Os autores agradecem a Kristen Bullard-Feibelman, Milena Veselinovic e Claudia Rückert por sua assistência na caracterização do vírus derivado de clones. Este trabalho foi apoiado em parte por doações do Instituto Nacional de Alergia e Doenças Infecciosas, NIH sob subsídios AI114675 (BJG) e AI067380 (GDE).

1. Transformação e Recuperação de Plasmídeos de Clone Infecciosos <ol><li> Transforme ambos os plasmídeos (separadamente) usando um protocolo de transformação comercial ( por exemplo , NEB 5 Minute Transformation Protocol) com algumas modificações. Ambos os plasmídeos contêm um gene que codifica a resistência à ampicilina, portanto, use ampicilina ou carbenicilina para seleção. A carbanilhilina é preferida, pois é mais estável. <ol><li> Remova as células (veja a Tabela de Materiais) a partir de um congelador de -80 ° C e descongelar no gelo durante 5-10 min. Caldo de lisogenia de pré-aquecimento (LB) (contendo placas de 10 g / L de NaCl e 25 μg / mL de carbenicilina, chamadas LB-carb) e o caldo com repressão de catabolitos (SOC (sem antibióticos) - chegando com as células) a 37 ° C. </li><li> Adicionar entre 100 pg-10 ng em 1 μL de ADN plasmídico a um tubo contendo 50 μL de células competentes; Misture suavemente acendendo o tubo. </li><li> Incubar tubos em gelo durante 5 min. </li><li> Tubos de choque térmico a 42 ° C durante 30 sEm banho-maria. Retorne ao gelo durante 2 minutos imediatamente após choque térmico. </li><li> Pipetar 950 μL de temperatura ambiente COS em cada tubo e misturar por pipetagem. Distribuir 100 μL da mistura bacteriana sobre uma placa LB-carb e incubar durante a noite a 37 ° C (aproximadamente 12-14 h). </li></ol></li><li> Retire as placas da incubadora a 37 ° C após 12-14 h de incubação. Coloque as placas em uma gaveta escura à temperatura ambiente para permitir que as colônias continuem a crescer (aproximadamente 8-9 h). </li><li> Usando 5 mL de caldo Terrific (TB, contendo 25 μg / mL de carbenicilina, chamado TB-carb), cresça 5-10 pequenas colônias para cada plasmídeo durante a noite a 30 ° C em um agitador bacteriano (aproximadamente 14-16 h). NOTA: As pequenas colônias são um indicador de que o plasmídeo está intacto; Colônias com plasmídeos contendo deleções, rearranjos ou mutações (aqui denominados eventos de instabilidade) crescerão mais rapidamente e, portanto, serão maiores. Portanto, deve-se tentar escolher as colônias mais pequenas na placa, especificamente nãoT selecionando as maiores colônias presentes. Algumas colônias de tamanho médio também podem ser selecionadas para integridade. A menor temperatura utilizada reduz a probabilidade de as células serem superadas (OD 600 acima de 0,6-0,8). Como a maioria dos pesquisadores realiza um crescimento durante a noite, ele permite mais controle e menor chance de crescimento excessivo. </li><li> Verifique as culturas líquidas para turbidez (aproximadamente OD 600 de 0,6-0,8). Coloque os tubos turvos a 4 ° C e permita que outros tubos se tornem turvos crescendo por mais tempo. NOTA: Não produza bactérias para OD 600 valores maiores que o recomendado, pois podem ocorrer eventos de instabilidade plasmídica. </li><li> Extrair DNA de plasmídeo de bactérias com um kit de miniprep de plasmídeo comercial (ver Tabela de Materiais). Eluir em 15 μL de tampão de eluição pré-aquecido (até 70 ° C em um bloco de aquecimento). Permitir que o tampão de eluição incuba na coluna durante 5 minutos antes da centrifugação. NOTA: Preserve pelo menos 1 mL desta cultura inicial a 4 ° C paraMais uma vez na próxima etapa. </li><li> Digerir 10 μL dos plasmídeos recuperados para avaliar se os eventos de instabilidade plasmídica ocorreram durante a cultura. NOTA: digerir p1 com SalI / NheI e p2 com BamHI / HindIII a 37 ° C durante 1 h. Confirme a presença das bandas corretas após a digestão ( Figura 2a ) por eletroforese em gel e avance para o passo 2. Se estiver preparando DNA de plasmídeo por amplificação do círculo de rolamento (RCA), reserve alguns dos eluentes de miniprep para servir como modelo. </li></ol> 2. Preparação de ADN de plasmídeo suficiente para ligadura NOTA: A ligação e a subsequente eletroporação requerem uma quantidade suficiente de DNA plasmídico que deve ser gerado através de maxiprep ou RCA. Embora a maxiprep seja a abordagem tradicionalmente utilizada, a RCA oferece a vantagem de não requerer bactérias, eliminando o potencial de toxicidade induzida por plasmídeos em bactérias que podem resultar em eventos de instabilidade. <ol><li><stRong&gt; Execute o seguinte procedimento de maxiprep. <ol><li> Para cada plasmídeo que demonstrou o padrão de digestão da enzima de restrição correto na seção anterior, adicione 500 μL de cultura de iniciador a 1 L de carbeno de TB-Carb (25 μg / mL) e agite durante a noite a 30 ° C (aproximadamente 14-16 h , Aproximadamente OD 600 de 0,6-0,8). NOTA: Não permita que a cultura cresça sobre este valor OD 600 . Isso irá potencialmente resultar em eventos de instabilidade dentro dos plasmídeos. </li><li> Colhe as bactérias e realize maxipreps por protocolo do fabricante (veja Tabela de Materiais). </li></ol></li><li> Usando o miniprep salvo da etapa 1.6, execute o seguinte para o procedimento RCA. <ol><li> Transferir 1 μL de ADN plasmídico para um tubo contendo 50 μL de tampão de amostra. </li><li> Desnaturar a amostra a 95 ° C durante 3 minutos e depois incubar a 4 ° C até estar pronto para usar. </li><li> Prepare a amplificação comercialPré -mistura (ver tabela de materiais ). Combine 50 μL de tampão de reação com 2 μL de mistura enzimática em um conjunto de tubos em gelo. NOTA: A pré-amplificação deve ser mantida em gelo até estar pronta para uso. É conveniente preparar uma mistura principal combinando reagentes suficientes para o número necessário de reações de amplificação. Qualquer pré-mistura não utilizada deve ser descartada. </li><li> Transferir 50 μL de pré-mistura de amplificação preparada para a amostra desnaturada. </li><li> Incubar os tubos de reação a 30 ° C durante 18 h. </li><li> Incubar os tubos a 65 ° C durante 10 min para inativar a polimerase de DNA ø29. </li><li> Armazene os tubos de reação a 4 ° C ou -20 ° C até estar pronto para uso. NOTA: Neste ponto, o DNA de plasmídeo preparado através de ambos os métodos deve ser quantificado (usando absorvância a 260 nm) e o genoma de ZIKV deve ser Sanger sequenciado inteiramente para confirmar que não ocorreram eventos de instabilidade (deleções e rearranjos) durante a preparação. </li></ol></li></ol><table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Nome do Primer </td><td> Sequência (5 &#39;- 3&#39;) </td></tr><tr><td> ZIKV PRVABC59 1For. </td><td> AGTTGTTGATCTGTGTGAATCAGAC </td></tr><tr><td> ZIKV Conserved 632For. </td><td> GCCCTATGCTGGATGAGG </td></tr><tr><td> ZIKV Conserved 692Rev. </td><td> GGTTCCGTACACAACcCAAGTTG </td></tr><tr><td> ZIKV Conserved 1313Rev. </td><td> CTCCCTTTGCCAAAAAGTCCACA </td></tr><tr><td> ZIKV Conserved 1201For. </td><td> CCAACACAAGGTGAAGCCTAC </td></tr><tr><td> ZIKV Conserved 1663For. </td><td> GCAGACACCGGAACTCCACACT </td></tr><tr><td> ZIKV Conserved 2008For. </td><td> CAGATGGCGGTGGACATGC </td></tr><tr><td> ZIKV Conserved 2350Rev. </td><td> GTGAGAACCAGGACATTCCTCC </td></tr><tr><td> ZIKV Conserved 2605For. </td><td> TACAAGTACCATCCTGACTCCC </td></tr><tr><td> ZIKV Conserved 3499Rev. </td><td>GCCTTATCTCCATTCCATACCA </td></tr><tr><td> ZIKV Conserved 3961Rev. </td><td> TTGCCAACCAGGCCAAAG </td></tr><tr><td> ZIKV Conserved 4132For. </td><td> CATTTGTCATGGCCCTGG </td></tr><tr><td> ZIKV Conserved 4561Rev. </td><td> CTATTGGGTTCATGCCACAGAT </td></tr><tr><td> ZIKV Conserved 4665For. </td><td> GACCACAGATGGAGTGTACAGAGT </td></tr><tr><td> ZIKV Conserved 5189Rev. </td><td> AAGACAGTTAGCTGCTTCTTCTTCAG </td></tr><tr><td> ZIKV Conserved 5219For. </td><td> GAGAGTTCTTCCTGAAATAGTCCGTGA </td></tr><tr><td> ZIKV Conserved 6086Rev. </td><td> CTTGCTTCAAGCCAGTGTGC </td></tr><tr><td> ZIKV Conserved 6119For. </td><td> GCCTCATAGCCTCGCTCTATCG </td></tr><tr><td> ZIKV Conserved 6721Rev. </td><td> CCATTCCAAAGCCCATCTTCCC </td></tr><tr><td> ZIKV Conserved 6769For. </td><td> CCAGCCAGAATTGCATGTGTCC </td></tr><tr><td> ZIKV Conserved 7209Rev. </td><td> ATCATTAGCAGCGGGACTCCAA </td></tr><tr><td> ZIKV Conservado 7343Para. </td><td> GTTGTGGATGGAATAGTGGT </td></tr><tr><td> ZIKV Conserved 8243For. </td><td> TGCCCATACACCAGCACTATGA </td></tr><tr><td> ZIKV PRVABC59 8893Rev. </td><td> TGCATTGCTACGAACCTTGTTG </td></tr><tr><td> ZIKV conservou 9133Para. </td><td> AGCCCTTGGATTCTTGAACGAGGA </td></tr><tr><td> ZIKV PRVABC59 9673Rev. </td><td> AACGCAATCATCTCCACTGACT </td></tr><tr><td> ZIKV Conserved 9686For. </td><td> GATGATAGGTTTGCACATGCC </td></tr><tr><td> ZIKV Conserved 10321Rev. </td><td> GTCCATGTACTTTTCTTCATCACCTAT </td></tr><tr><td> ZIKV Conserved 10455For. </td><td> CAGGAGAAGCTGGGAAACC </td></tr><tr><td> ZIKV Conserved 10621Rev. </td><td> CAGATTGAAGGGTGGGGAAGGTC </td></tr></tbody></table> Tabela 1: Primers para sequenciação de clones de cDNA. Os plasmídeos podem ser sequenciados inteiramente com os primers listados. Primers marcados como &quot;conservados&quot; indiCate que provavelmente são capazes de seqüenciar / amplificar todos os genótipos de ZIKV. Os primers rotulados como &quot;PRVABC59&quot; são específicos desta cepa, mas também podem funcionar para outras estirpes de genótipos asiáticos e possivelmente outros genótipos. 3. Preparação de ARN transcrito in vitro <ol><li> Configure a reação de digestão de DNA maxiprep ou RCA preparado. <ol><li> Para a digestão com p1, misture 10 μL de tampão de reação 10x, 3 μL de ApaLI, 3 μL de BamHI-HF, 3 μL de rSAP ou CIP e 3,3 μg de DNA p1. Adicione ddH 2 O a 100 μL. </li><li> Para a digestão com p2, misture 10 μL de 10x de tampão de reação, 3 μL de ApaLI, 3 μL de EcoRI-HF e 13,3 μg de DNA de p2. Adicione ddH 2 O a 100 μL. </li><li> Incubar a 37 ° C por 1-2 h. </li><li> Purifique usando um gel comercial e um kit de limpeza de PCR (veja a Tabela de Materiais). Eluir em 30 μL de tampão de eluição pré-aquecido a 70 ° C em um bloco de aquecimento (incubar oColuna por 5 min antes de girar). NOTA: Mantenha 1 μL para funcionar em um gel mais tarde. </li></ol></li><li> Prepare a reação de ligação. <ol><li> Combina 10 μL de tampão de reacção de ligação de ADN T4 10x, 3 μL de T4 DNA ligase (400 U / μL), 29 μL de p1 purificado e 29 μL de p2 purificado. Adicione ddH 2 O a 100 μL. </li><li> Incubar à temperatura ambiente durante 2 h ou 16 ° C durante a noite. </li><li> Purifique usando um gel comercial e um kit de limpeza de PCR (veja a Tabela de Materiais). Eluir em 10 μL de tampão de eluição pré-aquecido a 70 ° C em um bloco de aquecimento (incubar coluna durante 5 minutos antes de girar). NOTA: Mantenha 1 μL para funcionar em um gel mais tarde. </li></ol></li><li> Executar plasmídeos não digeridos, plasmídeos digeridos e ligação em um gel de agarose. O produto de ligação deve ter uma banda de peso molecular mais elevado (cerca de 11 kb) do que o plasmídeo digerido isolado, indicando que a ligação foi bem sucedida ( Figura 2b ).</li><li> Configure a reação de transcrição in vitro T7. <ol><li> Combine 10 μL de mistura ARCA / NTP 2x, 2 μL de mistura de ARN polimerase T7 e 8 μL de reação de ligação purificada para um volume final de 20 μL. NOTA: O ARCA incluído na mistura é um sensor analógico que é incorporado exclusivamente na orientação correta. Os análogos da capa padrão podem resultar em apenas ~ 50% dos transcritos com uma tampa na orientação correta. </li><li> Incubar durante 4 h a 37 ° C. </li><li> Medir a concentração de ARN através de um espectrofotômetro UV. Opcionalmente, execute um gel de agarose desnaturante para confirmar o comprimento da transcrição de RNA. </li></ol></li></ol> 4. Resgate de vírus infeccioso por eletroporação <ol><li> Dias antes da eletroporação, preparar 1 balão T182 de células Vero (entre T150 e T182 é aceitável, cultivado em DMEM + 10% de soro fetal bovino (FBS)) por construção a ser recuperada. Inclua 1 T182 como um controle de transfecção simulada. CeLls devem ser utilizados em uma confluência de 70-80%. </li><li> Quando as células estão prontas, coloque 12 mL / reação de DMEM + 15% de FBS + 10 mM de HEPES em um banho de água aquecido a 37 ° C. </li><li> Descarte as células por tripsinização com um protocolo padrão e recupera as células na mídia com FBS a 10% para inativar a tripsina; Centrifugação de células a 150 xg durante 5 min a 4 ° C. </li><li> Lavar células em 1x solução salina tamponada com fosfato (PBS), células de sedimentação a 150 xg durante 5 min a 4 ° C. Repita este passo duas vezes para um total de três lavagens. </li><li> Ressuspender células em 200 μL de RPMI 1640 + HEPES 10 mM (estéril) por número de amostras. Transfira 200 μL de suspensão celular para um tubo estéril. As células devem ser ~ 0,5 x 10 7 células / mL. </li><li> Adicionar 20 μL de água (mock neg control) ou 20 μL de RNA (de preferência 5-10 μg) produzido no passo 3.4 para cada conjunto de células. Misture suavemente puxando o tubo e transfira o conteúdo do tubo para uma cubeta de eletroporação de intervalo de 2 mm. </li><li> Defina um elétronOporador para 170 V LV, omega (resistência) a 0 e 950 μF (aproximadamente a 625 V / cm e 20 ms constante para outras máquinas). Configure a resistência à configuração mais baixa disponível, seja 0 ou ∞ se disponível. </li><li> Pulso uma vez e imediatamente adicionar 600 μL de DMEM + 15% FBS + 10 mM HEPES que foi aquecido no passo 4.2. Enxágue dentro da cuvete cuidadosamente para remover todas as células. Adicionar células a um balão de cultura de tecido T75 contendo 10 mL de meio pré aquecido. Remova a mídia adicional da cuvete usando o conta-gotas que acompanha a cuvete. Tenha cuidado para manter a esterilidade. </li><li> Balão de redemoinho para misturar meios e células e colocar em uma incubadora de 37 ° C. </li><li> Verifique no dia seguinte a viabilidade celular e faça-o todos os dias até 50-75% de morte celular. A morte celular é observada comparando-se ao mock controle eletroporado. NOTA: O efeito citopático ZIKV (CPE) é bastante pronunciado nas células Vero, resultando em células arredondadas que se destacam e flutuam no meio de cultura. Nós temosObservou uma faixa de 8-10 dias como ideal para a colheita. </li><li> Coloque o sobrenadante em um tubo cônico e centrifugue para remover detritos celulares a&gt; 3,000 xg durante 10 min a 4 ° C. </li><li> Remova o sobrenadante esclarecido para um novo tubo e adicione-o com uma concentração final de FBS a 20% (de 100% de estoque). Adicionalmente, adicione HEPES estéril a uma concentração final de 10 mM como agente tampão para preservar a infecciosidade do vírus enquanto está congelado (a partir de um estoque esterilizado de 1 M). </li><li> Misture o vírus por vórtice e alíquota em frascos de tampa roscada. Armazene a -80 ° C para uso futuro. </li></ol> 5. Titulação do vírus recuperado <ol><li> Seed o número apropriado de placas de 6 ou 12 poços de células Vero no dia anterior à titulação. </li><li> Remova o vírus do congelador e faça diluições em série de 10 vezes em DMEM + 2% de FBS em tubos ou placas de 96 poços. NOTA: O título esperado dos clones recuperados é entre 1 x 10 6 e 5 x 10 7 PFU / mL. </li><li> Adicione 200 oR 400 μL de cada diluição em duplicado para um poço de uma placa de 12 ou 6 poços, respectivamente. </li><li> Coloque as placas em uma incubadora a 37 ° C e roote a cada 15 minutos, para um período total de ~ 1-1,5 h de adsorção. </li><li> Remova o inóculo viral e adicione 1 mL de (12 poços) ou 2 mL (6 poços) de aderência DMGM-Tragacanto a cada poço. NOTA: É possível usar agarose, ágar, metilcelulose ou outro meio de sobreposição aqui. </li><li> Incubar células em incubadora a 37 ° C durante 5 dias. O tempo para a formação adequada da placa irá variar dependendo da sobreposição utilizada. </li><li> Para consertar células, remova as placas da incubadora e decanta a sobreposição suavemente em desinfetante. </li><li> Adicione suficiente 20% de etanol / 0,1% de violeta de cristal (CV) a cada poço para cobrir e girar para misturar. NOTA: Muitos outros fixadores existem e podem ser usados ​​aqui. Além disso, se estiver usando uma sobreposição de agarose ou ágar, uma segunda sobreposição pode ser usada em conjunto com vermelho neutro para visualizar placas sem fixação. 20% de etanol mostrou-se serEficaz na inativação de vírus envolvidos em estudos anteriores; Não use esse valor para vírus não envolvidos, pois não serão inativados 19 . </li><li> Incube as placas durante 30-60 minutos à temperatura ambiente (num gabinete de biossegurança de classe II); Descarte CV (por regulação local) e lave as placas com água da torneira. </li><li> Deixe as placas secar e contamine as placas manualmente. NOTA: Referência 20 pode ser usado como uma referência adicional para realizar ensaios de placa. </li></ol>

<ol>
	<li>Kindhauser, M. K., Allen, T., Frank, V., Santhana, R. S., Dye, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika:+the+origin+and+spread+of+a+mosquito-borne+virus.">Zika: the origin and spread of a mosquito-borne virus.</a> Bull World Health Organ. 94 (9), 675C-686C (2016).</li><li>Oehler, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika+virus+infection+complicated+by+Guillain-Barre+syndrome--case+report,+French+Polynesia,+December+2013.">Zika virus infection complicated by Guillain-Barre syndrome--case report, French Polynesia, December 2013.</a> Euro Surveill. 19 (9), (2014).</li><li>Li, D., Aaskov, J., Lott, W. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+cryptic+prokaryotic+promoter+within+the+cDNA+encoding+the+5'+end+of+dengue+virus+RNA+genome.">Identification of a cryptic prokaryotic promoter within the cDNA encoding the 5' end of dengue virus RNA genome.</a> PLoS One. 6 (3), e18197 (2011).</li><li>Pu, S. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+approach+to+propagate+flavivirus+infectious+cDNA+clones+in+bacteria+by+introducing+tandem+repeat+sequences+upstream+of+virus+genome.">A novel approach to propagate flavivirus infectious cDNA clones in bacteria by introducing tandem repeat sequences upstream of virus genome.</a> J Gen Virol. 95 (Pt 7), 1493-1503 (2014).</li><li>Pu, S. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Successful+propagation+of+flavivirus+infectious+cDNAs+by+a+novel+method+to+reduce+the+cryptic+bacterial+promoter+activity+of+virus+genomes.">Successful propagation of flavivirus infectious cDNAs by a novel method to reduce the cryptic bacterial promoter activity of virus genomes.</a> J Virol. 85 (6), 2927-2941 (2011).</li><li>Rice, C. M., Grakoui, A., Galler, R., Chambers, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+of+infectious+yellow+fever+RNA+from+full-length+cDNA+templates+produced+by+in+vitro+ligation.">Transcription of infectious yellow fever RNA from full-length cDNA templates produced by in vitro ligation.</a> New Biol. 1 (3), 285-296 (1989).</li><li>Yun, S. I., Kim, S. Y., Rice, C. M., Lee, Y. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+application+of+a+reverse+genetics+system+for+Japanese+encephalitis+virus.">Development and application of a reverse genetics system for Japanese encephalitis virus.</a> J Virol. 77 (11), 6450-6465 (2003).</li><li>Gualano, R. C., Pryor, M. J., Cauchi, M. R., Wright, P. J., Davidson, A. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+major+determinant+of+mouse+neurovirulence+of+dengue+virus+type+2+using+stably+cloned+genomic-length+cDNA.">Identification of a major determinant of mouse neurovirulence of dengue virus type 2 using stably cloned genomic-length cDNA.</a> J Gen Virol. 79 (Pt 3), 437-446 (1998).</li><li>Johansen, I. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intron+insertion+facilitates+amplification+of+cloned+virus+cDNA+in+Escherichia+coli+while+biological+activity+is+reestablished+after+transcription+in+vivo.">Intron insertion facilitates amplification of cloned virus cDNA in Escherichia coli while biological activity is reestablished after transcription in vivo.</a> Proc Natl Acad Sci U S A. 93 (22), 12400-12405 (1996).</li><li>Shan, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Infectious+cDNA+Clone+of+Zika+Virus+to+Study+Viral+Virulence,+Mosquito+Transmission,+and+Antiviral+Inhibitors.">An Infectious cDNA Clone of Zika Virus to Study Viral Virulence, Mosquito Transmission, and Antiviral Inhibitors.</a> Cell Host Microbe. 19 (6), 891-900 (2016).</li><li>Schwarz, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rescue+of+the+1947+Zika+Virus+Prototype+Strain+with+a+Cytomegalovirus+Promoter-Driven+cDNA+Clone.">Rescue of the 1947 Zika Virus Prototype Strain with a Cytomegalovirus Promoter-Driven cDNA Clone.</a> mSphere. 1 (5), (2016).</li><li>Tsetsarkin, K. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Full-Length+Infectious+cDNA+Clone+of+Zika+Virus+from+the+2015+Epidemic+in+Brazil+as+a+Genetic+Platform+for+Studies+of+Virus-Host+Interactions+and+Vaccine+Development.">A Full-Length Infectious cDNA Clone of Zika Virus from the 2015 Epidemic in Brazil as a Genetic Platform for Studies of Virus-Host Interactions and Vaccine Development.</a> MBio. 7 (4), (2016).</li><li>Gadea, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+robust+method+for+the+rapid+generation+of+recombinant+Zika+virus+expressing+the+GFP+reporter+gene.">A robust method for the rapid generation of recombinant Zika virus expressing the GFP reporter gene.</a> Virology. 497, 157-162 (2016).</li><li>Kapoor, M., Zhang, L., Mohan, P. M., Padmanabhan, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthesis+and+characterization+of+an+infectious+dengue+virus+type-2+RNA+genome+(New+Guinea+C+strain).">Synthesis and characterization of an infectious dengue virus type-2 RNA genome (New Guinea C strain).</a> Gene. 162 (2), 175-180 (1995).</li><li>Messer, W. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+characterization+of+a+reverse+genetic+system+for+studying+dengue+virus+serotype+3+strain+variation+and+neutralization.">Development and characterization of a reverse genetic system for studying dengue virus serotype 3 strain variation and neutralization.</a> PLoS Negl Trop Dis. 6 (2), e1486 (2012).</li><li>Kinney, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avian+virulence+and+thermostable+replication+of+the+North+American+strain+of+West+Nile+virus.">Avian virulence and thermostable replication of the North American strain of West Nile virus.</a> J Gen Virol. 87 (Pt 12), 3611-3622 (2006).</li><li>Chang, A. C., Cohen, S. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+and+characterization+of+amplifiable+multicopy+DNA+cloning+vehicles+derived+from+the+P15A+cryptic+miniplasmid.">Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid.</a> J Bacteriol. 134 (3), 1141-1156 (1978).</li><li>Weger-Lucarelli, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+Characterization+of+Recombinant+Virus+Generated+from+a+New+World+Zika+Virus+Infectious+Clone.">Development and Characterization of Recombinant Virus Generated from a New World Zika Virus Infectious Clone.</a> J Virol. 91 (1), (2017).</li><li>Roberts, P. L., Lloyd, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus+inactivation+by+protein+denaturants+used+in+affinity+chromatography.">Virus inactivation by protein denaturants used in affinity chromatography.</a> Biologicals. 35 (4), 343-347 (2007).</li><li>Baer, A., Kehn-Hall, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+concentration+determination+through+plaque+assays:+using+traditional+and+novel+overlay+systems.">Viral concentration determination through plaque assays: using traditional and novel overlay systems.</a> J Vis Exp. (93), e52065 (2014).</li><li>Weger-Lucarelli, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+Characterization+of+Recombinant+Virus+Generated+from+a+New+World+Zika+Virus+Infectious+Clone.">Development and Characterization of Recombinant Virus Generated from a New World Zika Virus Infectious Clone.</a> J Virol. , (2016).</li><li>Grubaugh, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+Drift+during+Systemic+Arbovirus+Infection+of+Mosquito+Vectors+Leads+to+Decreased+Relative+Fitness+during+Host+Switching.">Genetic Drift during Systemic Arbovirus Infection of Mosquito Vectors Leads to Decreased Relative Fitness during Host Switching.</a> Cell Host Microbe. 19 (4), 481-492 (2016).</li></ol>

Os autores não têm nada a revelar.

Here we describe a method for the recovery of a bipartite infectious cDNA clone system for ZIKV. Previously described clones for ZIKV suffer from either attenuation or require the addition of introns, making plasmids larger and preventing rescue in insect cells. Infectious virus can be recovered using the two-plasmid clone system in either mammalian or insect cells (data not shown). In addition, virus recovered from this system behaves similarly to wild-type virus in several cell lines, in an immunocompromised mouse mode...

O vírus Zika (ZIKV; Família Flaviviridae : Gênero Flavivírus ) é um flavivírus transmitido por mosquito que chegou ao Brasil em 2013-14 e posteriormente foi associado a um surto maciço de doença febril que se espalhou pelas Américas 1 . Além disso, o ZIKV tem sido associado a desfechos graves da doença, como a síndrome de Guillain-Barré em adultos e microcefalia em fetos e neonatos 2 . Pouco se sabia sobre ZIKV antes da sua rápida propagação no hemisfério ocidental. Isso incluiu a falta de ferramentas moleculares, dificultando assim a pesquisa mecanicista. Ferramentas moleculares para vírus, tais como clones de cDNA infecciosos, facilitam a vacina e o desenvolvimento terapêutico antiviral e permitem a avaliação de fatores genéticos virais relacionados à patogênese viral diferencial, resposta imune e evolução viral. Os clones infecciosos de Flavivirus são conhecidos por serem altamente instáveis ​​em bactérias devido a crPromotores procarióticos ypticos presentes em seus genomas 3 . Várias abordagens têm sido usadas para melhorar esse problema; Incluindo a inserção de repetições em tandem a montante das sequências virais 4 , mutação das seqüências promotoras procarióticas putativas 5 , dividindo o genoma em múltiplos plasmídeos 6 , vetores numéricos de baixa cópia (incluindo cromossomos artificiais bacterianos) 7 , 8 e inserção de intrões no genoma viral 9 . Um sistema completo sem modificações foi descrito para ZIKV; No entanto, este clone pareceu ser atenuado na cultura celular e em camundongos 10 . Outros grupos criaram intrões no genoma de ZIKV, permitindo a interrupção de seqüências instáveis ​​em bactérias que podem ser empalmadas em células de mamíferos in vitro para a produção de vírus infecciosos 11, 12 . Além disso, um sistema baseado em PCR, intitulado Infectious-Subgenomic-Amplicons, foi utilizado com sucesso para resgatar o protótipo MR766 de ZIKV 13 . A abordagem descrita aqui não requer seqüências estranhas, mas sim interrompe o genoma na região de alta instabilidade usando múltiplos plasmídeos, que já foram utilizados com sucesso com vírus da febre amarela 6 , dengue 14 , 15 e do Nilo Ocidental 16 . Além disso, a adição da sequência de ribozima da hepatite D no terminal genômico viral facilita a criação de um autêntico final 3 &#39;sem a necessidade de adicionar um site de linearização. Além disso, ambos os plasmídeos são construídos em um vetor de números de baixa cópia (pACYC177, ~ 15 cópias por célula) para mitigar qualquer toxicidade residual 17 . O vírus recuperado exibe um perfil de crescimento comparável aoVírus parental em curvas de crescimento in vitro em 8 linhas celulares compreendendo uma variedade de tipos de células derivadas de mamíferos e insetos e exibiu perfis patogênicos idênticos em camundongos e taxas de infecção, disseminação e transmissão em mosquitos 18 . Aqui, detalhamos um protocolo descrevendo como cultivar os plasmídeos de clones infecciosos, gerar RNA viral completo (o genoma viral) in vitro e recuperar vírus infecciosos em cultura celular. Primeiro, descrevemos a propagação de plasmídeos em bactérias ou amplificação sem bactérias usando amplificação do círculo circulante (RCA). Em seguida, mostramos como os dois plasmídeos são digeridos e subsequentemente ligados em conjunto para gerar vírus de comprimento total. Finalmente, descrevemos a produção de ARN transcrito e sua subsequente eletroporação em células Vero, seguidas de titulação de vírus recuperado ( Figura 1 ). A abordagem descrita é rápida, permitindo queR recuperação de stocks de vírus infecciosos em 1-2 semanas.

<table><tbody><tr><td>NEB Stable CompetentE. coli</td><td>New England BioLabs</td><td>C3040H</td><td></td></tr><tr><td>Carbenicillin, Disodium Salt</td><td>various</td><td></td><td></td></tr><tr><td>Zyppy Plasmid Miniprep Kit</td><td>Zymo Research</td><td>D4036</td><td></td></tr><tr><td>ZymoPURE Plasmid Maxiprep Kit</td><td>Zymo Research</td><td>D4202</td><td></td></tr><tr><td>SalI-HF</td><td>New England BioLabs</td><td>R3138S</td><td>20,000 units/ml</td></tr><tr><td>NheI-HF</td><td>New England BioLabs</td><td>R3131S</td><td>20,000 units/ml</td></tr><tr><td>ApaLI</td><td>New England BioLabs</td><td>R0507S</td><td>10,000 units/ml</td></tr><tr><td>EcoRI-HF</td><td>New England BioLabs</td><td>R3101S</td><td>20,000 units/ml</td></tr><tr><td>BamHI-HF</td><td>New England BioLabs</td><td>R3136S</td><td>20,000 units/ml</td></tr><tr><td>HindIII-HF</td><td>New England BioLabs</td><td>R3104S</td><td>20,000 units/ml</td></tr><tr><td>illustra TempliPhi 100 Amplification Kit</td><td>GE Healthcare Life Sciences</td><td>25640010</td><td></td></tr><tr><td>NucleoSpin Gel and PCR Clean-up</td><td>Macherey-Nagel</td><td>740609.5</td><td></td></tr><tr><td>Shrimp Alkaline Phosphatase (rSAP)</td><td>New England BioLabs</td><td>M0371S</td><td>1,000 units/ml</td></tr><tr><td>Alkaline Phosphatase, Calf Intestinal (CIP)</td><td>New England BioLabs</td><td>M0290S</td><td>10,000 units/ml</td></tr><tr><td>T4 DNA Ligase</td><td>New England BioLabs</td><td>M0202S</td><td>400,000units/mL</td></tr><tr><td>HiScribe T7 ARCA mRNA Kit</td><td>New England BioLabs</td><td>E2065S</td><td></td></tr><tr><td>Vero cells</td><td>ATCC</td><td>CCL-81</td><td></td></tr><tr><td>ECM 630 High Throughput Electroporation System</td><td>BTX</td><td>45-0423</td><td>Other machines are acceptable.</td></tr><tr><td>LB Broth with agar (Miller)</td><td>Sigma</td><td>L3147</td><td>Can be homemade as well.</td></tr><tr><td>Terrific Broth</td><td>Sigma</td><td>T0918</td><td>Can be homemade as well.</td></tr><tr><td>Petri Dish</td><td>Celltreat</td><td>229693</td><td></td></tr><tr><td>Culture Tubes</td><td>VWR International</td><td>60818-576</td><td></td></tr><tr><td>T75 flasks</td><td>Celltreat</td><td>229340</td><td></td></tr><tr><td>T182 flasks</td><td>Celltreat</td><td>229350</td><td></td></tr><tr><td>1x PBS</td><td>Corning</td><td>21-040-CV</td><td></td></tr><tr><td>RPMI 1640 with L-glutamine</td><td>Corning</td><td>10-040-CV</td><td></td></tr><tr><td>DMEM with L-glutamine and 4.5 g/L glucose</td><td>Corning</td><td>10-017-CV</td><td></td></tr><tr><td>Fetal Bovine Serum (FBS)</td><td>Atlas Biologicals</td><td>FP-0500-A</td><td></td></tr><tr><td>Tragacanth Powder</td><td>MP Bio</td><td>MP 104792</td><td></td></tr><tr><td>Crystal Violet</td><td>Amresco</td><td>0528-1006</td><td></td></tr><tr><td>Ethanol Denatured</td><td>VWR International</td><td>BDH1156-1LP</td><td></td></tr><tr><td>6 well plate</td><td>Celltreat</td><td>229106</td><td></td></tr><tr><td>12 well plate</td><td>Celltreat</td><td>229111</td><td></td></tr><tr><td>Sequencing Oligos</td><td>IDT</td><td>see table 1</td><td></td></tr><tr><td>Qubit 3.0</td><td>ThermoFisher</td><td>Qubit 3.0</td><td>other methods are acceptable.</td></tr><tr><td>Qubit dsDNA BR Assay Kit</td><td>ThermoFisher</td><td>Q32850</td><td>other methods are acceptable.</td></tr><tr><td>Qubit RNA HS Assay Kit</td><td>ThermoFisher</td><td>Q32852</td><td>other methods are acceptable.</td></tr><tr><td>Class II Biosafety Cabinet</td><td>Varies</td><td>N/A</td><td>This is necessary for live-virus work.</td></tr></tbody></table>

rescue and characterization of recombinant virus from a new world zika virus infectious clone

Os clones de cDNA infecciosos permitem a manipulação genética de um vírus, facilitando assim o trabalho em vacinas, patogênese, replicação, transmissão e evolução viral. Aqui descrevemos a construção de um clone infeccioso para o vírus Zika (ZIKV), que atualmente está causando um surto explosivo nas Américas. Para evitar a toxicidade para bactérias comumente observadas com plasmídeos derivados de flavivírus, geramos um sistema de dois plasmídeos que separa o genoma no gene NS1 e é mais estável que as construções de comprimento total que não puderam ser recuperadas com sucesso sem mutações. Após a digestão e a ligação para unir os dois fragmentos, o ARN viral completo pode ser gerado por transcrição in vitro com polimerase de ARN T7. Após a eletroporação do ARN transcrito nas células, recuperou-se o vírus que apresentava cinética de crescimento in vitro semelhante e fenótipos de virulência e infecção in vivo em camundongos e mosquitos, respectivamente.

O protocolo aqui descrito permite a recuperação do vírus Zika infeccioso derivado de clones. Manipular o sistema de clones infecciosos de dois plasmídeos é direto quando realizado com cuidado, em comparação com versões completas que são altamente instáveis ​​(dados não mostrados). Após a digestão e a ligação das duas peças distintas, o ARN tampado é produzido usando transcrição in vitro com polimerase T7 que é então eletroporada em células Vero ( <stron...

Watch this Scientific Journal Video about Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone at JoVE.com

Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone

Este protocolo descreve a recuperação do vírus Zika infeccioso a partir de um clone de cDNA infeccioso com dois plasmídeos.

Salvamento e Caracterização do Vírus Recombinante de um Clone Infeccioso do Vírus do Novo Mundo Zika

Infectious cDNA clones allow for genetic manipulation of a virus, thus facilitating work on vaccines, pathogenesis, replication, transmission and viral ...

rescue-characterization-recombinant-virus-from-new-world-zika-virus

Universidad de Cartagena UDEC

Research

JoVE Journal

Immunology and Infection

9.6K visualizações.  Colorado State University.  Este protocolo descreve a recuperação do vírus Zika infeccioso a partir de um clone de cDNA infeccioso com dois plasmídeos. 

Vídeo: Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone

Generation of Recombinant Influenza Virus from Plasmid DNA

Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally established in 1999 1,2 plasmid-based reverse genetic techniques to generate recombinant viruses have revolutionized the influenza research field because specific questions have been answered by genetically engineered, infectious, recombinant influenza viruses. Such studies include virus replication, function of viral proteins, the contribution of specific mutations in viral proteins in viral replication and/or pathogenesis and, also, viral vectors using recombinant influenza viruses expressing foreign proteins 3.

Rescue of influenza A viruses from plasmid DNA is a basic and essential experimental technique that allows influenza researchers to generate recombinant viruses to study multiple aspects in the biology of influenza virus, and to be used as potential vectors or vaccines.

Geração de recombinante do vírus Influenza de DNA plasmidial

Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally ...

Imunologia e Infecção

Generation of Recombinant Arenavirus for Vaccine Development in FDA-Approved Vero Cells

The development and implementation of arenavirus reverse genetics represents a significant breakthrough in the arenavirus field 4. The use of cell-based arenavirus minigenome systems together with the ability to generate recombinant infectious arenaviruses with predetermined mutations in their genomes has facilitated the investigation of the contribution of viral determinants to the different steps of the arenavirus life cycle, as well as virus-host interactions and mechanisms of arenavirus pathogenesis 1, 3, 11 . In addition, the development of trisegmented arenaviruses has permitted the use of the arenavirus genome to express additional foreign genes of interest, thus opening the possibility of arenavirus-based vaccine vector applications 5 . Likewise, the development of single-cycle infectious arenaviruses capable of expressing reporter genes provides a new experimental tool to improve the safety of research involving highly pathogenic human arenaviruses 16 . The generation of recombinant arenaviruses using plasmid-based reverse genetics techniques has so far relied on the use of rodent cell lines 7,19 , which poses some barriers for the development of Food and Drug Administration (FDA)-licensed vaccine or vaccine vectors. To overcome this obstacle, we describe here the efficient generation of recombinant arenaviruses in FDA-approved Vero cells.

Rescue of recombinant arenaviruses from cloned cDNAs, an approach referred to as reverse genetics, allows researchers to investigate the role of specific viral gene products, as well as the contribution of their different specific domains and residues, to many different aspects of the biology of arenavirus. Likewise, reverse genetics techniques in FDA-approved cell lines (Vero) for vaccine development provides novel possibilities for the generation of effective and safe vaccines to combat human pathogenic arenaviruses.

Geração de Arenavirus recombinante de Desenvolvimento de Vacinas no FDA-approved células Vero

The development and implementation of arenavirus reverse genetics represents a significant breakthrough in the arenavirus field  4. The use of cell-based ...

Zika Virus Infectious Cell Culture System and the In Vitro Prophylactic Effect of Interferons

Zika Virus (ZIKV) is an emerging pathogen that is linked to fetal developmental abnormalities such as microcephaly, eye defects, and impaired growth. ZIKV is an RNA virus of the Flaviviridae family. ZIKV is mainly transmitted by mosquitoes, but can also be spread by maternal to fetal vertical transmission as well as sexual contact. To date, there are no reliable treatment or vaccine options available to protect those infected by the virus. The development of a reproducible, effective Zika virus infectious cell culture system is critical for studying the molecular mechanisms of ZIKV replication as well as drug and vaccine development. In this regard, a protocol describing a mammalian cell-based in vitro Zika virus culture system for viral production and growth analysis is reported here. Details on the formation of plaques by Zika virus on a cell monolayer and plaque assay for measuring viral titer are presented. Viral genome replication kinetics and double-stranded RNA genome replicatory intermediates are determined. This culture platform was utilized to screen against a library of a small set of cytokines resulting in the identification of interferon-&#945; (IFN-&#945;), IFN-&#946; and IFN-&#947; as potent inhibitors of Zika viral growth. In summary, an in vitro infectious Zika viral culture system and various virological assays are demonstrated in this study, which has the potential to greatly benefit the research community in elucidating further the mechanisms of viral pathogenesis and the evolution of viral virulence. Antiviral IFN-alpha can further be evaluated as a prophylactic, post-exposure prophylactic, and treatment option for Zika virus infections in high-risk populations, including infected pregnant women.

Zika Virus Infectious Cell Culture System and the In Vitro Prophylactic Effect of Interferons

Zika Virus (ZIKV), an emerging pathogen, is linked to fetal developmental abnormalities and microcephaly. The establishment of an effective infectious cell culture system is crucial for studies of ZIKV replication as well as vaccine and drug development. In this study, various virological assays pertaining to ZIKV are illustrated and discussed.

Virus Zika sistema de cultura celular Infecciosas e do<em&gt; In Vitro</em&gt; Efeito profilático de interferões

Zika Virus (ZIKV) is an emerging pathogen that is linked to fetal developmental abnormalities such as microcephaly, eye defects, and impaired growth. ZIKV ...

Evaluation of Zika Virus-specific T-cell Responses in Immunoprivileged Organs of Infected Ifnar1-/- Mice

The Zika virus (ZIKV) can induce inflammation in immunoprivileged organs (e.g., the brain and testis), leading to the Guillain-Barr&#233; syndrome and damaging the testes. During an infection with the ZIKV, immune cells have been shown to infiltrate into the tissues. However, the cellular mechanisms that define the protection and/or immunopathogenesis of these immune cells during a ZIKV infection are still largely unknown. Herein, we describe methods to evaluate the virus-specific T-cell functionality in these immunoprivileged organs of ZIKV-infected mice. These methods include a) a ZIKV infection and vaccine inoculation in Ifnar1-/- mice; b) histopathology, immunofluorescence, and immunohistochemistry assays to detect the virus infection and inflammation in the brain, testes, and spleen; c) the preparation of a tetramer of ZIKV-derived T-cell epitopes; d) the detection of ZIKV-specific T cells in the monocytes isolated from the brain, testes, and spleen. Using these approaches, it is possible to detect the antigen-specific T cells that have infiltrated into the immunoprivileged organs and to evaluate the functions of these T cells during the infection: potential immune protection via virus clearance and/or immunopathogenesis to exacerbate the inflammation. These findings may also help to clarify the contribution of T cells induced by the immunization against ZIKV.

Evaluation of Zika Virus-specific T-cell Responses in Immunoprivileged Organs of Infected Ifnar1-/- Mice

A protocol to evaluate antigen-specific T-cell responses in the immunoprivileged organs of the Ifnar1-/- murine model for the Zika virus (ZIKV) infection is described. This method is pivotal for investigating the cellular mechanisms of the protection and immunopathogenesis of ZIKV vaccines and is also valuable for their efficacy evaluation.

Avaliação das respostas de células T Zika vírus específicos em órgãos Immunoprivileged de infectados Ifnar1- / - ratos

The Zika virus (ZIKV) can induce inflammation in immunoprivileged organs (e.g., the brain and testis), leading to the Guillain-Barr&#233; syndrome and ...

Quantification of Antibody-dependent Enhancement of the Zika Virus in Primary Human Cells

The recent emergence of the flavivirus Zika and neurological complications, such as Guillain-Barr&#233; syndrome and microcephaly in infants, has brought serious public safety concerns. Among the risk factors, antibody-dependent enhancement (ADE) poses the most significant threat, as the recent re-emergence of the Zika virus (ZIKV) is primarily in areas where the population has been exposed and is in a state of pre-immunity to other closely related flaviviruses, especially dengue virus (DENV). Here, we describe a protocol for quantifying the effect of human serum antibodies against DENV on ZIKV infection in primary human cells or cell lines.

We describe a method to evaluate the effect of pre-existing immunity against dengue virus on the Zika virus infection by using human serum, primary human cells, and infection quantification by quantitative real-time polymerase chain reaction.

Quantificação de realce dependente de anticorpo do vírus nas células humanas primárias Zika

The recent emergence of the flavivirus Zika and neurological complications, such as Guillain-Barr&#233; syndrome and microcephaly in infants, has brought ...

Establishing Mouse Models for Zika Virus-induced Neurological Disorders Using Intracerebral Injection Strategies: Embryonic, Neonatal, and Adult

The Zika virus (ZIKV) is a flavivirus currently endemic in North, Central, and South America. It is now established that the ZIKV can cause microcephaly and additional brain abnormalities. However, the mechanism underlying the pathogenesis of ZIKV in the developing brain remains unclear. Intracerebral surgical methods are frequently used in neuroscience research to address questions about both normal and abnormal brain development and brain function. This protocol utilizes classical surgical techniques and describes methods that allow one to model ZIKV-associated human neurological disease in the mouse nervous system. While direct brain inoculation does not model the normal mode of virus transmission, the method allows investigators to ask targeted questions concerning the consequence after ZIKV infection of the developing brain. This protocol describes embryonic, neonatal, and adult stages of intraventricular inoculation of ZIKV. Once mastered, this method can become a straightforward and reproducible technique that only takes a few hours to perform.

Here we describe a method for establishing a model of Zika virus-induced microcephaly in mouse. This protocol includes methods for embryonic, neonatal, and adult-stage intracerebral inoculation of the Zika virus.

Estabelecer modelos de Mouse para doenças neurológicas induzida por vírus Zika usando estratégias de injeção Intracerebral: embrionárias, Neonatal e adulto

The Zika virus (ZIKV) is a flavivirus currently endemic in North, Central, and South America. It is now established that the ZIKV can cause microcephaly ...

Neurociência

Rescue of Recombinant Zika Virus from a Bacterial Artificial Chromosome cDNA Clone

The association of Zika virus (ZIKV) infection with neurological complications during the recent worldwide outbreak and the lack of approved vaccines and/or antivirals have underscored the urgent need to develop ZIKV reverse genetic systems to facilitate the study of ZIKV biology and the development of therapeutic and/or prophylactic approaches. However, like with other flaviviruses, the generation of ZIKV full-length infectious cDNA clones has been hampered due to the toxicity of viral sequences during its amplification in bacteria. To overcome this problem, we have developed a nontraditional approach based on the use of bacterial artificial chromosomes (BACs). Using this approach, the full-length cDNA copy of the ZIKV strain Rio Grande do Norte Natal (ZIKV-RGN) is generated from four synthetic DNA fragments and assembled into the single-copy pBeloBAC11 plasmid under the control of the human cytomegalovirus (CMV) immediate-early promoter. The assembled BAC cDNA clone is stable during propagation in bacteria, and infectious recombinant (r)ZIKV is recovered in Vero cells after transfection of the BAC cDNA clone. The protocol described here provides a powerful technique for the generation of infectious clones of flaviviruses, including ZIKV, and other positive-strand RNA viruses, particularly those with large genomes that have stability problems during bacterial&#160;propagation.

The recent epidemic of Zika virus highlights the importance of establishing reverse genetic approaches to develop vaccines and/or therapeutic strategies. Here, we describe the protocol to rescue an infectious recombinant Zika virus from a full-length cDNA clone assembled in a bacterial artificial chromosome under the control of the human cytomegalovirus immediate-early promoter.

Resgate do vírus Zika recombinante de um clone de cDNA de cromossomo artificial bacteriano

The association of Zika virus (ZIKV) infection with neurological complications during the recent worldwide outbreak and the lack of approved vaccines ...

Isolation and Quantification of Zika Virus from Multiple Organs in a Mouse

The methods being presented demonstrate laboratory procedures for the isolation of organs from Zika virus infected animals and the quantification of viral load. The purpose of the procedure is to quantify viral titers in peripheral and CNS areas of the mouse at different time points post infection or under different experimental conditions to identify virologic and immunological factors that regulate Zika virus infection. The organ isolation procedures demonstrated allow for both focus forming assay quantification and quantitative PCR assessment of viral titers. The rapid organ isolation techniques are designed for the preservation of virus titer. Viral titer quantification by focus forming assay allows for the rapid throughput assessment of Zika virus. The benefit of the focus forming assay is the assessment of infectious virus, the limitation of this assay is the potential for organ toxicity reducing the limit of detection. Viral titer assessment is combined with quantitative PCR, and using a recombinant RNA copy control viral genome copy number within the organ is assessed with low limit of detection. Overall these techniques provide an accurate rapid high throughput method for the analysis of Zika viral titers in the periphery and CNS of Zika virus infected animals and can be applied to the assessment of viral titers in the organs of animals infected with most pathogens, including Dengue virus.

The goal of the protocol is to demonstrate the techniques used to investigate viral disease by isolating and quantifying Zika virus, from multiple organs in a mouse following infection.

Isolamento e quantificação do vírus Zika de múltiplos órgãos em um mouse

The methods being presented demonstrate laboratory procedures for the isolation of organs from Zika virus infected animals and the quantification of viral ...

Vector Competence Analyses on Aedes aegypti Mosquitoes using Zika Virus

The procedures presented describe a generalized methodology to infect Aedes aegypti mosquitoes with Zika virus under laboratory conditions to determine the rate of infection, disseminated infection, and potential transmission of the virus in the mosquito population in question. These procedures are widely utilized with various modifications in vector competence evaluations globally. They are important in determining the potential role that a given mosquito (i.e., species, population, individual) may play in the transmission of a given agent.

Vector Competence Analyses on Aedes aegypti Mosquitoes using Zika Virus

The presented protocol can determine the vector competence of Aedes aegypti mosquito populations for a given virus, such as Zika, in a containment setting.

Análises de competência vetorial sobre mosquitos Aedes aegypti que usam zika vírus

The procedures presented describe a generalized methodology to infect Aedes aegypti mosquitoes with Zika virus under laboratory conditions to determine ...

High-throughput Antiviral Assays to Screen for Inhibitors of Zika Virus Replication

Antiviral drug discovery requires the development of reliable biochemical and cellular assays that can be performed in high-throughput screening (HTS) formats. The flavivirus non-structural (NS) proteins are thought to co-translationally assemble on the endoplasmic reticulum (ER) membranes, forming the replication complex (RC). The NS3 and NS5 are the most studied enzymes of the RC and constitute the main targets for drug development due to their crucial roles in viral genome replication. NS3 protease domain, which requires NS2B as its cofactor, is responsible for the cleavage of the immature viral polyprotein into the mature NS proteins, whereas NS5 RdRp domain is responsible for the RNA replication. Herein, we describe in detail the protocols used in replicon-based screenings and enzymatic assays to test large compound libraries for inhibitors of the Zika virus (ZIKV) replication. Replicons are self-replicating subgenomic systems expressed in mammalian cells, in which the viral structural genes are replaced by a reporter gene. The inhibitory effects of compounds on viral RNA replication can be easily evaluated by measuring the reduction in the reporter protein activity. The replicon-based screenings were performed using a BHK-21 ZIKV replicon cell line expressing Renilla luciferase as a reporter gene. To characterize the specific targets of identified compounds, we established in-vitro fluorescence-based assays for recombinantly expressed NS3 protease and NS5 RdRp. The proteolytic activity of the viral protease was measured by using the fluorogenic peptide substrate Bz-nKRR-AMC, while the NS5 RdRp elongation activity was directly detected by the increase of the fluorescent signal of SYBR Green I during RNA elongation, using the synthetic biotinylated self-priming template 3&#8242;UTR-U30 (5&#39;-biotin-U30-ACUGGAGAUCGAUCUCCAGU-3&#39;).

In this work, we describe the protocols used in replicon-based and viral enzyme-based assays to screen for inhibitors of Zika virus replication in a high-throughput screening format.

Ensaios antivirais de alta produtividade para tela para inibidores da replicação do vírus Zika

Antiviral drug discovery requires the development of reliable biochemical and cellular assays that can be performed in high-throughput screening (HTS) ...

Salvamento e Caracterização do Vírus Recombinante de um Clone Infeccioso do Vírus do Novo Mundo Zika

Resumo

Explore mais vídeos

Capítulos neste vídeo