Name: in vivo sirna transfection and gene knockdown in spinal cord via rapid noninvasive lumbar intrathecal injections in mice
Uploaded: 2014-03-22T14:00:00.000+00:00
Duration: 5 min 24 s
Description: Watch this Scientific Journal Video about In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice at JoVE.com

Todos os procedimentos de uso de animais estavam de acordo com as diretrizes éticas estabelecidas pelo órgão local (Regierungspräsidium Karlsruhe, Karlsruhe, Alemanha). 1. Preparação de siRNA / PEI Complexo A solução complexa siRNA / PEI é preparada com as instruções do fabricante da seguinte forma: <ol><li> Solução A: Dilui-se a quantidade desejada de siRNA com água estéril (se necessário) até um quarto do volume final e diluir este ainda com solução de glicose a 10% até a metade do volume final. Vortex suavemente ou misture pipetando cima e para baixo. A quantidade ideal de siRNA precisa ser determinada empiricamente, mas 1 mg siRNA em 10 mL solução complexa por animal é um bom ponto de partida para a otimização. </li><li> Solução B: Diluir o volume necessário de reagente PEI com água estéril até um quarto do volume final e diluir esta ainda mais com solução de glicose a 10% até a metade do volume final. Vortex gently ou misture pipetando cima e para baixo. Nota: A quantidade de reagente de PEI determina o equilíbrio iónico no complexo, o que influencia a eficiência da transfecção. Do mesmo modo a quantidade óptima de solução de PEI tem que ser determinado empiricamente. Em nossas mãos, a quantidade ideal é de 0,12 ml de solução de PEI por 1 mg siRNA. </li><li> Misture a solução A com a solução B de uma só vez, vortex suavemente. </li><li> Incubar a solução da mistura durante 15 min à temperatura ambiente antes da sua utilização. Este complexo é estável durante 2 horas à temperatura ambiente e durante 24 horas a 4 ° C. </li></ol> 2. Injeção intratecal <ol><li> Anestesiar o mouse com 3% de isoflurano, até que ele não mostra sinais de reflexo de endireitamento. Além disso, verificar a existência de cauda e / ou pata pitada reflexo para garantir ainda mais o estado de anestesia. </li><li> Raspar a cerca de 2 cm 2 de pele na parte posterior do animal, perto da base da cauda, ​​para facilitar uma melhor visualização durante a inserção da agulha. </li><li> Coloque o mouse emum cone de nariz para uma administração contínua de isoflurano durante o procedimento, reduzir o isoflurano a 1,5%, e cobrir os olhos do rato com lubrificante ocular. </li><li> Prepare o pronto para usar solução mista siRNA usando um 25 mL Hamilton seringa ligada a um 30 G 0,5 na agulha. </li><li> Localize o processo espinhoso da L6, que deve ser um dos mais proeminentes e fixar a coluna de vertebrados em torno desta área, pressionando-o suavemente. </li><li> Insira com cuidado a agulha entre o sulco de L5 e L6 vértebras e observar um movimento de cauda como este signo indica uma entrada bem sucedida da agulha no espaço intradural. Dica: Usando unha, deve-se ser capaz de localizar o sulco também. </li><li> Depois da retirada da cauda é observada, de imediato, mas com cuidado, proteger a posição da agulha com uma mão e injetar o volume desejado de substância com a outra mão lentamente. Dica: um volume entre 5-10 mL é o ideal como o volume de menos de 5 &amp;# 181; l não é confiável e um volume maior que 10 ml leva a muita pressão. </li><li> Uma vez que a injeção é feita, mova o mouse de volta para a jaula para se recuperar da anestesia. </li><li> Repetir esta injecção de, pelo menos, mais duas vezes a cada 24 horas para se conseguir a regulação negativa óptima do gene alvo. </li></ol>

<ol>
	<li>Hylden, J. L., Wilcox, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intrathecal+morphine+in+mice:+a+new+technique.">Intrathecal morphine in mice: a new technique.</a> Eur. J. Pharmacol. 67, 313-316 (1980).</li><li>Stokes, J. A., Corr, M., Yaksh, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transient+tactile+allodynia+following+intrathecal+puncture+in+mouse:+contributions+of+Toll-like+receptor+signaling.">Transient tactile allodynia following intrathecal puncture in mouse: contributions of Toll-like receptor signaling.</a> Neurosci. Lett. 504, 215-218 (2011).</li><li>Goula, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyethylenimine-based+intravenous+delivery+of+transgenes+to+mouse+lung.">Polyethylenimine-based intravenous delivery of transgenes to mouse lung.</a> Gene Ther. , 1291-1295 (1998).</li><li>Fairbanks, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spinal+delivery+of+analgesics+in+experimental+models+of+pain+and+analgesia.">Spinal delivery of analgesics in experimental models of pain and analgesia.</a> Adv. Drug. Deliv. Rev. 55, 1007-1041 (2003).</li><li>Hohmann, A. G., Tsou, K., Walker, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cannabinoid+modulation+of+wide+dynamic+range+neurons+in+the+lumbar+dorsal+horn+of+the+rat+by+spinally+administered+WIN55,212-2.">Cannabinoid modulation of wide dynamic range neurons in the lumbar dorsal horn of the rat by spinally administered WIN55,212-2.</a> Neurosci. Lett. 257, 119-122 (1998).</li><li>Song, Z. H., Takemori, A. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Involvement+of+spinal+kappa+opioid+receptors+in+the+antinociception+produced+by+intrathecally+administered+corticotropin-releasing+factor+in+mice.">Involvement of spinal kappa opioid receptors in the antinociception produced by intrathecally administered corticotropin-releasing factor in mice.</a> J. Pharmacol. Exp. Ther. 254, 363-368 (1990).</li><li>Trang, T., Sutak, M., Jhamandas, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Involvement+of+cannabinoid+(CB1)-receptors+in+the+development+and+maintenance+of+opioid+tolerance.">Involvement of cannabinoid (CB1)-receptors in the development and maintenance of opioid tolerance.</a> Neuroscience. , 1275-1288 (2007).</li><li>Yaksh, T. L., Rudy, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chronic+catheterization+of+the+spinal+subarachnoid+space.">Chronic catheterization of the spinal subarachnoid space.</a> Physiol. Behav. 17, 1031-1036 (1976).</li><li>Tappe, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synaptic+scaffolding+protein+Homer1a+protects+against+chronic+inflammatory+pain.">Synaptic scaffolding protein Homer1a protects against chronic inflammatory pain.</a> Nat. Med. , 677-681 (2006).</li><li>Bourinet, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silencing+of+the+Cav3.2+T-type+calcium+channel+gene+in+sensory+neurons+demonstrates+its+major+role+in+nociception.">Silencing of the Cav3.2 T-type calcium channel gene in sensory neurons demonstrates its major role in nociception.</a> EMBO J. 24, 315-324 (2005).</li><li>Wang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+transfer+to+dorsal+root+ganglia+by+intrathecal+injection:+effects+on+regeneration+of+peripheral+nerves.">Gene transfer to dorsal root ganglia by intrathecal injection: effects on regeneration of peripheral nerves.</a> Mol. Ther. 12, 314-320 (2005).</li><li>Wigdor, S., Wilcox, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Central+and+systemic+morphine-induced+antinociception+in+mice:+contribution+of+descending+serotonergic+and+noradrenergic+pathways.">Central and systemic morphine-induced antinociception in mice: contribution of descending serotonergic and noradrenergic pathways.</a> J. Pharmacol. Exp. Ther. 242, 90-95 (1987).</li></ol>

Os autores declaram não haver interesses financeiros concorrentes.

Assim, a técnica de injecções intratecais agulhas acima descrito é eficaz, rápida, especificamente localizada, e não destrutivos. Tecnicamente, o aspecto mais importante deste processo é o ponto de inserção da agulha para dentro da ranhura. É fundamental que este procedimento é feito com as mãos e paciência muito calmas. Como muitos procedimentos cirúrgicos, a formação melhora a taxa de injecção com sucesso. Isso também é importante porque durante um experimento real, esta técnica não fornece um in...

A medula espinhal é um centro muito importante em uma variedade de processos biológicos fundamentais e as funções fisiológicas, incluindo o processamento e transmissão de dolorosas (nociceptivos) entradas 4-7. Foram desenvolvidas várias técnicas experimentais para facilitar a modulação farmacológica da medula espinal, tais como implantação crónica de cateteres intratecais 8, espinal medula microinjecção, e injecção intratecal de agulha 9. Cada técnica tem as suas próprias vantagens e desvantagens, e dependendo do paradigma experimental uma técnica podem ser mais adequados do que os outros. Considerando a implantação crônica de cateteres intratecal é facilmente viável em ratos, este método é muito difícil no mouse, dado as restrições de tamanho. A taxa de sucesso é muito baixo e os défices motores frequentemente ocorrer devido à presença de um volumoso cateter no espaço subdural severamente confinado no rato. Além disso, a entrega a longo prazo de drogas é processado devido a coagulação freqüentede cronicamente implantados cateteres. Finalmente, as reações imunológicas são comuns. Estes problemas podem ser contornados utilizando o método de injecção intratecal aguda por meio de uma agulha, na ausência de um cateter preimplanted, o que permite uma aplicação rápida e anatomicamente limitado de medicamentos e reagentes para as medulas espinhais em ratinhos. Este método mantém totalmente os benefícios da entrega intratecal sobre outras vias de administração sistémica (por exemplo, oral, intravenosa, intraperitoneal, etc), tais como especificidade de modulação espinal, que permite doses reduzidas e limite de efeitos secundários, bem como a capacidade de fornecer substâncias não fazer normalmente não atravessam a barreira hematoencefálica, uma vez durante a injecção intratecal, a agulha é inserida entre a dura-máter e da medula espinhal. Importante, no entanto, em comparação com outros métodos de administração intratecal, o método de injecção intratecal agulha é o menos invasivos, permitindo numerosas aplicações namesmo animal, sem causar qualquer dano ao tecido considerável ou evocando reação imunológica devido à implantação de material estranho. No entanto, requer habilidades técnicas para uma segmentação muito preciso da agulha para permitir a eficácia. Aqui, nós demonstrar visualmente o método para alcançar uma taxa ótima de sucesso para visando especificamente a medula espinhal lombar. O local de injecção que é escolhida nesta experiência é o sulco entre L5 e L6 coluna vertebrado, perto de onde a medula espinal termina, para minimizar a possibilidade de danificar a coluna. Além disso, demonstramos o uso desta técnica para derrubar genes na medula espinhal usando siRNAs.

<table><tbody><tr><td>&lt;em&gt;In Vivo&lt;/em&gt;-jetPEI</td><td>Polyplus</td><td>201-10G</td><td>&amp;nbsp;</td></tr><tr><td>WAVE1 siRNA</td><td>Santa Cruz</td><td>sc-36832</td><td>&amp;nbsp;</td></tr><tr><td>Control siRNA-A</td><td>Santa Cruz</td><td>sc-37007</td><td>&amp;nbsp;</td></tr><tr><td>Anti-&amp;szlig;-Tubulin III antibody</td><td>Sigma</td><td>T2200</td><td>&amp;nbsp;</td></tr><tr><td>Anti-WAVE1 antibody</td><td>R&amp;amp;D Systems</td><td>AF5514</td><td>&amp;nbsp;</td></tr><tr><td>Fast green dye</td><td>Sigma</td><td>F-7252</td><td>&amp;nbsp;</td></tr><tr><td>Isoflurane</td><td>Baxter</td><td></td><td>&amp;nbsp;</td></tr><tr><td>Isoflurane setup</td><td>Dr&amp;auml;ger L&amp;uuml;beck</td><td></td><td>&amp;nbsp;</td></tr><tr><td>Shaver</td><td>Wella</td><td></td><td>&amp;nbsp;</td></tr><tr><td>Hamilton syringe Gastight 1702</td><td>Hamilton</td><td></td><td>&amp;nbsp;</td></tr><tr><td>30 G 1/2 in 13 mm Needle</td><td>BD Microlance</td><td>304000</td><td>&amp;nbsp;</td></tr><tr><td>Microscope Leica MS5</td><td>Leica</td><td></td><td>&amp;nbsp;</td></tr><tr><td>WAVE1 forward primer for qRT-PCR</td><td>Sigma</td><td></td><td>cacagagcctcaggacagg</td></tr><tr><td>WAVE1 reversed primer for qRT-PCR</td><td>Sigma</td><td></td><td>cttttcaccaacggcatctt</td></tr><tr><td>FastStart Essential DNA Green Master</td><td>Roche</td><td>6402712001</td><td>&amp;nbsp;</td></tr></tbody></table>

in vivo sirna transfection and gene knockdown in spinal cord via rapid noninvasive lumbar intrathecal injections in mice

Este relatório descreve um guia passo-a-passo para a técnica de injeção intratecal de agulhas agudas de forma não invasiva, ou seja, independente da implantação do cateter. A limitação técnica desta técnica cirúrgica encontra-se na delicadeza das mãos. A injeção é rápida, especialmente para um experimentador treinado, e desde rompimento do tecido com esta técnica é mínima, injeções repetidas são possíveis, além disso reação imune a ferramentas externas (. Eg cateter) não ocorre, dando assim uma melhor e mais específico LER de modulação da medula espinal. Uma vez que a aplicação da substância é essencialmente limitada à região alvo da medula espinal, as drogas não precisa de ser aplicado em grandes dosagens, e mais importante, os efeitos indesejados sobre outros tecidos, tal como observado com uma administração sistémica, pode ser contornado 1, 2. Além disso, combinar esta técnica com a transfecção in vivo de ácido nucleico, com a ajuda de polyethylenimine (PEI) de reagente 3, o qual proporciona uma enorme versatilidade para o estudo de funções da coluna vertebral através da administração de agentes farmacológicos, bem como do gene, RNA, e de moduladores de proteínas.

A fim de ilustrar uma injecção bem sucedida, foi realizada utilizando a técnica rápida de corante verde FCF em adultos ratinhos C57Bl6 (8-10 semanas de idade). O animal foi deixado a recuperar durante alguns minutos após a injecção, para dar tempo suficiente para que o corante de espalhar e em seguida sacrificados com uma dose excessiva de CO2. Subsequentemente, a coluna foi dissecado vertebrado e a medula espinhal foi exposta. O puncta azul correspondente ao corante difusa, marcado no local da injecç...

Watch this Scientific Journal Video about In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice at JoVE.com

In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

Este relatório descreve uma técnica simples e rápida de punção intratecal para a transfecção localizada de siRNA na medula espinhal lombar em rato sob anestesia luz de curta duração.

In Vivo SiRNA transfecção e Gene Knockdown em Spinal Cord via rápida não invasiva lombar intratecal Injeções em Ratos

This report describes a step-by-step guide to the technique of acute intrathecal needle injections in a noninvasive manner, i.e. independent of catheter ...

in-vivo-sirna-transfection-gene-knockdown-spinal-cord-via-rapid

Universidad de Cartagena UDEC

Research

JoVE Journal

Biology

In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

46.5K visualizações.  University of Heidelberg.  Este relatório descreve uma técnica simples e rápida de punção intratecal para a transfecção localizada de siRNA na medula espinhal lombar em rato sob anestesia luz de curta duração. 

Vídeo: In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

In vivo Imaging of the Mouse Spinal Cord Using Two-photon Microscopy

In vivo imaging using two-photon microscopy 1 in mice that have been genetically engineered to express fluorescent proteins in specific cell types 2-3 has significantly broadened our knowledge of physiological and pathological processes in numerous tissues in vivo 4-7. In studies of the central nervous system (CNS), there has been a broad application of in vivo imaging in the brain, which has produced a plethora of novel and often unexpected findings about the behavior of cells such as neurons, astrocytes, microglia, under physiological or pathological conditions 8-17. However, mostly technical complications have limited the implementation of in vivo imaging in studies of the living mouse spinal cord. In particular, the anatomical proximity of the spinal cord to the lungs and heart generates significant movement artifact that makes imaging the living spinal cord a challenging task.
We developed a novel method that overcomes the inherent limitations of spinal cord imaging by stabilizing the spinal column, reducing respiratory-induced movements and thereby facilitating the use of two-photon microscopy to image the mouse spinal cord in vivo. This is achieved by combining a customized spinal stabilization device with a method of deep anesthesia, resulting in a significant reduction of respiratory-induced movements. This video protocol shows how to expose a small area of the living spinal cord that can be maintained under stable physiological conditions over extended periods of time by keeping tissue injury and bleeding to a minimum. Representative raw images acquired in vivo detail in high resolution the close relationship between microglia and the vasculature. A timelapse sequence shows the dynamic behavior of microglial processes in the living mouse spinal cord. Moreover, a continuous scan of the same z-frame demonstrates the outstanding stability that this method can achieve to generate stacks of images and/or timelapse movies that do not require image alignment post-acquisition. Finally, we show how this method can be used to revisit and reimage the same area of the spinal cord at later timepoints, allowing for longitudinal studies of ongoing physiological or pathological processes in vivo.

In vivo Imaging of the Mouse Spinal Cord Using Two-photon Microscopy

A minimally invasive protocol to stabilize the mouse spinal column and perform repetitive in vivo spinal cord imaging using two-photon microscopy is described. This method combines a spinal stabilization device and an anesthetic regimen to minimize respiratory-induced movements and produce raw imaging data that require no alignment or other post-processing.

Em Imaging vivo do Cordão do rato Spinal Usando Two-photon Microscopia

In vivo imaging using two-photon microscopy 1 in mice that have been genetically engineered to express fluorescent proteins in specific cell types 2-3 has ...

Neurociência

Stereotaxic Injection of a Viral Vector for Conditional Gene Manipulation in the Mouse Spinal Cord

Intraparenchymal injection of a viral vector enables conditional gene manipulation in distinct populations of neurons or particular regions of the central nervous system. We demonstrate a stereotaxic injection technique that allows targeted gene expression or silencing in the dorsal horn of the mouse spinal cord. The surgical procedure is brief. It requires laminectomy of a single vertebra, providing for quick recovery of the animal and unimpaired motility of the spine. Controlled injection of a small vector suspension volume at low speed and use of a microsyringe with beveled glass cannula minimize the tissue lesion. The local immune response to the vector depends on the intrinsic properties of the virus employed; in our experience, it is minor and short-lived when a recombinant adeno-associated virus is used. A reporter gene such as enhanced green fluorescent protein facilitates monitoring spatial distribution of the vector, and the efficacy and cellular specificity of the transfection.

Viral vectors allow for targeted gene manipulation. We demonstrate a method for conditional gene expression or ablation in the mouse spinal cord, using stereotaxic injection of a viral vector into the dorsal horn, a prominent site of synaptic contact between primary somatosensory afferents and neurons of the central nervous system.

Injeção estereotáxica de um vetor viral para manipulação genética condicional no Cabo de Rato Spinal

Intraparenchymal injection of a viral vector enables conditional gene manipulation in distinct populations of neurons or particular regions of the central ...

<meta charset="utf8"></head><body>Desenvolvendo um modelo de camundongo eficiente e preciso para glioma da medula espinhal

Surgical Transplantation of Tumor Cells into the Spinal Cord of Mice

Spinal cord gliomas are commonly malignant tumors of the spinal cord, leading to a high rate of disability. However, uniform treatment guidelines and comprehensive data on spinal cord gliomas remain limited due to the lack of suitable preclinical animal models. Developing a simple and reproducible animal model has become essential for advancing basic and translational research. A murine model is ideal, as the murine spinal cord shares structural similarities with the human spinal cord. This protocol describes the generation of a reproducible murine model of spinal cord glioma by directly injecting tumor cells into the intervertebral space using the spinous process of the seventh cervical vertebra as a guide. Compared to other methods, this approach is more effective and convenient, involving a smaller incision, reduced invasiveness and blood loss, faster recovery, and more stable tumor formation. This model is expected to advance the understanding of disease mechanisms, optimize surgical strategies, and support the development of therapeutic drugs for spinal cord gliomas.

<meta charset="utf8"></head><body>Transplante cirúrgico de células tumorais na medula espinhal de camundongos

The present protocol describes the development of a reproducible murine model of spinal cord glioma by injecting tumor cells into the intervertebral space, offering a more effective and less invasive approach for research and therapeutic development.

Transplante cirúrgico de células tumorais na medula espinhal de camundongos

Spinal cord gliomas are commonly malignant tumors of the spinal cord, leading to a high rate of disability. However, uniform treatment guidelines and ...

Pesquisa do câncer

In Vivo Gene Transfer to Schwann Cells in the Rodent Sciatic Nerve by Electroporation

The formation of the myelin sheath by Schwann cells (SCs) is essential for rapid conduction of nerve impulses along axons in the peripheral nervous system. SC-selective genetic manipulation in living animals is a powerful technique for studying the molecular and cellular mechanisms of SC myelination and demyelination in vivo. While knockout/knockin and transgenic mice are powerful tools for studying SC biology, these methods are costly and time consuming. Viral vector-mediated transgene introduction into the sciatic nerve is a simpler and less laborious method. However, viral methods have limitations, such as toxicity, transgene size constraints, and infectivity restricted to certain developmental stages. Here, we describe a new method that allows selective transfection of myelinating SCs in the rodent sciatic nerve using electroporation. By applying electric pulses to the sciatic nerve at the site of plasmid DNA injection, genes of interest can be easily silenced or overexpressed in SCs in both neonatal and more mature animals. Furthermore, this in vivo electroporation method allows for highly efficient simultaneous expression of multiple transgenes. Our novel technique should enable researchers to efficiently manipulate SC gene expression, and facilitate studies on SC development and function.

In Vivo Gene Transfer to Schwann Cells in the Rodent Sciatic Nerve by Electroporation

Here, we present an in vivo technique for gene transfer to Schwann cells (SCs) in the rodent sciatic nerve. This simple technique is useful for investigating signaling mechanisms involved in the development and maintenance of myelinating SCs.

Em Gene Vivo Transferência de células de Schwann no nervo ciático de roedores por Eletroporação

The formation of the myelin sheath by Schwann cells (SCs) is essential for rapid conduction of nerve impulses along axons in the peripheral nervous ...

Subpial Adeno-associated Virus 9 (AAV9) Vector Delivery in Adult Mice

The successful development of a subpial adeno-associated virus 9 (AAV9) vector delivery technique in adult rats and pigs has been reported on previously. Using subpially-placed polyethylene catheters (PE-10 or PE-5) for AAV9 delivery, potent transgene expression through the spinal parenchyma (white and gray matter) in subpially-injected spinal segments has been demonstrated. Because of the wide range of transgenic mouse models of neurodegenerative diseases, there is a strong desire for the development of a potent central nervous system (CNS)-targeted vector delivery technique in adult mice. Accordingly, the present study describes the development of a spinal subpial vector delivery device and technique to permit safe and effective spinal AAV9 delivery in adult C57BL/6J mice. In spinally immobilized and anesthetized mice, the pia mater (cervical 1 and lumbar 1-2 spinal segmental level) was incised with a sharp 34 G needle using an XYZ manipulator. A second XYZ manipulator was then used to advance a blunt 36G needle into the lumbar and/or cervical subpial space. The AAV9 vector (3-5 &#181;L; 1.2 x 1013 genome copies (gc)) encoding green fluorescent protein (GFP) was then injected subpially. After injections, neurological function (motor and sensory) was assessed periodically, and animals were perfusion-fixed 14 days after AAV9 delivery with 4% paraformaldehyde. Analysis of horizontal or transverse spinal cord sections showed transgene expression throughout the entire spinal cord, in both gray and white matter. In addition, intense retrogradely-mediated GFP expression was seen in the descending motor axons and neurons in the motor cortex, nucleus ruber, and formatio reticularis. No neurological dysfunction was noted in any animals. These data show that the subpial vector delivery technique can successfully be used in adult mice, without causing procedure-related spinal cord injury, and is associated with highly potent transgene expression throughout the spinal neuraxis.

Subpial Adeno-associated Virus 9 AAV9 Vector Delivery in Adult Mice

The goal of the present study was to develop and validate the potency and safety of spinal adeno-associated virus 9 (AAV9)-mediated gene delivery by using a novel subpial gene delivery technique in adult mice.

Vedação subjugada Adeno-associada do vírus 9 (AAV9) em ratos adultos

The successful development of a subpial adeno-associated virus 9 (AAV9) vector delivery technique in adult rats and pigs has been reported on previously. ...

Adeno-associated Virus-mediated Transgene Expression in Genetically Defined Neurons of the Spinal Cord

Selective manipulation of spinal neuronal subpopulations has mainly been achieved by two different methods: 1) Intersectional genetics, whereby double or triple transgenic mice are generated in order to achieve selective expression of a reporter or effector gene (e.g., from the Rosa26 locus) in the desired spinal population. 2) Intraspinal injection of Cre-dependent recombinant adeno-associated virus (rAAV); here Cre-dependent AAV vectors coding for the reporter or effector gene of choice are injected into the spinal cord of mice expressing Cre recombinase in the desired neuronal subpopulation. This protocol describes how to generate Cre-dependent rAAV vectors and how to transduce neurons in the dorsal horn of the lumbar spinal cord segments L3-L5 with rAAVs. As the lumbar spinal segments L3-L5 are innervated by those peripheral sensory neurons that transmit sensory information from the hindlimbs, spontaneous behavior and responses to sensory tests applied to the hindlimb ipsilateral to the injection side can be analyzed in order to interrogate the function of the manipulated neurons in sensory processing. We provide examples of how this technique can be used to analyze genetically defined subsets of spinal neurons. The main advantages of virus-mediated transgene expression in Cre transgenic mice compared to classical reporter mouse-induced transgene expression are the following: 1) Different Cre-dependent rAAVs encoding various reporter or effector proteins can be injected into a single Cre transgenic line, thus overcoming the need to create several multiple transgenic mouse lines. 2) Intraspinal injection limits manipulation of Cre-expressing cells to the injection site and to the time after injection. The main disadvantages are: 1) Reporter gene expression from rAAVs is more variable. 2) Surgery is required to transduce the spinal neurons of interest. Which of the two methods is more appropriate depends on the neuron population and research question to be addressed.

Intraspinal injection of recombinase dependent recombinant adeno-associated virus (rAAV) can be used to manipulate any genetically labelled cell type in the spinal cord. Here we describe how to transduce neurons in the dorsal horn of the lumbar spinal cord. This technique enables functional interrogation of the manipulated neuron subtype.

Expressão do Transgene de mediada por vírus adeno-associado em geneticamente definidos neurônios da medula espinhal

Selective manipulation of spinal neuronal subpopulations has mainly been achieved by two different methods: 1) Intersectional genetics, whereby double or ...

Direct Intrathecal Injection of Recombinant Adeno-associated Viruses in Adult Mice

Intrathecal (IT) injection of adeno-associated virus (AAV) has drawn considerable interest in CNS gene therapy by virtue of its safety, noninvasiveness, and excellent transduction efficacy in the CNS.&#160;Previous studies have demonstrated the therapeutic potency of AAV-delivered gene therapy in neurodegenerative disorders by IT administration. However, high rates of unpredictable failure due to the technical limitation of IT administration in small animals have been reported. Here, we established a scoring system to indicate the success extent of lumbar puncture in small animals by adding 1% lidocaine hydrochloride into the injection solution. We further show that the extent of transient weakness following injection can predict the transduction efficiency of AAV. Thus, this IT injection method can be used to optimize therapeutic trials in mouse models of CNS diseases that afflict wide regions of the CNS.

Here we present a direct intrathecal injection technique using 1% lidocaine hydrochloride in a viral solution to ensure efficient adeno-associated virus delivery to small animals and establish a scoring system to predict transduction efficiency in the central nervous system according to the degree of transient weakness induced by lidocaine.

Injeção intratecal de vírus Adeno-associado recombinantes em ratos adultos

Intrathecal (IT) injection of adeno-associated virus (AAV) has drawn considerable interest in CNS gene therapy by virtue of its safety, noninvasiveness, ...

Direct Injection of a Lentiviral Vector Highlights Multiple Motor Pathways in the Rat Spinal Cord

Introducing proteins of interest into cells in the nervous system is challenging due to innate biological barriers that limit access to most molecules. Injection directly into spinal cord tissue bypasses these barriers, providing access to cell bodies or synapses where molecules can be incorporated. Combining viral vector technology with this method allows for introduction of target genes into nervous tissue for the purpose of gene therapy or tract tracing. Here a virus engineered for highly efficient retrograde transport (HiRet) is introduced at the synapses of propriospinal interneurons (PNs) to encourage specific transport to neurons in the spinal cord and brainstem nuclei. Targeting PNs takes advantage of the numerous connections they receive from motor pathways such as the rubrospinal and reticulospinal tracts, as well as their interconnection with each other throughout spinal cord segments. Representative tracing using the HiRet vector with constitutively active green fluorescent protein (GFP) shows high fidelity details of cell bodies, axons and dendritic arbors in thoracic PNs and in reticulospinal neurons in the pontine reticular formation. HiRet incorporates well into brainstem pathways and PNs but shows age dependent integration into corticospinal tract neurons. In summary, spinal cord injection using viral vectors is a suitable method for introduction of proteins of interest into neurons of targeted tracts.

This protocol demonstrates injection of a retrogradely transportable viral vector into rat spinal cord tissue. The vector is taken up at the synapse and transported to the cell body of target neurons. This model is suitable for retrograde tracing of important spinal pathways or targeting cells for gene therapy applications.

Injeção direta de um vetor de Lentivirus destaca várias vias motoras na medula espinhal de ratos

Introducing proteins of interest into cells in the nervous system is challenging due to innate biological barriers that limit access to most molecules. ...

In Vivo SiRNA transfecção e Gene Knockdown em Spinal Cord via rápida não invasiva lombar intratecal Injeções em Ratos

Resumo

Explore mais vídeos

Capítulos neste vídeo

Em Imaging vivo do Cordão do rato Spinal Usando Two-photon Microscopia

Injeção estereotáxica de um vetor viral para manipulação genética condicional no Cabo de Rato Spinal

Transplante cirúrgico de células tumorais na medula espinhal de camundongos

Transplante cirúrgico de células tumorais na medula espinhal de camundongos

Transplante cirúrgico de células tumorais na medula espinhal de camundongos

Em Gene Vivo Transferência de células de Schwann no nervo ciático de roedores por Eletroporação

Vedação subjugada Adeno-associada do vírus 9 (AAV9) em ratos adultos

Expressão do Transgene de mediada por vírus adeno-associado em geneticamente definidos neurônios da medula espinhal

Injeção intratecal de vírus Adeno-associado recombinantes em ratos adultos

Injeção direta de um vetor de Lentivirus destaca várias vias motoras na medula espinhal de ratos