이 작품은 NIH/NHGRI R00 HG006922 및 J.G.에 NIH/NHGRI R01 HG008974 그리고 사냥꾼 Cancer 학회에 의해 지원 되었다. J.B.C.는 유전자 T32GM007464에 NIH 연수 프로그램에 의해 지원 되었다.

<ol>
	<li>Consortium, E. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+integrated+encyclopedia+of+DNA+elements+in+the+human+genome.">An integrated encyclopedia of DNA elements in the human genome.</a> Nature. 489 (7414), 57-74 (2012).</li><li>Roadmap Epigenomics, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+analysis+of+111+reference+human+epigenomes.">Integrative analysis of 111 reference human epigenomes.</a> Nature. 518 (7539), 317-330 (2015).</li><li>Andersson, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+atlas+of+active+enhancers+across+human+cell+types+and+tissues.">An atlas of active enhancers across human cell types and tissues.</a> Nature. 507 (7493), 455-461 (2014).</li><li>Perry, M. W., Boettiger, A. N., Bothma, J. P., Levine, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Shadow+enhancers+foster+robustness+of+Drosophila+gastrulation.">Shadow enhancers foster robustness of Drosophila gastrulation.</a> Curr Biol. 20 (17), 1562-1567 (2010).</li><li>Lam, D. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Partially+redundant+enhancers+cooperatively+maintain+Mammalian+pomc+expression+above+a+critical+functional+threshold.">Partially redundant enhancers cooperatively maintain Mammalian pomc expression above a critical functional threshold.</a> PLoS Genet. 11 (2), e1004935 (2015).</li><li>Patwardhan, R. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massively+parallel+functional+dissection+of+mammalian+enhancers+in+vivo.">Massively parallel functional dissection of mammalian enhancers in vivo.</a> Nat Biotechnol. 30 (3), 265-270 (2012).</li><li>Savic, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Promoter-distal+RNA+polymerase+II+binding+discriminates+active+from+inactive+CCAAT/+enhancer-binding+protein+beta+binding+sites.">Promoter-distal RNA polymerase II binding discriminates active from inactive CCAAT/ enhancer-binding protein beta binding sites.</a> Genome Res. 25 (12), 1791-1800 (2015).</li><li>Mali, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-guided+human+genome+engineering+via+Cas9.">RNA-guided human genome engineering via Cas9.</a> Science. 339 (6121), 823-826 (2013).</li><li>Cheng, A. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplexed+activation+of+endogenous+genes+by+CRISPR-on,+an+RNA-guided+transcriptional+activator+system.">Multiplexed activation of endogenous genes by CRISPR-on, an RNA-guided transcriptional activator system.</a> Cell Res. 23 (10), 1163-1171 (2013).</li><li>Hilton, I. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenome+editing+by+a+CRISPR-Cas9-based+acetyltransferase+activates+genes+from+promoters+and+enhancers.">Epigenome editing by a CRISPR-Cas9-based acetyltransferase activates genes from promoters and enhancers.</a> Nat Biotechnol. , (2015).</li><li>Kearns, N. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+annotation+of+native+enhancers+with+a+Cas9-histone+demethylase+fusion.">Functional annotation of native enhancers with a Cas9-histone demethylase fusion.</a> Nat Methods. 12 (5), 401-403 (2015).</li><li>Thakore, P. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+specific+epigenome+editing+by+CRISPR-Cas9+repressors+for+silencing+of+distal+regulatory+elements.">Highly specific epigenome editing by CRISPR-Cas9 repressors for silencing of distal regulatory elements.</a> Nat Methods. 12 (12), 1143-1149 (2015).</li><li>Groner, A. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=KRAB-zinc+finger+proteins+and+KAP1+can+mediate+long-range+transcriptional+repression+through+heterochromatin+spreading.">KRAB-zinc finger proteins and KAP1 can mediate long-range transcriptional repression through heterochromatin spreading.</a> PLoS Genet. 6 (3), e1000869 (2010).</li><li>Qi, L. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Repurposing+CRISPR+as+an+RNA-guided+platform+for+sequence-specific+control+of+gene+expression.">Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression.</a> Cell. 152 (5), 1173-1183 (2013).</li><li>Fulco, C. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+mapping+of+functional+enhancer-promoter+connections+with+CRISPR+interference.">Systematic mapping of functional enhancer-promoter connections with CRISPR interference.</a> Science. 354 (6313), 769-773 (2016).</li><li>Joo, J. Y., Schaukowitch, K., Farbiak, L., Kilaru, G., Kim, T. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stimulus-specific+combinatorial+functionality+of+neuronal+c-fos+enhancers.">Stimulus-specific combinatorial functionality of neuronal c-fos enhancers.</a> Nat Neurosci. 19 (1), 75-83 (2016).</li><li>Xie, S., Duan, J., Li, B., Zhou, P., Hon, G. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplexed+Engineering+and+Analysis+of+Combinatorial+Enhancer+Activity+in+Single+Cells.">Multiplexed Engineering and Analysis of Combinatorial Enhancer Activity in Single Cells.</a> Mol Cell. 66 (2), 285-299 (2017).</li><li>Carleton, J. B., Berrett, K. C., Gertz, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+Enhancer+Interference+Reveals+Collaborative+Control+of+Gene+Regulation+by+Estrogen+Receptor+alpha-Bound+Enhancers.">Multiplex Enhancer Interference Reveals Collaborative Control of Gene Regulation by Estrogen Receptor alpha-Bound Enhancers.</a> Cell Syst. 5 (4), 333-344 (2017).</li><li>Gilbert, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-mediated+modular+RNA-guided+regulation+of+transcription+in+eukaryotes.">CRISPR-mediated modular RNA-guided regulation of transcription in eukaryotes.</a> Cell. 154 (2), 442-451 (2013).</li><li>Ayer, D. E., Laherty, C. D., Lawrence, Q. A., Armstrong, A. P., Eisenman, R. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mad+proteins+contain+a+dominant+transcription+repression+domain.">Mad proteins contain a dominant transcription repression domain.</a> Mol Cell Biol. 16 (10), 5772-5781 (1996).</li><li>Alland, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+for+N-CoR+and+histone+deacetylase+in+Sin3-mediated+transcriptional+repression.">Role for N-CoR and histone deacetylase in Sin3-mediated transcriptional repression.</a> Nature. 387 (6628), 49-55 (1997).</li><li>Konermann, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optical+control+of+mammalian+endogenous+transcription+and+epigenetic+states.">Optical control of mammalian endogenous transcription and epigenetic states.</a> Nature. 500 (7463), 472-476 (2013).</li><li>Rennoll, S. A., Scott, S. A., Yochum, G. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+repression+of+AXIN2+and+MYC+gene+expression+using+designer+TALEs.">Targeted repression of AXIN2 and MYC gene expression using designer TALEs.</a> Biochem Biophys Res Commun. 446 (4), 1120-1125 (2014).</li><li>Stampfel, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional+regulators+form+diverse+groups+with+context-dependent+regulatory+functions.">Transcriptional regulators form diverse groups with context-dependent regulatory functions.</a> Nature. 528 (7580), 147-151 (2015).</li><li>Perez-Pinera, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-guided+gene+activation+by+CRISPR-Cas9-based+transcription+factors.">RNA-guided gene activation by CRISPR-Cas9-based transcription factors.</a> Nat Methods. 10 (10), 973-976 (2013).</li><li>Heigwer, F., Kerr, G., Boutros, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=E-CRISP:+fast+CRISPR+target+site+identification.">E-CRISP: fast CRISPR target site identification.</a> Nat Methods. 11 (2), 122-123 (2014).</li><li>Parsi, K. M., Hennessy, E., Kearns, N., Maehr, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+an+Inducible+CRISPR-dCas9-KRAB+Effector+System+to+Dissect+Transcriptional+Regulation+in+Human+Embryonic+Stem+Cells.">Using an Inducible CRISPR-dCas9-KRAB Effector System to Dissect Transcriptional Regulation in Human Embryonic Stem Cells.</a> Methods Mol Biol. , 221-233 (2017).</li><li>Romanienko, P. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Vector+with+a+Single+Promoter+for+In+Vitro+Transcription+and+Mammalian+Cell+Expression+of+CRISPR+gRNAs.">A Vector with a Single Promoter for In Vitro Transcription and Mammalian Cell Expression of CRISPR gRNAs.</a> PLoS One. 11 (2), e0148362 (2016).</li><li>Smith, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+RNAi+and+CRISPR+technologies+by+large-scale+gene+expression+profiling+in+the+Connectivity+Map.">Evaluation of RNAi and CRISPR technologies by large-scale gene expression profiling in the Connectivity Map.</a> PLoS Biol. 15 (11), e2003213 (2017).</li><li>Liu, X. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Editing+DNA+Methylation+in+the+Mammalian+Genome.">Editing DNA Methylation in the Mammalian Genome.</a> Cell. 167 (1), 233-247 (2016).</li><li>O'Geen, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=dCas9-based+epigenome+editing+suggests+acquisition+of+histone+methylation+is+not+sufficient+for+target+gene+repression.">dCas9-based epigenome editing suggests acquisition of histone methylation is not sufficient for target gene repression.</a> Nucleic Acids Res. 45 (17), 9901-9916 (2017).</li><li>Amabile, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inheritable+Silencing+of+Endogenous+Genes+by+Hit-and-Run+Targeted+Epigenetic+Editing.">Inheritable Silencing of Endogenous Genes by Hit-and-Run Targeted Epigenetic Editing.</a> Cell. 167 (1), 219-232 (2016).</li></ol>

저자는 공개 없다.

이 프로토콜 증강 기능 생 genomic 소재 시에 DNA 순서를 실제로 변경 하지 않고 해 부에 대 한 간단 하 고 유연한 방법을 설명 합니다. 반면 비슷한 개념 dCas9 리아27을 사용 하 여 이전에 게시 CRISPR 간섭 프로토콜, 증강 인자-i는 3 가지 주요 방법으로 이러한 프로토콜에서 다릅니다. 첫째, 증강 인자-i MAD120 증강 비활성화 달성 하기의 SIN3A 상호 작용 도메인을 활용 합니다. 증강 비활성화 HDAC 저 해제, 비활성화 하는 기본 메커니즘 HDAC 의존 하자를 사용 하 여 구출 될 수 있다. CRISPR dCas9-리아와 간섭, 달리 증강-i H3K9me3의 증 착에 연결 되지 않습니다. 사실은 RNAs, 3 일에 수확 되 고 세포 transfection 게시 가이드의 변이 도입에 의존 하는 증강 인자-i이 높습니다. CRISPR 간섭, H3K9me3 증가 7 일 게시물 변환12에서 관찰 됩니다. 마지막으로, 증강 인자-i 프로토콜 여러 사이트를 동시에 대상 및 대상의 효율성을 모니터링할 수 있는 전략을 제공 합니다. 모자이크-seq17, dCas9-리아는 여러 강화를 동시에, 대상 하는 데 사용 됩니다 하지만이 기술은 식 변화를 식별 하는 단일 셀 RNA 시퀀싱에 의존 하 고 (스 트로 겐-응답 유전자) 등 많은 유전자가 들 키 지 않고는 난청 단일 셀 RNA이 증강 인자-i의 감도 개별적으로 강화 연구 조합 어떤 유전자에 대 한 신뢰할 수 있는 방법을 제공 합니다.
증강 인자-i의 가장 중요 한 단계가 이다 transfection, 관심의 셀 라인에 대 한 최적화 되어야 합니다. 이 프로토콜 transfected 세포에 대 한 풍부 하 게 puromycin 치료에 의존 하지만 그 공동 transfecting 가이드 RNAs 형광 단백질 및 형광 셀 cytometry 사용 하 여 정렬 일부 셀에 대 한 더 나은 농축 방법으로 증명할 수 있습니다. 유형입니다. 문제 해결 및 확인 transfection 정량 식 가이드 RNAs의 수준과 SID4x-dCas9-리아 모니터링 하는 것이 좋습니다. 가이드 RNA 레벨은 낮은 경우 (사이클 임계값 > 30), 사용자가 고려할 수 있습니다 또한 대체 가이드 녹음 방송 생체 외에서 28등 RNA 생산 전략. 그것은 또한 가능한 높은 gRNA 수준에도 불구 하 고 가이드 RNA는 SID4x-dCas9-리아 단백질의 대상으로 하는 것은 비효율적, 어떤 경우에 다른 선택 가이드 RNA 시퀀스 할 수 있습니다. 증강 인자-i 치료 세포에서 chromatin와 융합 단백질에 칩 seq를 수행 하 여 대상으로의 효율성을 모니터링할 수 있습니다. SID4x-dCas9-리아, 관심 영역에서의 높은 신호는 그것의 상 상속 대상 유전자 식 변경 감지 하는 경우 다음 가능성이 지역 공부 하는 조건 하에서 그 유전자의 표정에 공헌 하지 않는다.
증강 인자-i의 한 가지 잠재적인 한계는 오프 대상 효과 너무 많은 사이트는 동시에 표적으로 하는 경우 누적 될 수 있습니다. 그럼에도 불구 하 고, 최저 CRISPR 방해 전략 있다 대상 효과 RNAi29, 보다 적은 특히 dCas9 리아 표현 polyclonal 셀 라인을 사용할 때. 우리가 본 SID4X-dCas9-리아의 게놈 바인딩 대상에서 동시에 10 개의 사이트를 대상으로 하는 동안 우리가 하지 그 바인딩 이벤트의 결과로 유전자 식 변경 확인 했습니다. 일부 강화 여러 발기인 또는 다른 강화 연락처 수 있습니다, 비록 유전자 규칙의이 형태는 일반적인 경우에 명확 하지 않다 많은 유전자 단일 증강의 대상으로 시 식에 변경 될 수 있음을 가능 하다. 식 변화는 특정 증강을 대상으로 관찰을 확인 하 고 오프-목표는 아니지만 효과, 사용자가 수행할 수 증강-i 겹치지 가이드 같은 지역 타겟팅 하는 RNAs의 두 가지 세트와 함께. 또한, nuclease 유능한 Cas9를 사용 하 여 영역의 유전자 삭제 추가 유전자 발현에 미치는 영향을 확인할 수 있습니다.
히스톤 deacetylation 통해 증강-i 기능으로 그것은 그것의 비활성화 능력 histone acetylation 감지할 수준을 강화 제한 가능. 타겟팅 특정 강화에 더 효과적일 수 있습니다 대체 억압 융해의 다양 한이 있다. DCas9 DNA methyltransferase 융해 유전자 발현 원심 강화30, 대상으로 하는 경우를 줄이기 위해 사용할 수 있습니다 하지만이 억압은 자주 과도. 또 다른 억압 적인 퓨전 히스톤 H3 리 27 trimethylation 리드 하 고 다양 한 세포 선 및 발기인31dCas9-리아와 비슷한 수준에서 유전자 발현을 누르는 GATA1 친구 (FOG1) 도메인을 사용 합니다. 흥미롭게도, 발기인, SID 도메인의 단일 복사본 증강-i에서 현재 사용 하는 4 복사본 보다 더 증강 비활성화를 제공할 수 있습니다 제안에 억압 적인 잠재력을 감소 dCas9 FOG1의 더 많은 복사본을 추가 합니다. 그것은 일부 loci 위의 dCas9 융해의 다른 조합에 의해 듀얼 타겟팅에서 이점을 얻을 수 있습니다. 예를 들어 안정적인 장기 억압 dCas9 DNMT3a 및 dCas9-리아32동시 변환에 의해 얻을 수 있습니다. 이러한 억압 적인 융해의 대부분만 타깃이 되어 단일 장소에 한 번에, 그리고 그것은 불분명 남아 있는 여러 강화를 동시에 조작에 가장 효과적 이다.
증강 인자-i, 유전자의 소수에 대 한 강화의 조합을 공부에 대 한 적합 한 방법 동안 사용자 putative 강화 유전자의 수백을 공부 하고자 하는 경우 처리량에 여전히 다소 제한 됩니다. 이 기술의 미래 응용 프로그램 이미징 기반 기술을 여러 샘플에서 여러 유전자를 동시에 계량을 통합할 예정 이다. 중요 한 것은, 이러한 기술은 시간이 걸리는 RNA 격리에 대 한 필요성을 제거, lysate에서 RNA 분자의 직접적인 탐지와 호환 됩니다. 이러한 적응 강화의 더 큰 세트의 심문을 촉진 한다.

시퀀싱 프로젝트 인코딩1, 로드맵 Epigenomics2, FANTOM 등 대규모3 확인 했습니다 인간 게놈 내 상 상속 강화의 수백만 수백 종류의 세포에서. 각 발기인 4.9 강화의 평균 연결 하 고 각 증강 연락처 2.4 유전자3의 평균 유전자 발현은 종종 여러 분산된 규정 상호 작용의 통합의 결과 제안 추정 된다. 중요 한 나머지 과제 정의 개별 강화 뿐만 아니라 유전자 발현에 기여 하는 하지만 어떻게 그들이 결합 하 여 식에 영향을 미칠. 유전 접근 일반적으로 쥐5 초파리4 에서 모형 유기 체에 강화 간의 관계를 식별 하는 데 사용 됩니다. 그러나,이 실험은 어렵고 여러 유전자에서 여러 강화의 연구에 대 한 낮은 처리량.
큰 규모로 증강 기능을 공부 하는 한 가지 방법은 대규모 병렬 기자 분석 실험을 포함 한다. 이 분석 실험 기자 유전자6식 드라이브를 그들의 능력에 대 한 DNA 시퀀스의 수천의 동시 상영에 대 한 수 있습니다. 이 분석 실험 DNA 순서 혼자 유전자 규칙 정보7전달 하기 충분할 수 나타났습니다, 그들은 온 네이티브 chromatin 컨텍스트 외부에서 수행 되 고의 주의 분리의 발기인. 또한, 대규모 병렬 기자 분석에 분석 되 고 DNA 시퀀스의 크기는 일반적으로 관련 주변 시퀀스를 제외 시킬 수 있습니다 미만 200 basepairs. 중요 한 것은, 기자가 분석만 한 번에 하나의 시퀀스의 활동 측정, 그들은 할 하지 고려 강화 사이 존재할 수 있는 복잡 한 관계. 따라서, 대규모 병렬 기자 분석 DNA 시퀀스의 본질적인 활동에 대 한 정보를 제공 될 수 있습니다, 그들은 할 하지 반드시 우리에 게는 게놈의 맥락에서 그 DNA 시퀀스의 기능.
최근 개발 된 CRISPR/Cas9 도구8 있다 그들은 내 생 로커 스에서 강화의 삭제에 대 한 허용 유전자 규칙의 연구를 촉진 했다. 그러나, genomic 불안정성으로 이어질 수 있습니다 여러 강화를 동시에 삭제 하 고 그것은 단일 셀 라인에서 연속 증강 삭제를 생성 하는 시간이 소요. 또한, 새로운 게놈 시퀀스 삭제 복구, 다음의 사이트에서 생성 되 고이 시퀀스 규제 기능을 얻을 수 있습니다. Cas9의 대체 버전9,10 활성화 또는 nuclease 불충분 한 형태의 Cas911,12 도메인을 억압의 융해에 의존 하는 유전자 발현을 변조를 위해 특별히 개발 되었습니다. (dCas9)입니다. 이 융해 단백질 그들은 육체적으로 DNA 순서를 변경 하 고 대신 epigenetics 규제 영역을 심문 하기 위해 변조로 여러 loci를 동시에 공부에 이상적입니다. 가장 널리 사용 되는 억압 적인 퓨전 리아, KAP1 공동 진압 복잡 한 신병이 억압 관련 히스톤 H3 리 진 9 trimethylation (H3K9me3)13의 증 착을 홍보입니다. dCas9-리아, 일컬어 CRISPR 간섭14,16; 유전자의 식15,그들의 공헌에 대 한 대상과 화면 개별 강화를 사용 되었습니다. 그러나, 그것은 하지 최적화 되었습니다 여러 영역을 동시에 대상에 대 한. 강화, 모자이크-seq17, 다중 CRISPR 간섭의 한 버전 사용 단일 셀 RNA-seq는 판독 하지만이 기술은 단일 셀의 낮은 감도 때문에 높게 표현한 유전자의 연구에만 적합 하 고 비싼 RNA-이
우리가 스 트로 겐에 transcriptional 응답의 컨텍스트 내에서 조합 증강 기능 해 부에 대 한 CRISPR 간섭을 기반 방법을 개발 하고자 했다. 스 트로 겐-응답 유전자의 약 절반 2 이상의 강화 근처의18, 에스트로겐 수용 체 알파 (응급실)을 준수할 여러 강화 에스트로겐 응답에 참여 하 고 규제 논리 필요 이해 수 있습니다 제안 포함 동시에 여러 명의 강화를 목표로. 초기 연구에서 발기인 CRISPR 방해를 사용 하 여 모든 발기인은 동등 하 게 리아 중재 억압19응답 제안, 우리 dCas9 별개의 억압 적인 도메인 추가의 비활성화를 촉진 수 있습니다 권유 다양 한 강화입니다. 우리 선택 Sin3a 상호 작용 도메인의 Mad1 (SID)20 히스톤 deacetylases21의 채용에 리드에 transcriptional 활동에 연관 된 히스톤 아 세 틸 그룹을 제거 하는. 중요 한 것은, SID 도메인 dCas922 와 이야기23, 융합 하는 때 유전자 발현을 감소에 효과적 이었고 Sin3a 다양 한 증강 시퀀스 컨텍스트24에 강력한 억압 적인 공동 요인이 될 표시 되었습니다. 우리 응급실, 준수할의 다른 강화 10 개를 대상으로 SID4x-dCas9-리아 (증강 인자-i)를 사용 하 고 응급실 바인딩 사이트 (ERBS) 4 유전자18에 스 트로 겐 transcriptional 응답에 필요한 식별 합니다. 우리는 또한 에스트로겐 transcriptional 응답의 생산에 협력 하는 사이트를 식별 하는 증강의 조합 대상. 우리는 50 개 사이트까지 잠재적으로 타겟팅 할 수 있습니다 동시에 감지 유전자 식 변화 발견. 칩 seq와 RNA-seq 사용 하 여, 우리는 증강-i은 여러 강화를 동시에 공부에 대 한 매우 구체적인 기술 시연 했다.
이 프로토콜에서 우리는 증강-i, 조직 문화 설정에 동시에 여러 강화의 기능 연구를 가능 하 게 하는 유연한 기술 수행에 관련 된 단계를 설명 합니다. 증강 인자-i 유전자 삭제와 상관 매우 하지만 히스톤 deacetylases (HDACs)에 따라 달라 집니다 일시적인 비활성화를 제공 합니다. 바이러스 성 벡터를 통해 안정적인 통합 반대 과도 transfection을 통해 가이드 RNAs를 제공,이 프로토콜 증 착 및 H3K9me3의 잠재적인 확산 방지 합니다. 이 프로토콜 세부 정보 가이드 RNA 디자인 및 깁슨 어셈블리의 transfection 통해 복제 RNAs lipofection를 사용 하 여 가이드와 결과 유전자 발현의 분석 정량 하 여 변경. 우리는 또한 게놈 transcriptome 수준에 증강-i 대상의 특이성을 평가 하기 위한 메서드가 포함 됩니다. 이 기술을 연구 개발 하는 동안 어 유전자 규정 강화 인간 암 세포 라인에서 어떤 포유류 증강의 해 부에 적용 됩니다.

<table><tbody><tr><td>ZR 96-well Quick-RNA Kit</td><td>Zymo Research</td><td>R1053</td><td></td></tr><tr><td>Power SYBR Green RNA-to-CT 1-Step</td><td>Applied Biosystems</td><td>4389986</td><td></td></tr><tr><td>AflII restriction enzyme</td><td>NEB</td><td>R0520S</td><td></td></tr><tr><td>Phusion High-Fidelity PCR Master Mix with HF Buffer</td><td>NEB</td><td>M0531L</td><td></td></tr><tr><td>NEBuilder HiFi DNA Assembly Master Mix</td><td>NEB</td><td>E2621L</td><td></td></tr><tr><td>FuGENE HD</td><td>Promega</td><td>E2312</td><td></td></tr><tr><td>DNA Clean &amp;amp; Concentrator Kit</td><td>Zymo Research</td><td>D4013</td><td></td></tr><tr><td>Buffer RLT Plus</td><td>Qiagen</td><td>1053393</td><td></td></tr><tr><td>b-estradiol</td><td>Sigma-Aldrich</td><td>E2758</td><td></td></tr><tr><td>Human: Ishikawa cells</td><td>ECACC</td><td>99040201</td><td></td></tr><tr><td>H3K27ac rabbit polyclonal</td><td>Active Motif&amp;nbsp;</td><td>39133</td><td></td></tr><tr><td>H3K9me3 rabbit polyclonal</td><td>Abcam&amp;nbsp;</td><td>ab8898</td><td></td></tr><tr><td>FLAG mouse monoclonal</td><td>Sigma-Aldrich&amp;nbsp;</td><td>F1804</td><td></td></tr><tr><td>ER alpha rabbit polyclonal</td><td>Santa Cruz</td><td>sc-544</td><td></td></tr><tr><td>pGL3-U6-PGK-Puro plasmid</td><td>Addgene&amp;nbsp;</td><td>51133</td><td>Shen et al., 2014</td></tr><tr><td>gRNA_cloningVector plasmid</td><td>Addgene&amp;nbsp;</td><td>41824</td><td>Mali et al., 2013</td></tr><tr><td>AflII U6 puromycin plasmid</td><td>Addgene&amp;nbsp;</td><td>106404</td><td>Carleton et al., 2017</td></tr><tr><td>SID4X-dCas9-KRAB plasmid</td><td>Addgene&amp;nbsp;</td><td>106399</td><td>Carleton et al., 2017</td></tr><tr><td>2-Mercaptoethanol</td><td>Sigma-Aldrich</td><td>M6250-10ML</td><td></td></tr><tr><td>UltraPure DNase/RNase-Free Distilled Water</td><td>ThermoFisher Scientific</td><td>10977-023</td><td></td></tr><tr><td>Opti-MEM I Reduced Serum Medium</td><td>Gibco</td><td>31985070</td><td></td></tr><tr><td>KAPA Stranded mRNA-Seq Kit, with KAPA mRNA Capture Beads</td><td>Kapa Biosytems</td><td>KK8420</td><td></td></tr><tr><td>Pierce Protease and Phosphatase Inhibitor Mini Tablets</td><td>ThermoFisher Scientific</td><td>A32959</td><td></td></tr><tr><td>Formaldehyde solution</td><td>Sigma-Aldrich</td><td>252549-25ML</td><td></td></tr><tr><td>Geneticin Selective Antibiotic (G418 Sulfate) (50 mg/mL)</td><td>ThermoFisher Scientific</td><td>10131035</td><td></td></tr><tr><td>LB Broth</td><td>ThermoFisher Scientific</td><td>10855001</td><td></td></tr><tr><td>Quick-DNA Miniprep Kit</td><td>Zymo Research</td><td>D3020</td><td></td></tr><tr><td>Quick-Load Purple 2-Log DNA Ladder</td><td>NEB</td><td>N0050S</td><td></td></tr></tbody></table>

dissection of enhancer function using multiplex crispr-based enhancer interference in cell lines

여러 강화 종종 주어진된 유전자 조절 아직 대부분 유전자에 대 한 그것은 불분명 남아 있는 강화 유전자 발현에 대 한 필요 하 고 어떻게 이러한 강화 결합 transcriptional 응답. 강화의 수백만 확인 되었습니다로 높은 처리량 도구 게놈 넓은 규모로 증강 기능 확인 필요 합니다. 증강 기능 공부에 대 한 현재 방법은 유전자 삭제 nuclease 실력 Cas9를 사용 하 여 만드는 포함 하지만 여러 연속 클론 셀 라인으로이 기술을 사용 하 여 여러 강화의 조합 효과 공부 하기 어려운 생성. 여기, 선물이 증강-i, 그들의 생 loci에서 동시에 여러 강화의 기능 심문 수 CRISPR 간섭 기반 방법. 증강 인자-i 타겟된 loci에서 히스톤 deacetylation 통해 증강 비활성화 달성 하기 위해 융합 nuclease 불충분 한 두 억압 도메인의 Cas9, SID와 리아, 사용 만든다. 이 프로토콜 가이드 대상된 지역의 일시적인 비활성화 수 있도록 RNAs의 과도 transfection를 활용 하 고 특히 조직 문화 설정에서 자극을 유도할 수 있는 transcriptional 응답을 차단에 효과적 이다. 증강 인자-i은 모두 그것의 게놈을 대상으로 글로벌 유전자 발현에 미치는 영향에 매우 구체적인. 이 프로토콜에서 얻은 결과 증강 유전자 발현, 기여, 규모와 어떻게 기여는 영향을 받는 다른 인근 강화에 기여 하 고 있는지 이해 하는 데 도움이.

그림 1 프로토콜에서 설명 하는 워크플로의 회로도 보여준다. 근처에 스 트로 겐 통제 유전자 MMP17, 칩 seq (그림 2A)에 의해 정의 된 인근 3 바인딩 사이트가 어 바운드 강화 기여 가이드 RNAs를 확인 하려면 각 지역에 대 한 설계 되었습니다. 디자인 가이드 RNAs, 시퀀스를 둘러싼 각 응급실의 600-900 bp 창 관심의 바인딩 사이트 선택 하 고 가이드 RNA 디자인 프로그램에 넣어 했다. 가이드 인 RNA 0-2 사이트는 BLAT을 사용 하 여 인간 게놈에 정렬 했다 목표 예측 시퀀스. 및 칩 seq에 의해 정의 된 영역을 스팬 RNAs 가이드 4 겹치지 DNaseI 과민 증 (그림 2B)를 대상으로 선정 됐다. 추가 시퀀스 (표 1) 다운스트림 복제 및 결과 59 뉴클레오티드 조각을 주문 했다 각 끝에 추가 되었습니다. 도착 후, 가이드 RNAs 희석 되었고 사이트, 그리고 짧은 PCR에 의해 풀링된 깁슨 조립 전에 상 동 영역을 추가 하려면 수행 되었다. 그림 2C 59 basepair의 각 끝에 시퀀스의 20 basepairs를 추가할 것입니다 "U6_internal" 뇌관 (표 1)를 사용 하 여 짧은 PCR 후 예상된 가이드 RNA 제품 가이드 RNA 조각, 100 ~ basepair 시퀀스에 결과 보여줍니다. 깁슨 어셈블리에 따라 이러한 가이드 RNA 풀 박테리아로 변형 되었다 그리고 플라스 미드 minipreps 다음 날을 준비 했다. 그림 2D MMP17 근처 여러 강화 혼자 표적으로 증강 해 부 실험, 및 조합 증강-i를 사용 하 여 결과 보여줍니다. 증강-i 대상 사이트는 검은 육각형으로 표시 됩니다. 표시 된 사이트를 대상으로 하는 가이드 RNA 플라스 미드를 박탈 하는 에스트로겐 이시카와 셀 라인으로 안정적으로 표현 하는 SID4X-dCas9-리아 페 했다. 2 일 후, 미디어 변경 되었습니다과 puromycin transfected 세포에 대 한 풍부 하 게 추가 되었습니다. 다음 날, 셀 8 h 10 nM estradiol 치료 따르는 것을 수확 했다. RNA 격리, 고 1 단계 정량 수행 되었다. 이 예제에서 사이트 1과 2는 사이트 3 (그림 2D, 레인 ii-4)이이 조건 하에서 기여 하지 않는 하는 동안 MMP17의 완전 한 estrogenic 응답 필요 하다. 때만 2 또는 3 사이트는 활성 (vi와 vii), 에스트로겐 응답은 때 없는 사이트는 유사한 활성 (viii), 제안 하는이 사이트를 독립적으로 기여할 수 없습니다. 사이트 1 자체 (v), 일부 식을 기여할 수 있지만 가장 큰 활동은 볼 때 사이트 1 및 2 활성 (iv).
4 다른 유전자 근처 10 강화를 동시에 조작 하기 (그림 3A)의 복잡 한 풀 가이드 RNAs 42 증강 가이드 및 16 발기인 가이드 생성 된. 가이드 RNA oligos 초기 가이드 RNA 확장 PCR (단계 3.3), 전에 풀링된 했다 그리고 결과 PCR 제품 정화 깁슨 어셈블리를 사용 하 여 빈 puromycin U6 클로닝 벡터와 결합 했다. 깁슨 어셈블리에 따라 여러 개의 독립적인 변환은 수행 하 고 도금 했다. 플레이트는 파운드에 긁힌 것 이었고 2-4 h maxiprep 이전에 대 한 밖으로 성장할 수 있습니다. 그림 3B 표시 대표 감소 유전자 발현에 정량 하 여 때 이러한 가이드 RNA 풀을 한 스 트로 겐 박탈 이시카와 셀 라인으로 안정적으로 표현 하는 SID4X-dCas9-리아 페 (그림 2D) 위에서 설명한 대로 처리 됩니다. 증강 인자-i에서 감소는 상 상속 대상 유전자의 발기인을 대상으로 얻은 그 비슷합니다. 그림 3C RNAs 증강-i를 사용 하 여 에스트로겐 응답의 감소에 가이드의 희석의 효과 보여줍니다. 1:50 G0S2 아직도 근처 증강을 대상으로 가이드 RNA 수영장의 희석 생성 증강-i 50까지를 대상으로 사용할 수 있습니다 제안 하는 유전자 발현에 있는 뜻깊은 감소는 한 번에 사이트. 그러나, 비활성화 사이트의 수백 더 민감한 탐지 방법을 채용 하지 않는 한 동시에 대상 수 없습니다 것을 나타내는, 희석 수 있습니다.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57883/57883fig1.jpg"> 그림 1입니다. 프로토콜 증강-나를 사용 하 여 다중 증강 해 부에 대 한 도식 가이드 RNAs (빨간색과 파란색)은 e-선명 및 UCSC 게놈 브라우저를 사용 하 여 선택한 사용 하 여 설계 되었습니다. 4 명의 가이드 RNAs는 관심 (전사 인자 바인딩 사이트 칩 seq에 의해 정의 된 대로) 영역에 걸쳐 선택 됩니다. (빨간색과 파란색)의 지역별 풀링된 가이드 RNA oligonucleotides 깁슨 어셈블리 및 변환 전에 상 동 영역 (주황색)을 추가 하는 PCR를 받 다. 안정적으로 표현 하는 SID4X-dCas9-리아 셀 라인 또는 SID4X-dCas9-리아 플라스 미드와 함께에서 야생-타입 셀 결과 플라스 미드 풀 lipofection을 통해 페는. 가이드 RNA 플라스 미드 풀은 한 번에 또는 동시에 여러 사이트를 대상으로 한 사이트를 대상으로 개별적으로 페 수 있습니다. Transfected 세포 가이드 RNAs를 포함 하는 셀에 대 한 풍부 하는 항생제로 처리 됩니다. 에 ~ 72 h 게시물 transfection, 세포 수확. 핵 산 정량, RNA-seq, 또는 칩이 추출 될 수 있다 <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/57883/57883fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57883/57883fig2.jpg"> 그림 2입니다. MMP17를 위한 RNA 설계 및 증강 해 부 안내. 근처 타겟 응급실 알파 바인딩된 강화 (회색)의 (A) 게놈 브라우저 화면 MMP17. 이 그림에서 칼튼, 외. 수정 되었습니다. 18. (B) 가이드 RNA 바인딩 사이트183에 대 한 설계. ER 칩 seq에 의해 정의 된에 대 한 바인딩 사이트는이 지역에 걸쳐 대상과 4 가이드 RNAs 타일입니다. 바인딩 사이트에 걸쳐 있는 DNaseI 감도 신호 가이드 RNA 디자인에 대 한 대상 시퀀스를 정의 하기 위해 사용할 수 있습니다. 칩 seq와 DNaseI HS 데이터 1 헤 (C) 대표 가이드 RNA 시퀀스 깁슨 어셈블리, 상 동 영역을 추가 하는 짧은 PCR을 받은 것에 대 한 준비가 된 10 nM estradiol로 치료 시 세포에서 얻은 했다. (D) MMP17 의 상대 식 정량 특정 지역 증강-i와 8-h 10 nM estradiol 치료의 대상으로 다음을 통해 측정. 식 세포 estradiol 치료 하지 않을 MMP17 의 CTCF 및 식 수준에 상대적입니다. 제어 가이드 RNAs의 발기인 대상 IL1RN. 모든 오차 막대를 나타내는 SEM, 이중 별표 나타냅니다 p < 0.01 및 단일 별표 나타냅니다 p < 쌍된 t-검정에서 0.05. 이 그림에서 칼튼, 수정 된 외. 18. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/57883/57883fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57883/57883fig3.jpg"> 그림 3입니다. 증강-i. 풀링 대상 근처에 다른 유전자를 동시에 여러 강화 바인딩 사이트와 풀링된 증강-i에 타겟이 될 발기인의 (A) 회로도 (B) 이시카와 셀에 E2 치료 증강-i 플라스 미드 풀 (녹색), (파란색) 발기인-i 플라스 미드 풀 또는 제어 gRNAs (화이트)18페 후 정량 Pcr로 측정 된 식에 효과. 모든 유전자에서 중요 한 감소는 증강 i 관찰 됩니다. 이 그림에서 칼튼, 수정 된 외. 18. (C) 가이드 G0S2를 대상으로 하는 RNAs의 다른 양의 페 이시카와 셀에 G0S2 식 레벨 e 2 치료 후에 효과. 상당한 감소 가이드 RNA의 소량으로도 볼 수 있다 (1시 50분 희석), 제안 하는 최대 50 개 사이트 동시에 대상 수 있습니다. 모든 오차 막대를 나타내는 SEM, 이중 별표 나타냅니다 p < 0.01 및 단일 별표 나타냅니다 p < 쌍된 t-검정에서 0.05. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/57883/57883fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>이름</td>
			<td>시퀀스</td>
		</tr>
<tr>
<td>U6_internal_F</td>
			<td>TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCG</td>
		</tr>
<tr>
<td>U6_internal_R</td>
			<td>GACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC</td>
		</tr>
<tr>
<td>U6_PCR_F</td>
			<td>CCAATTCAGTCGACTGGATCCGGTA</td>
		</tr>
<tr>
<td>U6_PCR_R</td>
			<td>AAAAAAAGCACCGACTCGGTGCCA</td>
		</tr>
<tr>
<td>gRNA_qPCR_F</td>
			<td>GCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCG</td>
		</tr>
<tr>
<td>gRNA_qPCR_R</td>
			<td>AAAAAGCACCGACTCGGTGCC</td>
		</tr>
<tr>
<td>dCas9_qPCR_F</td>
			<td>GTGACCGAGGGAATGAGAAA</td>
		</tr>
<tr>
<td>dCas9_qPCR_R</td>
			<td>AGCTGCTTCACGGTCACTTT</td>
		</tr>
<tr>
<td>pAC95_PCR_F</td>
			<td>AGAAGAGAAAGGTGGAGGCC</td>
		</tr>
<tr>
<td>pAC95_PCR_R</td>
			<td>CGTCACCGCATGTTAGAAGG</td>
		</tr>
<tr>
<td>SID4X_PCR_F</td>
			<td>CAATAGAAACTGGGCTTGTCG</td>
		</tr>
<tr>
<td>SID4X_PCR_R</td>
			<td>TCGTGCTTCTTATCCTCTTCC</td>
		</tr>
</tbody></table>표 1입니다. 가이드 RNA 확장 및 시퀀싱, 정량, 융해 단백질의 탐지 사용 한 뇌관

Watch this Scientific Journal Video about Dissection of Enhancer Function Using Multiplex CRISPR-based Enhancer Interference in Cell Lines at JoVE.com

Dissection of Enhancer Function Using Multiplex CRISPR-based Enhancer Interference in Cell Lines

이 프로토콜 설계 및 다중화 비활성화 융해 단백질 SID4X-dCas9-리아로 알려진 또한 증강 간섭 (증강 인자-i)와 강화의 대상으로 수행 하는 데 필요한 단계를 설명 합니다. 이 프로토콜 유전자 발현을 조절 하는 강화의 식별을 가능 하 게 일반적인 대상 유전자 규제 강화 간의 관계의 해 부를 촉진 한다.

증강 기능 다중 CRISPR 기반 증강 간섭 셀 라인에서의 해 부

Multiple enhancers often regulate a given gene, yet for most genes, it remains unclear which enhancers are necessary for gene expression, and how these ...

dissection-enhancer-function-using-multiplex-crispr-based-enhancer

Universidad de Cartagena UDEC

Research

JoVE Journal

Genetics

9.2K 조회수.  University of Utah. 이 프로토콜 설계 및 다중화 비활성화 융해 단백질 SID4X-dCas9-리아로 알려진 또한 증강 간섭 (증강 인자-i)와 강화의 대상으로 수행 하는 데 필요한 단계를 설명 합니다. 이 프로토콜 유전자 발현을 조절 하는 강화의 식별을 가능 하 게 일반적인 대상 유전자 규제 강화 간의 관계의 해 부를 촉진 한다.

비디오: Dissection of Enhancer Function Using Multiplex CRISPR-based Enhancer Interference in Cell Lines

Efficient Generation of hiPSC Neural Lineage Specific Knockin Reporters Using the CRISPR/Cas9 and Cas9 Double Nickase System

Gene targeting is a critical approach for characterizing gene functions in modern biomedical research. However, the efficiency of gene targeting in human cells has been low, which prevents the generation of human cell lines at a desired rate. The past two years have witnessed a rapid progression on improving efficiency of genetic manipulation by genome editing tools such as the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas (CRISPR-associated) system. This manuscript describes a protocol for generating lineage specific human induced pluripotent stem cell (hiPSC) reporters using CRISPR/Cas system assisted homologous recombination. Procedures for obtaining necessary components for making neural lineage reporter lines using the CRISPR/Cas system, focusing on construction of targeting vectors and single guide RNAs, are described. This protocol can be extended to platform establishment and mutation correction in hiPSCs.

Genome editing tools such as the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas (CRISPR-associated) system have greatly improved gene targeting efficiency in human induced pluripotent stem cells (hiPSCs). This manuscript describes a protocol for generating lineage specific hiPSC reporter using CRISPR/Cas system assisted homologous recombination.

hiPSC 신경 리니지 특정 올림피아 기자의 효율적인 생성 사용 CRISPR / Cas9 및 Cas9 더블 Nickase 시스템

Gene targeting is a critical approach for characterizing gene functions in modern biomedical research. However, the efficiency of gene targeting in human ...

연구

발생학

Genome Editing and Directed Differentiation of hPSCs for Interrogating Lineage Determinants in Human Pancreatic Development

Interrogating gene function in self-renewing or differentiating human pluripotent stem cells (hPSCs) offers a valuable platform towards understanding human development and dissecting disease mechanisms in a dish. To capitalize on this potential application requires efficient genome-editing tools to generate hPSC mutants in disease-associated genes, as well as in vitro hPSC differentiation protocols to produce disease-relevant cell types that closely recapitulate their in vivo counterparts. An efficient genome-editing platform for hPSCs named iCRISPR has been developed through the TALEN-mediated targeting of a Cas9 expression cassette in the AAVS1 locus. Here, the protocols for the generation of inducible Cas9 hPSC lines using cells cultured in a chemically defined medium and a feeder-free condition are described. Detailed procedures for using the iCRISPR system for gene knockout or precise genetic alterations in hPSCs, either through non-homologous end joining (NHEJ) or via precise nucleotide alterations using a homology-directed repair (HDR) template, respectively, are included. These technical procedures include descriptions of the design, production, and transfection of CRISPR guide RNAs (gRNAs); the measurement of the CRISPR mutation rate by T7E1 or RFLP assays; and the establishment and validation of clonal mutant lines. Finally, we chronicle procedures for hPSC differentiation into glucose-responsive pancreatic &#946;-like cells by mimicking in vivo pancreatic embryonic development. Combining iCRISPR technology with directed hPSC differentiation enables the systematic examination of gene function to further our understanding of pancreatic development and diabetes disease mechanisms.

Protocols to generate hPSC mutant lines using the iCRISPR platform and to differentiate hPSCs into glucose-responsive &#946;-like cells are described. Combining genome editing technology with hPSC-directed differentiation provides a powerful platform for the systematic analysis of the role of lineage determinants in human development and disease progression.

인간의 췌장 개발에 리니지의 결정 요인을 들여다보기위한 게놈 편집 및 hPSCs의 감독 차별화

Interrogating gene function in self-renewing or differentiating human pluripotent stem cells (hPSCs) offers a valuable platform towards understanding ...

유전학

Generating CRISPR/Cas9 Mediated Monoallelic Deletions to Study Enhancer Function in Mouse Embryonic Stem Cells

Enhancers control cell identity by regulating tissue-specific gene expression in a position and orientation independent manner. These enhancers are often located distally from the regulated gene in intergenic regions or even within the body of another gene. The position independent nature of enhancer activity makes it difficult to match enhancers with the genes they regulate. Deletion of an enhancer region provides direct evidence for enhancer activity and is the gold standard to reveal an enhancer's role in endogenous gene transcription. Conventional homologous recombination based deletion methods have been surpassed by recent advances in genome editing technology which enable rapid and precisely located changes to the genomes of numerous model organisms. CRISPR/Cas9 mediated genome editing can be used to manipulate the genome in many cell types and organisms rapidly and cost effectively, due to the ease with which Cas9 can be targeted to the genome by a guide RNA from a bespoke expression plasmid. Homozygous deletion of essential gene regulatory elements might lead to lethality or alter cellular phenotype whereas monoallelic deletion of transcriptional enhancers allows for the study of cis-regulation of gene expression without this confounding issue. Presented here is a protocol for CRISPR/Cas9 mediated deletion in F1 mouse embryonic stem (ES) cells (Mus musculus129 x Mus castaneus). Monoallelic deletion, screening and expression analysis is facilitated by single nucleotide polymorphisms (SNP) between the two alleles which occur on average every 125 bp in these cells.

Experimental validation of enhancer activity is best approached by loss-of-function analysis. Presented here is an efficient protocol that uses CRISPR/Cas9 mediated deletion to study allele-specific regulation of gene transcription in F1 ES cells which contain a hybrid genome (Mus musculus129 x Mus castaneus).

생성 CRISPR은 / Cas9 중재 Monoallelic 삭제할 경우는 마우스 배아 줄기 세포의 증강 기능을 연구하는

Enhancers control cell identity by regulating tissue-specific gene expression in a position and orientation independent manner. These enhancers are often ...

Genome Editing in Mammalian Cell Lines using CRISPR-Cas

The clustered regularly interspaced short palindromic repeats (CRISPR) system functions naturally in bacterial adaptive immunity, but has been successfully repurposed for genome engineering in many different living organisms. Most commonly, the wildtype CRISPR associated 9 (Cas9) or Cas12a endonuclease is used to cleave specific sites in the genome, after which the DNA double-stranded break is repaired via the non-homologous end joining (NHEJ) pathway or the homology-directed repair (HDR) pathway depending on whether a donor template is absent or present respectively. To date, CRISPR systems from different bacterial species have been shown to be capable of performing genome editing in mammalian cells. However, despite the apparent simplicity of the technology, multiple design parameters need to be considered, which often leave users perplexed about how best to carry out their genome editing experiments. Here, we describe a complete workflow from experimental design to identification of cell clones that carry desired DNA modifications, with the goal of facilitating successful execution of genome editing experiments in mammalian cell lines. We highlight key considerations for users to take note of, including the choice of CRISPR system, the spacer length, and the design of a single-stranded oligodeoxynucleotide (ssODN) donor template. We envision that this workflow will be useful for gene knockout studies, disease modeling efforts, or the generation of reporter cell lines.

CRISPR-Cas is a powerful technology to engineer the complex genomes of plants and animals. Here, we detail a protocol to efficiently edit the human genome using different Cas endonucleases. We highlight important considerations and design parameters to optimize editing efficiency.

포유류 세포 라인 CRISPR Cas를 사용 하 여 게놈 편집

The clustered regularly interspaced short palindromic repeats (CRISPR) system functions naturally in bacterial adaptive immunity, but has been ...

Investigation of the Transcriptional Role of a RUNX1 Intronic Silencer by CRISPR/Cas9 Ribonucleoprotein in Acute Myeloid Leukemia Cells

The bulk of the human genome (~98%) is comprised of non-coding sequences. Cis-regulatory elements (CREs) are non-coding DNA sequences that contain binding sites for transcriptional regulators to modulate gene expression. Alterations of CREs have been implicated in various diseases including cancer. While promoters and enhancers have been the primary CREs for studying gene regulation, very little is known about the role of silencer, which is another type of CRE that mediates gene repression. Originally identified as an adaptive immunity system in prokaryotes, CRISPR/Cas9 has been exploited to be a powerful tool for eukaryotic genome editing. Here, we present the use of this technique to delete an intronic silencer in the human RUNX1 gene and investigate the impacts on gene expression in OCI-AML3 leukemic cells. Our approach relies on electroporation-mediated delivery of two preassembled Cas9/guide RNA (gRNA) ribonucleoprotein (RNP) complexes to create two double-strand breaks (DSBs) that flank the silencer. Deletions can be readily screened by fragment analysis. Expression analyses of different mRNAs transcribed from alternative promoters help evaluate promoter-dependent effects. This strategy can be used to study other CREs and is particularly suitable for hematopoietic cells, which are often difficult to transfect with plasmid-based methods. The use of a plasmid- and virus-free strategy allows simple and fast assessments of gene regulatory functions.

Investigation of the Transcriptional Role of a RUNX1 Intronic Silencer by CRISPR/Cas9 Ribonucleoprotein in Acute Myeloid Leukemia Cells

Direct delivery of preassembled Cas9/guide RNA ribonucleoprotein complexes is a fast and efficient means for genome editing in hematopoietic cells. Here, we utilize this approach to delete a RUNX1 intronic silencer and examine the transcriptional responses in OCI-AML3 leukemic cells.

급성 골수성 백혈병 세포에서 CRISPR/Cas9 리보뉴클레오단백질에 의한 RUNX1 내성 소음기의 전사 적 역할 조사

The bulk of the human genome (~98%) is comprised of non-coding sequences. Cis-regulatory elements (CREs) are non-coding DNA sequences that contain binding ...

Lentiviral CRISPR/Cas9-Mediated Genome Editing for the Study of Hematopoietic Cells in Disease Models

Manipulating genes in hematopoietic stem cells using conventional transgenesis approaches can be time-consuming, expensive, and challenging. Benefiting from advances in genome editing technology and lentivirus-mediated transgene delivery systems, an efficient and economical method is described here that establishes mice in which genes are manipulated specifically in hematopoietic stem cells. Lentiviruses are used to transduce Cas9-expressing lineage-negative bone marrow cells with a guide RNA (gRNA) targeting specific genes and a red fluorescence reporter gene (RFP), then these cells are transplanted into lethally-irradiated C57BL/6 mice. Mice transplanted with lentivirus expressing non-targeting gRNA are used as controls. Engraftment of transduced hematopoietic stem cells are evaluated by flow cytometric analysis of RFP-positive leukocytes of peripheral blood. Using this method, ~90% transduction of myeloid cells and ~70% of lymphoid cells at 4 weeks after transplantation can be achieved. Genomic DNA is isolated from RFP-positive blood cells, and portions of the targeted site DNA are amplified by PCR to validate the genome editing. This protocol provides a high-throughput evaluation of hematopoiesis-regulatory genes and can be extended to a variety of mouse disease models with hematopoietic cell involvement.

Described are protocols for the highly efficient genome editing of murine hematopoietic stem and progenitor cells (HSPC) by the CRISPR/Cas9 system to rapidly develop mouse model systems with hematopoietic system-specific gene modifications.

질병 모델에서 조혈 세포의 연구를 위한 렌티바이러스 CRISPR/Cas9 매개 게놈 편집

Manipulating genes in hematopoietic stem cells using conventional transgenesis approaches can be time-consuming, expensive, and challenging. Benefiting ...

면역학 및 감염병학

In Vitro Selection of Engineered Transcriptional Repressors for Targeted Epigenetic Silencing

Gene inactivation is instrumental to study gene function and represents a promising strategy for the treatment of a broad range of diseases. Among traditional technologies, RNA interference suffers from partial target abrogation and the requirement for life-long treatments. In contrast, artificial nucleases can impose stable gene inactivation through induction of a DNA double strand break (DSB), but recent studies are questioning the safety of this approach. Targeted epigenetic editing via engineered transcriptional repressors (ETRs) may represent a solution, as a single administration of specific ETR combinations can lead to durable silencing without inducing DNA breaks.
ETRs are proteins containing a programmable DNA-binding domain (DBD) and effectors from naturally occurring transcriptional repressors. Specifically, a combination of three ETRs equipped with the KRAB domain of human ZNF10, the catalytic domain of human DNMT3A and human DNMT3L, was shown to induce heritable repressive epigenetic states on the ETR-target gene. The hit-and-run nature of this platform, the lack of impact on the DNA sequence of the target, and the possibility to revert to the repressive state by DNA demethylation on demand, make epigenetic silencing a game-changing tool. A critical step is the identification of the proper ETRs&#39; position on the target gene to maximize on-target and minimize off-target silencing. Performing this step in the final ex vivo or in vivo preclinical setting can be cumbersome.
Taking the CRISPR/catalytically dead Cas9 system as a paradigmatic DBD for ETRs, this paper describes a protocol consisting of the in vitro screen of guide RNAs (gRNAs) coupled to the triple-ETR combination for efficient on-target silencing, followed by evaluation of the genome-wide specificity profile of top hits. This allows for reduction of the initial repertoire of candidate gRNAs to a short list of promising ones, whose complexity is suitable for their final&#160;evaluation in the therapeutically relevant setting of interest.

In Vitro Selection of Engineered Transcriptional Repressors for Targeted Epigenetic Silencing

Here, we present a protocol for the in vitro selection of engineered transcriptional repressors (ETRs) with high, long-term, stable, on-target silencing efficiency and low genome-wide, off-target activity. This workflow allows for reducing an initial, complex repertoire of candidate ETRs to a short list, suitable for further evaluation in therapeutically relevant settings.

In Vitro (시험관 ) 표적 후성유전학적 침묵을 위한 엔지니어링된 전사 억제제 선택

Gene inactivation is instrumental to study gene function and represents a promising strategy for the treatment of a broad range of diseases. Among ...

생체공학

Generation of Genomic Deletions in Mammalian Cell Lines via CRISPR/Cas9

The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 system may be re-purposed for site-specific eukaryotic genome engineering. CRISPR/Cas9 is an inexpensive, facile, and efficient genome editing tool that allows genetic perturbation of genes and genetic elements. Here we present a simple methodology for CRISPR design, cloning, and delivery for the production of genomic deletions. In addition, we describe techniques for deletion, identification, and characterization. This strategy relies on cellular delivery of a pair of chimeric single guide RNAs (sgRNAs) to create two double strand breaks (DSBs) at a locus in order to delete the intervening DNA segment by non-homologous end joining (NHEJ) repair. Deletions have potential advantages as compared to single-site small indels given the efficiency of biallelic modification, ease of rapid identification by PCR, predictability of loss-of-function, and utility for the study of non-coding elements. This approach can be used for efficient loss-of-function studies of genes and genetic elements in mammalian cell lines.

CRISPR/Cas9 is a robust system to produce disruption of genes and genetic elements. Here we describe a protocol for the efficient creation of genomic deletions in mammalian cell lines using CRISPR/Cas9.

CRISPR / Cas9를 통해 포유 동물 세포주의 게놈에 삭제 세대

The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 system may be re-purposed for site-specific ...

생물학

Electroporation-Based CRISPR-Cas9-Mediated Gene Knockout in THP-1 Cells and Single-Cell Clone Isolation

The human acute monocytic leukemia (AML) THP-1 cell line is widely used as a model to study the functions of human monocyte-derived macrophages, including their interplay with significant human pathogens such as the human immunodeficiency virus (HIV). Compared to other immortalized cell lines of myeloid origin, THP-1 cells retain many intact inflammatory signaling pathways and display phenotypic characteristics that more closely resemble those of primary monocytes, including the ability to differentiate into macrophages when treated with phorbol-12-myristate 13-acetate (PMA). The use of CRISPR-Cas9 technology to engineer THP-1 cells through targeted gene knockout (KO) provides a powerful approach to better characterize immune-related mechanisms, including virus-host interactions. This article describes a protocol for efficient CRISPR-Cas9-based engineering using electroporation to deliver pre-assembled Cas9:sgRNA ribonucleoproteins into the cell nucleus. Using multiple sgRNAs targeting the same locus at slightly different positions results in the deletion of large DNA fragments, thereby increasing editing efficiency, as assessed by the T7 endonuclease I assay. CRISPR-Cas9-mediated editing at the genetic level was validated by Sanger sequencing followed by Inference of CRISPR Edits (ICE) analysis. Protein depletion was confirmed by immunoblotting coupled with a functional assay. Using this protocol, up to 100% indels in the targeted locus and a decrease of over 95% in protein expression were achieved. The high editing efficiency makes it convenient to isolate single-cell clones by limiting dilution.

The THP-1 cell line is widely used as a model to investigate the functions of human monocytes/macrophages across various biology-related research areas. This article describes a protocol for efficient CRISPR-Cas9-based engineering and single-cell clone isolation, enabling the production of robust and reproducible phenotypic data.

THP-1 세포의 전기천공법 기반 CRISPR-Cas9 매개 유전자 녹아웃 및 단일 세포 클론 분리

The human acute monocytic leukemia (AML) THP-1 cell line is widely used as a model to study the functions of human monocyte-derived macrophages, including ...

CRISPR Gene Editing Tool for MicroRNA Cluster Network Analysis

MicroRNAs (miRNAs) have emerged as important cellular regulators (tumor suppressors, pro-oncogenic factors) of cancer and metastasis. Most published studies focus on a single miRNA when characterizing the role of small RNAs in cancer. However, ~30%&#160;of human miRNA genes are organized in clustered units that are often co-expressed, indicating a complex and coordinated system of noncoding RNA regulation. A clearer understating of how clustered miRNA networks function cooperatively to regulate tumor growth, cancer aggressiveness, and drug resistance is required before translating noncoding small RNAs to the clinic.
The use of a high-throughput clustered regularly interspaced short palindromic repeats (CRISPR)-mediated gene editing procedure has been employed to study the oncogenic role of a genomic cluster of seven miRNA genes located within a locus spanning ~35,000 bp in length in the context of prostate cancer. For this approach, human cancer cell lines were infected with a lentivirus vector for doxycycline (DOX)-inducible Cas9 nuclease grown in DOX-containing medium for 48 h. The cells were subsequently co-transfected with synthetic trans-activating CRISPR RNA (tracrRNA) complexed with genomic site-specific CRISPR RNA (crRNA) oligonucleotides to allow the rapid generation of cancer cell lines carrying the entire miRNA cluster deletion and individual or combination miRNA gene cluster deletions within a single experiment.
The advantages of this high-throughput gene editing system are the ability to avoid time-consuming DNA vector subcloning, the flexibility in transfecting cells with unique guide RNA combinations in a 24-well format, and the lower-cost PCR genotyping using crude cell lysates. Studies using this streamlined approach promise to uncover functional redundancies and synergistic/antagonistic interactions between miRNA cluster members, which will aid in characterizing the complex small noncoding RNA networks involved in human disease and better inform future therapeutic design.

This protocol describes a high-throughput clustered regularly interspaced short palindromic repeats (CRISPR) gene editing workflow for microRNA cluster network analysis that allows the rapid generation of a panel of genetically modified cell lines carrying unique miRNA cluster member deletion combinations as large as 35 kb within a single experiment.

마이크로RNA 클러스터 네트워크 분석을 위한 CRISPR 유전자 편집 도구

MicroRNAs (miRNAs) have emerged as important cellular regulators (tumor suppressors, pro-oncogenic factors) of cancer and metastasis. Most published ...