroporation offers precise spatio-temporal control over delivery (up to single cells) and has been shown to achieve high efficiencies19, 24-26. Additionally, electroporation based approaches do not require a prolonged period of incubation (typically 4 hours) with siRNA and DNA complexes as necessary in chemical based transfection methods and lead to direct entry of naked siRNA and DNA molecules into the cell cytoplasm. As a consequence gene expression can be achieved as early as six hours after transfection27. Our lab has previously demonstrated the use of microelectrode arrays (MEA) for site-specific transfection in adherent mammalian cell cultures17-19. In the MEA based approach, delivery of genetic payload is achieved via localized micro-scale electroporation of cells. An application of electric pulse to selected electrodes generates local electric field that leads to electroporation of cells present in the region of the stimulated electrodes. The independent control of the micro-electrodes provides spatial and temporal control over transfection and also enables multiple transfection based experiments to be performed on the same culture increasing the experimental throughput and reducing culture-to-culture variability. 
Here we describe the experimental setup and the protocol for targeted transfection of adherent HeLa cells with a fluorescently tagged scrambled sequence siRNA using electroporation. The same protocol can also be used for transfection of plasmid vectors. Additionally, the protocol described here can be easily extended to a variety of mammalian cell lines with minor modifications. Commercial availability of MEAs with both pre-defined and custom electrode patterns make this technique accessible to most research labs with basic cell culture equipment.

High efficiency, Site-specific Transfection of Adherent Cells with siRNA Using Microelectrode Arrays MEA

The article details the protocol for site-specific transfection of scrambled sequence of siRNA in an adherent mammalian cell culture using a microelectrode array (MEA).

יעילות גבוהה Transfection, אתר ספציפי של תאים חסידים עם siRNA שימוש במערכי microelectrode (MEA)

The discovery of RNAi pathway in eukaryotes and the subsequent development of RNAi agents, such as siRNA and shRNA, have achieved a potent method for ...

Bioengineering

CRISPR Guide RNA Cloning for Mammalian Systems

The outlined protocol describes streamlined methods for the efficient and cost-effective generation of Cas9-associated guide RNAs. Two alternative strategies for guide RNA (gRNA) cloning are outlined based on the usage of the Type IIS restriction enzyme BsmBI in combination with a set of compatible vectors. Outside of the access to Sanger sequencing services to validate the generated vectors, no special equipment or reagents are required aside from those that are standard to modern molecular biology laboratories. The outlined method is primarily intended for cloning one single gRNA or one paired gRNA-expressing vector at a time. This procedure does not scale well for the generation of libraries containing thousands of gRNAs. For those purposes, alternative sources of oligonucleotide synthesis such as oligo-chip synthesis are recommended. Finally, while this protocol focuses on a set of mammalian vectors, the general strategy is plastic and is applicable to any organism if the appropriate gRNA vector is available.

Here, a simple, efficient, and cost-effective method of sgRNA cloning is outlined.

CRISPR מדריך ה-RNA שיבוט בתרבית של מערכות

The outlined protocol describes streamlined methods for the efficient and cost-effective generation of Cas9-associated guide RNAs. Two alternative ...

Genetics

Producing Gene Deletions in Escherichia coli by P1 Transduction with Excisable Antibiotic Resistance Cassettes

A first approach to study the function of an unknown gene in bacteria is to create a knock-out of this gene. Here, we describe a robust and fast protocol for transferring gene deletion mutations from one Escherichia coli strain to another by using generalized transduction with the bacteriophage P1. This method requires that the mutation be selectable (e.g., based on gene disruptions using antibiotic cassette insertions). Such antibiotic cassettes can be mobilized from a donor strain and introduced into a recipient strain of interest to quickly and easily generate a gene deletion mutant. The antibiotic cassette can be designed to include flippase recognition sites that allow the excision of the cassette by a site-specific recombinase to produce a clean knock-out with only a ~100-base-pair-long scar sequence in the genome. We demonstrate the protocol by knocking out the tamA gene encoding an assembly factor involved in autotransporter biogenesis and test the effect of this knock-out on the biogenesis and function of two trimeric autotransporter adhesins. Though gene deletion by P1 transduction has its limitations, the ease and speed of its implementation make it an attractive alternative to other methods of gene deletion.

Producing Gene Deletions in Escherichia coli by P1 Transduction with Excisable Antibiotic Resistance Cassettes

Here we present a protocol for the use of pre-existing antibiotic resistance-cassette deletion constructs as a basis for making deletion mutants in other E. coli strains. Such deletion mutations can be mobilized and inserted into the corresponding locus of a recipient strain using P1 bacteriophage transduction.

הפקת ג'ין מחיקות ב- Escherichia coli מאת P1 התמרה חושית עם קלטות עמידות לאנטיביוטיקה ניתן לניתוח

A first approach to study the function of an unknown gene in bacteria is to create a knock-out of this gene. Here, we describe a robust and fast protocol ...

DNA Vector-based RNA Interference to Study Gene Function in Cancer

RNA interference (RNAi) inhibits gene expression by specifically degrading target mRNAs. Since the discovery of double-stranded small interference RNA (siRNA) in gene silencing1, RNAi has become a powerful research tool in gene function studies. Compared to genetic deletion, RNAi-mediated gene silencing possesses many advantages, such as the ease with which it is carried out and its suitability to most cell lines. Multiple studies have demonstrated the applications of RNAi technology in cancer research. In particular, the development of the DNA vector-based technology to produce small hairpin RNA (shRNA) driven by the U6 or H1 promoter has made long term and inducible gene silencing possible2,3. Its use in combination with genetically engineered viral vectors, such as lentivirus, facilitates high efficiencies of shRNA delivery and/or integration into genomic DNA for stable shRNA expression. 
We describe a detailed procedure using the DNA vector-based RNAi technology to determine gene function, including construction of lentiviral vectors expressing shRNA, lentivirus production and cell infection, and functional studies using a mouse xenograft model. 
Various strategies have been reported in generating shRNA constructs. The protocol described here employing PCR amplification and a 3-fragment ligation can be used to directly and efficiently generate shRNA-containing lentiviral constructs without leaving any extra nucleotide adjacent to a shRNA coding sequence. Since the shRNA-expression cassettes created by this strategy can be cut out by restriction enzymes, they can be easily moved to other vectors with different fluorescent or antibiotic markers. Most commercial transfection reagents can be used in lentivirus production. However, in this report, we provide an economic method using calcium phosphate precipitation that can achieve over 90% transfection efficiency in 293T cells. Compared to constitutive shRNA expression vectors, an inducible shRNA system is particularly suitable to knocking down a gene essential to cell proliferation. We demonstrate the gene silencing of Yin Yang 1 (YY1), a potential oncogene in breast cancer4,5, by a Tet-On inducible shRNA system and its effects on tumor formation. Research using lentivirus requires review and approval of a biosafety protocol by the Biosafety Committee of a researcher's institution. Research using animal models requires review and approval of an animal protocol by the Animal Care and Use Committee (ACUC) of a researcher's institution.

RNA interference (RNAi) possesses many advantages over gene knockout and has been broadly used as a tool in gene functional studies. The invention of DNA vector-based RNAi technology has made long term and inducible gene knockdown possible, and also increased the feasibility of gene silencing in vivo.

וקטור מבוסס DNA התערבות RNA ללמוד לתפקד גנים סרטן

RNA interference (RNAi) inhibits gene expression by specifically degrading target mRNAs. Since the discovery of double-stranded small interference RNA ...

Medicine

Application of CRISPR Interference (CRISPRi) for Gene Silencing in Pathogenic Species of Leptospira

Leptospirosis is a global neglected zoonosis, responsible for at least 1 million cases per year and almost 60 thousand deaths. The disease is caused by pathogenic and virulent bacteria of the genus Leptospira, either by direct contact with the bacteria or indirectly by exposure to contaminated water or soil. Domestic and wild animals act as reservoir hosts of infection, shedding leptospires from colonized renal tubules of the kidney, via urine, into the environment. The generation of mutant strains of Leptospira is critical to evaluate and understand pathogenic mechanisms of infection. CRISPR interference (CRISPRi) has proven to be a straightforward, affordable, and specific tool for gene silencing in pathogenic Leptospira. Therefore, the methodological details of obtaining the plasmid constructs containing both dCas9 and guide RNA, delivery of plasmids to Leptospira by conjugation with the E. coli strain &#946;2163, and transconjugant recovery and evaluation, will be described. In addition, the recently described Hornsby-Alt-Nally (HAN) media allows for the relatively rapid isolation and selection of mutant colonies on agar plates.

Application of CRISPR Interference CRISPRi for Gene Silencing in Pathogenic Species of Leptospira

Here, the application of CRISPR interference (CRISPRi) for specific gene silencing in Leptospira species is described. Leptospira cells are transformed by conjugation with plasmids expressing dCas9 (catalytically "dead" Cas9) and a single-guide RNA (sgRNA), responsible for base pairing to the desired genomic target. Methods to validate gene silencing are presented.

יישום הפרעות CRISPR (CRISPRi) להשתקת גנים במינים פתוגניים של לפטוספירה

Leptospirosis is a global neglected zoonosis, responsible for at least 1 million cases per year and almost 60 thousand deaths. The disease is caused by ...

Bacterial Delivery of RNAi Effectors: Transkingdom RNAi

RNA interference (RNAi) represents a high effective mechanism for specific inhibition of mRNA expression. Besides its potential as a powerful laboratory tool, the RNAi pathway appears to be promising for therapeutic utilization. For development of RNA interference (RNAi)-based therapies, delivery of RNAi-mediating agents to target cells is one of the major obstacles. A novel strategy to overcome this hurdle is transkingdom RNAi (tkRNAi). This technology uses non-pathogenic bacteria, e.g. Escherichia coli, to produce and deliver therapeutic short hairpin RNA (shRNA) into target cells to induce RNAi. A first-generation tkRNAi-mediating vector, TRIP, contains the bacteriophage T7 promoter for expression regulation of a therapeutic shRNA of interest. Furthermore, TRIP has the Inv locus from Yersinia pseudotuberculosis that encodes invasin, which permits natural noninvasive bacteria to enter &beta;1-integrin-positive mammalian cells and the HlyA gene from Listeria monocytogenes, which produces listeriolysin O. This enzyme allows the therapeutic shRNA to escape from entry vesicles within the cytoplasm of the target cell. TRIP constructs are introduced into a competent non-pathogenic Escherichia coli strain, which encodes T7 RNA polymerase necessary for the T7 promoter-driven synthesis of shRNAs. A well-characterized cancer-associated target molecule for different RNAi strategies is ABCB1 (MDR1/P-glycoprotein, MDR1/P-gp). This ABC-transporter acts as a drug extrusion pump and mediates the "classical" ABCB1-mediated multidrug resistance (MDR) phenotype of human cancer cells which is characterized by a specific cross resistance pattern. Different ABCB1-expressing MDR cancer cells were treated with anti-ABCB1 shRNA expression vector bearing E. coli. This procedure resulted in activation of the RNAi pathways within the cancer cells and a considerable down regulation of the ABCB1 encoding mRNA as well as the corresponding drug extrusion pump. Accordingly, drug accumulation was enhanced in the pristine drug-resistant cancer cells and the MDR phenotype was reversed. By means of this model the data provide the proof-of-concept that tkRNAi is suitable for modulation of cancer-associated factors, e.g. ABCB1, in human cancer cells.

For development of RNA interference (RNAi)-based therapies, a novel strategy was developed, transkingdom RNAi (tkRNAi). This technology uses non-pathogenic bacteria to produce and deliver therapeutic short hairpin RNA (shRNA) into target cells. Here, tkRNAi was successfully applied for reversal of classical ABCB1-mediated multidrug resistance (MDR) of cancer cells.

משלוח חיידקית של RNAi effectors: Transkingdom RNAi

RNA interference (RNAi) represents a high effective mechanism for specific inhibition of mRNA expression. Besides its potential as a powerful laboratory ...

In Vitro Selection of Engineered Transcriptional Repressors for Targeted Epigenetic Silencing

Gene inactivation is instrumental to study gene function and represents a promising strategy for the treatment of a broad range of diseases. Among traditional technologies, RNA interference suffers from partial target abrogation and the requirement for life-long treatments. In contrast, artificial nucleases can impose stable gene inactivation through induction of a DNA double strand break (DSB), but recent studies are questioning the safety of this approach. Targeted epigenetic editing via engineered transcriptional repressors (ETRs) may represent a solution, as a single administration of specific ETR combinations can lead to durable silencing without inducing DNA breaks.
ETRs are proteins containing a programmable DNA-binding domain (DBD) and effectors from naturally occurring transcriptional repressors. Specifically, a combination of three ETRs equipped with the KRAB domain of human ZNF10, the catalytic domain of human DNMT3A and human DNMT3L, was shown to induce heritable repressive epigenetic states on the ETR-target gene. The hit-and-run nature of this platform, the lack of impact on the DNA sequence of the target, and the possibility to revert to the repressive state by DNA demethylation on demand, make epigenetic silencing a game-changing tool. A critical step is the identification of the proper ETRs&#39; position on the target gene to maximize on-target and minimize off-target silencing. Performing this step in the final ex vivo or in vivo preclinical setting can be cumbersome.
Taking the CRISPR/catalytically dead Cas9 system as a paradigmatic DBD for ETRs, this paper describes a protocol consisting of the in vitro screen of guide RNAs (gRNAs) coupled to the triple-ETR combination for efficient on-target silencing, followed by evaluation of the genome-wide specificity profile of top hits. This allows for reduction of the initial repertoire of candidate gRNAs to a short list of promising ones, whose complexity is suitable for their final&#160;evaluation in the therapeutically relevant setting of interest.

In Vitro Selection of Engineered Transcriptional Repressors for Targeted Epigenetic Silencing

Here, we present a protocol for the in vitro selection of engineered transcriptional repressors (ETRs) with high, long-term, stable, on-target silencing efficiency and low genome-wide, off-target activity. This workflow allows for reducing an initial, complex repertoire of candidate ETRs to a short list, suitable for further evaluation in therapeutically relevant settings.

במבחנה בחירת מדכאי שעתוק מהונדסים להשתקה אפיגנטית ממוקדת

Gene inactivation is instrumental to study gene function and represents a promising strategy for the treatment of a broad range of diseases. Among ...

Effective Oral RNA Interference (RNAi) Administration to Adult Anopheles gambiae Mosquitoes

RNA interference has been a heavily utilized tool for reverse genetic analysis for two decades. In adult mosquitoes, double-stranded RNA (dsRNA) administration has been accomplished primarily via injection, which requires significant time and is not suitable for field applications. To overcome these limitations, here we present a more efficient method for robust activation of RNAi by oral delivery of dsRNA to adult Anopheles gambiae. Long dsRNAs were produced in Escherichia coli strain HT115 (DE3), and a concentrated suspension of heat-killed dsRNA-containing bacteria in 10% sucrose was offered on cotton balls ad-libitum to adult mosquitoes. Cotton balls were replaced every 2 days for the duration of the treatment. Use of this method to target doublesex (a gene involved in sex differentiation) or fork head (which encodes a salivary gland transcription factor) resulted in reduced target gene expression and/or protein immunofluorescence signal, as measured by quantitative Real-Time PCR (qRT-PCR) or fluorescence confocal microscopy, respectively. Defects in salivary gland morphology were also observed. This highly flexible, user-friendly, low-cost, time-efficient method of dsRNA delivery could be broadly applicable to target genes important for insect vector physiology and beyond.

Effective Oral RNA Interference RNAi Administration to Adult Anopheles gambiae Mosquitoes

The oral administration of dsRNA produced by bacteria, a delivery method for RNA interference (RNAi) that is routinely used in Caenorhabditis elegans, was successfully applied here to adult mosquitoes. Our method allows for robust reverse genetics studies and transmission-blocking vector studies without the use of injection.

מתן יעיל של הפרעת RNA דרך הפה (RNAi) ליתושים אנופלס גמביה בוגרים

RNA interference has been a heavily utilized tool for reverse genetic analysis for two decades. In adult mosquitoes, double-stranded RNA (dsRNA) ...

Phage Transduction: A Method to Transfer Ampicillin Resistance from Donor to Recipient E. coli

Source: Alexander S. Gold1, Tonya M. Colpitts1 
1 Department of Microbiology, Boston University School of Medicine, National Emerging Infections Diseases Laboratories, Boston, MA
Transduction is a form of genetic exchange between bacteria that utilizes bacteriophages, or phages, a class of virus that infects exclusively prokaryotic organisms. This form of DNA transfer, from one bacterium to another by way of a phage, was discovered in 1951 by Norton Zinder and Joshua Ledererg, who termed the process &#34;transduction&#34; (1). Bacteriophages were first discovered in 1915 by British bacteriologist Frederick Twort, then independently discovered again in 1917 by French-Canadian microbiologist Felix d&#39;Herelle (2). Since then, the structure and function of these phages have been widely characterized (3), dividing these phages into two classes. The first of these classes are the lytic phages which upon infection multiply within the host bacterium, disrupting the bacterial metabolism, lysing the cell, and releasing progeny phage (4). As a result of this anti-bacterial activity and the increasing prevalence of antibiotic-resistant bacteria, these lytic phages have recently proved useful as a substitute treatment for antibiotics. The second of these classes are the lysogenic phages which can either multiply within the host via the lytic cycle or enter a quiescent state in which their genome is integrated into that of the host (Figure 1), a process known as lysogeny, with the ability for phage production to be induced in multiple later generations (4).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/10517/10517fig1.jpg" /> 
Figure 1: Infection of host cell by bacteriophage. Adsorption by the phage to the bacterial cell wall via interactions between the tail fibers and receptor (purple). Once on the cell surface, the phage is irreversibly attached to the bacterial cell using the base plate (black) which is moved to the cell wall by the contractile sheath (yellow). Phage genome (red) then enters the cell and integrates into the host cell genome.
While bacterial transduction is a naturally occurring process, using modern technology it has been manipulated for the transfer of genes into bacteria in the laboratory setting. By inserting genes of interest into the genome of a lysogenic phage, such as phage, one is able to transfer these genes into the genomes of bacteria and consequently express them within these cells. While other methods of gene transfer, such as transformation, use a plasmid for gene transfer and expression, the insertion of the phage genome into that of the recipient bacterium not only has the potential to confer new traits to this bacterium, but also allows for naturally occurring mutations and other factors of the cellular environment to alter the function of the transferred gene.
Compared to other methods of horizontal gene transfer, such as conjugation, transduction is fairly flexible in the criteria required for donor and recipient cells. Any genetic element that can fit inside the genome of the phage being used can be transferred from any strain of donor bacteria to any strain of recipient bacteria as long as both are permissive to the phage, requiring the expression of necessary phage receptors on the cell surfaces. Once this gene is moved out of the donor genome and packaged into the phage, it can be transferred to the recipient. Following transduction, it is necessary to select for recipient bacteria that contain the gene of interest have to be selected for. This could be done by use of a genetic marker, such as a FLAG-tag or polyhistidine-tag, to mark the gene of interest, or the intrinsic function of the gene, in the case of genes that encode for antibiotic resistance. Additionally, PCR could be used to further confirm successful transduction. By using primers for a region within the gene of interest and comparing signal to a positive control, bacteria that has the gene of interest, and a negative control, bacteria that underwent the same steps as the transduction reaction with no phage. While bacterial transduction is a useful tool in molecular biology, it has and continues to play an important role in the evolution of bacteria, particularly with regard to the recent rise of antibiotic resistance.
In this experiment, bacterial transduction was used to transfer the gene encoding for resistance to the antibiotic ampicillin from the W3110 strain of E.coli to the J53 strain via the P1 bacteriophage (5). This experiment consisted of two main steps. First, the preparation of P1 phage containing the ampicillin resistance gene from the donor strain. Second, the transfer of this gene to the recipient strain by transduction with the P1 phage (Figure 1). Once carried out, the successful transfer of the ampicillin resistance gene could be determined by qPCR (Figure 2). If transduction was successful, the J53 strain of E. coli would be resistant to ampicillin, and the gene conferring this resistance detectable by qPCR. If unsuccessful, there would be no detection of the ampicillin resistance gene and ampicillin would still function as an effective antibiotic against the J53 strain.

<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/10517/10517fig2.jpg" /> 
Figure 2: The confirmation of successful transduction by qPCR. By comparing the Cq values detected for the gene of interest from the transduction reaction and the negative control reaction, and normalizing these values against a housekeeping gene, one was able to confirm that bacterial transduction was successful.

Phage Transduction: Transferring Ampicillin Resistance in E. coli

טרנסדוקציה של פאג': שיטה להעברת עמידות לאמפיצ'ילין מתורם לנמען E. coli

Source: Alexander S. Gold1, Tonya M. Colpitts1
1 Department of Microbiology, Boston University School of Medicine, National Emerging Infections Diseases ...

Education

JoVE Science Education

Advanced Biology

Microbiology

RNAi Plating for C. elegans Feeding: A Technique to Induce Target dsRNA Expression in E. coli

Source: Kolundzic, E., et al. <a href="https://jove.unicartagenaproxy.elogim.com/video/56889/application-rnai-heat-shock-induced-transcription-factor-expression">Application of RNAi and Heat-shock-induced Transcription Factor Expression to Reprogram Germ Cells to Neurons in&#160;C. elegans</a>.&#160;J. Vis. Exp.&#160;(2018).
This video describes the principles behind RNAi treatment in C. elegans and demonstrates a protocol to knockdown lin-35 in a transgenic worm strain.

ציפוי RNAi עבור C. elegans Feeding: טכניקה להשראת ביטוי dsRNA מטרה ב- E. coli

Source: Kolundzic, E., et al. Application of RNAi and Heat-shock-induced Transcription Factor Expression to Reprogram Germ Cells to Neurons in&#160;C. ...

משלוח בתיווך הפאג של ממוקדת Srna בונה להפיל Gene Expression ב

Summary

Explore More Videos

Chapters in this video