Bu eser NIH/NHGRI R00 HG006922 ve NIH/NHGRI R01 HG008974 J.G. için ve avcı Kanser Enstitüsü tarafından desteklenmiştir. J.B.C. genetik T32GM007464 NIH eğitim programında tarafından desteklenmiştir.

<ol>
	<li>Consortium, E. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+integrated+encyclopedia+of+DNA+elements+in+the+human+genome.">An integrated encyclopedia of DNA elements in the human genome.</a> Nature. 489 (7414), 57-74 (2012).</li><li>Roadmap Epigenomics, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+analysis+of+111+reference+human+epigenomes.">Integrative analysis of 111 reference human epigenomes.</a> Nature. 518 (7539), 317-330 (2015).</li><li>Andersson, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+atlas+of+active+enhancers+across+human+cell+types+and+tissues.">An atlas of active enhancers across human cell types and tissues.</a> Nature. 507 (7493), 455-461 (2014).</li><li>Perry, M. W., Boettiger, A. N., Bothma, J. P., Levine, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Shadow+enhancers+foster+robustness+of+Drosophila+gastrulation.">Shadow enhancers foster robustness of Drosophila gastrulation.</a> Curr Biol. 20 (17), 1562-1567 (2010).</li><li>Lam, D. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Partially+redundant+enhancers+cooperatively+maintain+Mammalian+pomc+expression+above+a+critical+functional+threshold.">Partially redundant enhancers cooperatively maintain Mammalian pomc expression above a critical functional threshold.</a> PLoS Genet. 11 (2), e1004935 (2015).</li><li>Patwardhan, R. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massively+parallel+functional+dissection+of+mammalian+enhancers+in+vivo.">Massively parallel functional dissection of mammalian enhancers in vivo.</a> Nat Biotechnol. 30 (3), 265-270 (2012).</li><li>Savic, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Promoter-distal+RNA+polymerase+II+binding+discriminates+active+from+inactive+CCAAT/+enhancer-binding+protein+beta+binding+sites.">Promoter-distal RNA polymerase II binding discriminates active from inactive CCAAT/ enhancer-binding protein beta binding sites.</a> Genome Res. 25 (12), 1791-1800 (2015).</li><li>Mali, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-guided+human+genome+engineering+via+Cas9.">RNA-guided human genome engineering via Cas9.</a> Science. 339 (6121), 823-826 (2013).</li><li>Cheng, A. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplexed+activation+of+endogenous+genes+by+CRISPR-on,+an+RNA-guided+transcriptional+activator+system.">Multiplexed activation of endogenous genes by CRISPR-on, an RNA-guided transcriptional activator system.</a> Cell Res. 23 (10), 1163-1171 (2013).</li><li>Hilton, I. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenome+editing+by+a+CRISPR-Cas9-based+acetyltransferase+activates+genes+from+promoters+and+enhancers.">Epigenome editing by a CRISPR-Cas9-based acetyltransferase activates genes from promoters and enhancers.</a> Nat Biotechnol. , (2015).</li><li>Kearns, N. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+annotation+of+native+enhancers+with+a+Cas9-histone+demethylase+fusion.">Functional annotation of native enhancers with a Cas9-histone demethylase fusion.</a> Nat Methods. 12 (5), 401-403 (2015).</li><li>Thakore, P. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+specific+epigenome+editing+by+CRISPR-Cas9+repressors+for+silencing+of+distal+regulatory+elements.">Highly specific epigenome editing by CRISPR-Cas9 repressors for silencing of distal regulatory elements.</a> Nat Methods. 12 (12), 1143-1149 (2015).</li><li>Groner, A. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=KRAB-zinc+finger+proteins+and+KAP1+can+mediate+long-range+transcriptional+repression+through+heterochromatin+spreading.">KRAB-zinc finger proteins and KAP1 can mediate long-range transcriptional repression through heterochromatin spreading.</a> PLoS Genet. 6 (3), e1000869 (2010).</li><li>Qi, L. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Repurposing+CRISPR+as+an+RNA-guided+platform+for+sequence-specific+control+of+gene+expression.">Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression.</a> Cell. 152 (5), 1173-1183 (2013).</li><li>Fulco, C. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+mapping+of+functional+enhancer-promoter+connections+with+CRISPR+interference.">Systematic mapping of functional enhancer-promoter connections with CRISPR interference.</a> Science. 354 (6313), 769-773 (2016).</li><li>Joo, J. Y., Schaukowitch, K., Farbiak, L., Kilaru, G., Kim, T. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stimulus-specific+combinatorial+functionality+of+neuronal+c-fos+enhancers.">Stimulus-specific combinatorial functionality of neuronal c-fos enhancers.</a> Nat Neurosci. 19 (1), 75-83 (2016).</li><li>Xie, S., Duan, J., Li, B., Zhou, P., Hon, G. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplexed+Engineering+and+Analysis+of+Combinatorial+Enhancer+Activity+in+Single+Cells.">Multiplexed Engineering and Analysis of Combinatorial Enhancer Activity in Single Cells.</a> Mol Cell. 66 (2), 285-299 (2017).</li><li>Carleton, J. B., Berrett, K. C., Gertz, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+Enhancer+Interference+Reveals+Collaborative+Control+of+Gene+Regulation+by+Estrogen+Receptor+alpha-Bound+Enhancers.">Multiplex Enhancer Interference Reveals Collaborative Control of Gene Regulation by Estrogen Receptor alpha-Bound Enhancers.</a> Cell Syst. 5 (4), 333-344 (2017).</li><li>Gilbert, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-mediated+modular+RNA-guided+regulation+of+transcription+in+eukaryotes.">CRISPR-mediated modular RNA-guided regulation of transcription in eukaryotes.</a> Cell. 154 (2), 442-451 (2013).</li><li>Ayer, D. E., Laherty, C. D., Lawrence, Q. A., Armstrong, A. P., Eisenman, R. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mad+proteins+contain+a+dominant+transcription+repression+domain.">Mad proteins contain a dominant transcription repression domain.</a> Mol Cell Biol. 16 (10), 5772-5781 (1996).</li><li>Alland, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+for+N-CoR+and+histone+deacetylase+in+Sin3-mediated+transcriptional+repression.">Role for N-CoR and histone deacetylase in Sin3-mediated transcriptional repression.</a> Nature. 387 (6628), 49-55 (1997).</li><li>Konermann, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optical+control+of+mammalian+endogenous+transcription+and+epigenetic+states.">Optical control of mammalian endogenous transcription and epigenetic states.</a> Nature. 500 (7463), 472-476 (2013).</li><li>Rennoll, S. A., Scott, S. A., Yochum, G. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+repression+of+AXIN2+and+MYC+gene+expression+using+designer+TALEs.">Targeted repression of AXIN2 and MYC gene expression using designer TALEs.</a> Biochem Biophys Res Commun. 446 (4), 1120-1125 (2014).</li><li>Stampfel, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional+regulators+form+diverse+groups+with+context-dependent+regulatory+functions.">Transcriptional regulators form diverse groups with context-dependent regulatory functions.</a> Nature. 528 (7580), 147-151 (2015).</li><li>Perez-Pinera, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-guided+gene+activation+by+CRISPR-Cas9-based+transcription+factors.">RNA-guided gene activation by CRISPR-Cas9-based transcription factors.</a> Nat Methods. 10 (10), 973-976 (2013).</li><li>Heigwer, F., Kerr, G., Boutros, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=E-CRISP:+fast+CRISPR+target+site+identification.">E-CRISP: fast CRISPR target site identification.</a> Nat Methods. 11 (2), 122-123 (2014).</li><li>Parsi, K. M., Hennessy, E., Kearns, N., Maehr, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+an+Inducible+CRISPR-dCas9-KRAB+Effector+System+to+Dissect+Transcriptional+Regulation+in+Human+Embryonic+Stem+Cells.">Using an Inducible CRISPR-dCas9-KRAB Effector System to Dissect Transcriptional Regulation in Human Embryonic Stem Cells.</a> Methods Mol Biol. , 221-233 (2017).</li><li>Romanienko, P. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Vector+with+a+Single+Promoter+for+In+Vitro+Transcription+and+Mammalian+Cell+Expression+of+CRISPR+gRNAs.">A Vector with a Single Promoter for In Vitro Transcription and Mammalian Cell Expression of CRISPR gRNAs.</a> PLoS One. 11 (2), e0148362 (2016).</li><li>Smith, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+RNAi+and+CRISPR+technologies+by+large-scale+gene+expression+profiling+in+the+Connectivity+Map.">Evaluation of RNAi and CRISPR technologies by large-scale gene expression profiling in the Connectivity Map.</a> PLoS Biol. 15 (11), e2003213 (2017).</li><li>Liu, X. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Editing+DNA+Methylation+in+the+Mammalian+Genome.">Editing DNA Methylation in the Mammalian Genome.</a> Cell. 167 (1), 233-247 (2016).</li><li>O'Geen, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=dCas9-based+epigenome+editing+suggests+acquisition+of+histone+methylation+is+not+sufficient+for+target+gene+repression.">dCas9-based epigenome editing suggests acquisition of histone methylation is not sufficient for target gene repression.</a> Nucleic Acids Res. 45 (17), 9901-9916 (2017).</li><li>Amabile, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inheritable+Silencing+of+Endogenous+Genes+by+Hit-and-Run+Targeted+Epigenetic+Editing.">Inheritable Silencing of Endogenous Genes by Hit-and-Run Targeted Epigenetic Editing.</a> Cell. 167 (1), 219-232 (2016).</li></ol>

Yazarlar ifşa gerek yok.

Bu iletişim kuralı fiziksel olarak DNA dizisi değiştirmeden artırıcı fonksiyon için endojen genomik locus dissekan için basit ve esnek bir yöntem açıklanır. Benzer olsa da kavram dCas9 KRAB27kullanarak daha önce yayımlanmış CRISPR girişim iletişim kuralları, Enhancer-i 3 ana şekilde bu iletişim kurallarından farklıdır. İlk olarak, Enhancer-i artırıcı devre dışı bırakma ulaşmak için MAD120 SIN3A etkileşen etki alanı kullanır. Artırıcı devre dışı bırakma HDAC inhibitörleri, devre dışı bırakma birincil mekanizma HDAC bağımlı olduğunu düşündüren kullanarak kurtarıldı. CRISPR dCas9-KRAB müdahale, Enhancer-i H3K9me3 birikimi yol açmaz. Gerçeğini Enhancer-i RNA'ların, transfection 3 gün hasat hücreleri ile göndermek Kılavuzu geçici giriş üzerinde dayanır nedeniyle muhtemeldir. CRISPR müdahale, 7 gün mesaj iletim12, H3K9me3 bir artış görülmektedir. Son olarak, birden çok siteyi aynı anda hedef ve hedefleme etkinliğini izlemek için bir strateji Enhancer-i Protokolü sağlar. Mozaik-seq17, dCas9-KRAB aynı anda birden fazla arttırıcılar hedeflemek için kullanılır ama bu tekniği ifade değişiklikleri tanımlamak için tek hücreli RNA sıralama dayanıyor ve (gibi östrojen duyarlı genler) birçok genler nedeniyle düşük undetected gitmek tek hücreli RNA-seq. Enhancer-i duyarlılığını ayrı ayrı ve birlikte herhangi bir gen arttırıcılar çalışmak için güvenilir bir yöntem sağlar.
En kritik artırıcı-i transfection, faiz hücre satırı için optimize edilmelidir adımdır. Puromisindir tedavi transfected hücreler için zenginleştirmek için bu protokolü kullanır ama bu ortak transfecting RNA'ların floresan bir protein ve Kılavuzu akış sitometresi kullanarak floresan hücreleri için sıralama bazı hücre için daha iyi bir zenginleştirme yöntemi olarak kanıtlamak Mayıs mümkündür türleri. İfade düzey kılavuzun RNA'ların ve SID4x-dCas9-KRAB gidermek ve transfection onaylamak için qPCR tarafından izlenmesi tavsiye ediyoruz. Kılavuzu RNA düzeyleri düşüktür (döngüsü eşik > 30), kullanıcılar ayrıca RNA üretim stratejileri vitro transkripsiyon28gibi alternatif Kılavuzu düşünün. Yüksek gRNA düzeyleri rağmen Kılavuzu RNA SID4x-dCas9-KRAB protein verimsiz hedefliyor, bu durumda farklı Seçme Kılavuzu RNA dizilerinin gerekli olabilir olanağı da sağlar. Füzyon proteini ile kromatin Enhancer-i tedavi hücrelerden üzerinde ChIP-seq gerçekleştirerek, hedefleme verimliliğini takip edilebilir. SID4x-dCas9-KRAB adlı bölge ilgi yüksek sinyal ve onun sözde hedef gen ifade değişiklik tespit edilir ise, o zaman büyük olasılıkla bölge okudu koşullar altında bu gen ifadesi için katkı sağlamamaktadır.
Bir potansiyel Enhancer-i çok fazla siteleri aynı anda hedeflenir Eğer hedef kapalı etkileri birikebilir kısıtlamasıdır. Yine de, özellikle dCas9 KRAB ifade poliklonal hücre satırı kullanıldığında CRISPR müdahale stratejileri nakavt için az daha RNAi29, hedef etkileri off olmasını. SID4X-dCas9-KRAB hedef kapalı genomik bağlama 10 site aynı anda hedeflerken gördün mü iken, biz gen ifade değişikliklerin sonucu olarak bağlama olayları belirlenememiştir. Bazı arttırıcılar birden çok organizatör ve/veya diğer arttırıcılar ile temasa geçebilirsiniz, gen düzenlemesi bu tür ortak ise belirsiz olmasına rağmen birçok gen ifade tek bir artırıcı hedefleme üzerine değişebilir mümkündür. İfade değişiklikleri belirli bir artırıcı hedefleme nedeniyle çoğu gözlenen onaylamak ve off-efektler hedef değil için Kullanıcı Kılavuzu aynı bölge hedefleme RNA'ların üst üste iki farklı kümesi ile Enhancer-i gerçekleştirebilirsiniz. Buna ek olarak, nükleaz yetkili Cas9 kullanarak bölge genetik silinmesi daha fazla gen ekspresyonu üzerindeki etkileri onaylayabilirsiniz.
Histon deasetilasyonu, aracılığıyla Enhancer-i işlevleri olarak devre dışı bırakma yetenekleri histon asetilasyon kayda değer düzeyine sahip arttırıcılar sınırlıdır mümkündür. Belirli arttırıcılar hedefleme daha etkili olabilir alternatif baskıcı füzyon çeşitli vardır. DNA metiltransferaz füzyon dCas9 için distal arttırıcılar30' a hedef zaman gen ekspresyonu azaltmak için kullanılabilir, ancak bu baskı genellikle geçici değildir. Başka bir baskıcı füzyon histon H3 lizin 27 trimethylation yol açar..... .şarap gen ekspresyonu dCas9-KRAB için benzer düzeyde hücre satırları ve rehberleri31çeşitli, GATA1 arkadaş (FOG1) etki alanı kullanır. İlginçtir, dCas9 için FOG1 daha fazla kopya ekleme rehberleri, SID'si etki alanı tek bir kopyasını şu anda Enhancer-i içinde kullanılan 4 kopya daha daha fazla artırıcı deaktivasyon sağlayabilir düşündüren, baskıcı potansiyel azalır. Bazı loci yukarıdaki dCas9 füzyon farklı kombinasyonları ikili hedefleme üzerinden yararlanabilir mümkündür. Örneğin, istikrarlı uzun vadeli baskı dCas9-DNMT3a ve dCas9-KRAB32eşzamanlı iletim tarafından elde edilebilir. Bu baskıcı füzyon çoğu sadece tek bir odağı bir anda hedef ve aynı anda birden fazla arttırıcılar manipüle en etkili olduğu belirsizdir.
Kullanıcı genler yüzlerce sözde arttırıcılar çalışma isterse enhancer-i, genler, bir avuç arttırıcılar kombinasyonları çalışmak için uygun bir yöntem ise biraz hala'nın üretimi sınırlı. Bu tekniğin gelecekteki uygulamalar aynı anda birden fazla örnekleri içinde birden çok gen ölçmek için görüntüleme tabanlı teknolojiler dahil edecektir. Önemlisi, bu teknolojilerin zaman alan RNA izolasyon ihtiyacını ortadan kaldırarak RNA molekülleri lysate, üzerinden doğrudan tespiti ile uyumlu. Bu uyarlamalar arttırıcılar büyük kümeleri sorgulama kolaylaştıracaktır.

Büyük ölçekli projeler kodla1, yol haritası Epigenomics2ve FANTOM gibi sıralama3 belirledik insan genomu içinde sözde arttırıcılar milyonlarca hücre türleri yüzlerce arasında. Bu her organizatörü ortalama 4,9 arttırıcılar ile ilişkilendirir ve gen ekspresyonu kez birden çok dağıtılmış düzenleyici etkileşimleri bütünleştirilmesi sonucu olduğunu düşündüren her artırıcı ortalama 2.4 genler3, ilgili kişileri tahmin edilmektedir. Bir önemli kalan sadece tek tek nasıl arttırıcılar gen ekspresyonu için katkıda tanımlamak için mücadeledir ama nasıl ifade etkiler için birleştirir. Genetik yaklaşımlar arttırıcılar fareler5 Drosophila4 model organizmalarda arasındaki ilişkileri tanımlamak için yaygın olarak kullanılır. Ancak, bu deneyler zaman alıcı ve düşük-üretim için birden çok gen, birden çok arttırıcılar çalışma vardır.
Artırıcı işlevi büyük ölçüde çalışmak için bir yaklaşım kitlesel paralel muhabir deneyleri içerir. Bu deneyleri DNA dizileri için yeteneklerini ifade bir muhabir gen6sürücü için binlerce eşzamanlı tarama sağlar. Bu deneyleri DNA dizisi yalnız gen yönetmelik bilgileri7iletmek için yeterli olabilir göstermiştir, onlar yerel kromatin bağlam dışında gerçekleştirilen uyarılar ve kapaklı bir organizatörü ile gelmek. Buna ek olarak, DNA dizisi kitlesel paralel muhabir deneyleri içinde analiz ediliyor genellikle ilgili çevresindeki sıra hariç tutabilirsiniz az 200 basepairs boyutudur. Muhabir deneyleri sadece bir dizi etkinlik teker teker ölçmek. gibi önemlisi, onlar dikkate arttırıcılar arasında bulunabilir karmaşık ilişkiler yapmak değil almak. Kitlesel paralel muhabir deneyleri bir DNA dizisi içsel etkinlikler hakkında bilgilendirici olabilir, böylece, onlar mutlaka bize o DNA dizisi genom bağlamında işlev bilgi yok.
Son zamanlarda gelişmiş CRISPR/Cas9 Araçlar8 kolaylaştırdı gen düzenlemesi çalışmanın arttırıcılar endojen odağı, silme için izin kadar. Ancak, aynı anda birden fazla arttırıcılar silme için genomik istikrarsızlık neden olabilir ve zaman alan ardışık artırıcı silmeleri bir tek hücre satırı oluşturmak için. Buna ek olarak, yeni genomik sıra onarım takip silme sitesinde oluşturulur ve bu dizi düzenleyici fonksiyonu kazanç olabilir. Cas9 alternatif versiyonu özellikle gen ekspresyonu,9,10 etkinleştirme veya11,12 etki alanlarına Cas9 nükleaz eksikliği şeklinde bastırmak füzyon güvenerek oransal için geliştirilmiştir (dCas9). Bu füzyon proteinler onlar fiziksel olarak DNA dizisi alter, bunun yerine bir düzenleyici bölgesi sorgulamak için epigenetik modüle olarak ve aynı anda birden fazla loci eğitimi için idealdir. En çok kullanılan baskıcı KAP1 Co önleyici karmaşık acemi, baskı ilişkili histon H3 lizin 9 trimethylation (H3K9me3)13birikimi teşvik KRAB, birleşimidir. dCas9-KRAB, olarak da bilinen CRISPR girişim14, hedef ve ekran bireysel arttırıcılar gen ifade15,16katkılarından dolayı kullanılmıştır; Ancak, bu aynı anda birden çok bölge hedefleme için optimize edilmiş değil. Çok katmanlı CRISPR girişim arttırıcılar, mozaik-seq17, için bir sürüm tek hücre RNA-seq bir okuma kullanır ama bu teknoloji pahalı ve yalnızca tek hücre düşük duyarlılık nedeniyle son derece ifade genler incelenmesi uygundur RNA-devamı.
Kombinatorik artırıcı işlev bağlamında, östrojen transkripsiyon bir yanıt dissekan için girişim tabanlı bir CRISPR yöntem geliştirmek için çalıştı. Yaklaşık yarısı östrojen duyarlı genlerin birden çok arttırıcılar olabilir östrojen yanıt olarak katılan ve düzenleyici mantık gerektirecektir anlama olduğunu düşündüren östrojen reseptör Alfa (ER) tarafından18, bağlı 2 veya daha fazla artırıcılar içeren aynı anda birden fazla arttırıcılar hedefleme. İlk çalışmalar CRISPR girişim Organizatör kullanarak tüm rehberleri KRAB-aracılı baskı19' a eşit derecede duyarlı ettiği gibi dCas9 için ayrı baskıcı etki alanı eklenmesi, etkinliğini kolaylaştırabilir gerekçeli çeşitli arttırıcılar. Histon uyku21, işe alım açar gibi Sin3a etkileşim etki alanı, Mad1 (SID)20 hangi transkripsiyon aktivitesiyle ilişkili histon asetil grupları kaldırmak seçtik. Önemlisi, SID'si etki alanı dCas922 ve TALEs23erimiş zaman gen ekspresyonu azaltılmasını etkili oldu ve Sin3a artırıcı sıra bağlamlarda24çeşitli güçlü bir baskıcı ortak faktör gösterdi. Biz 10 farklı arttırıcılar ER tarafından bağlı hedeflemek için SID4x-dCas9-KRAB (Enhancer-i) kullanılan ve östrojen transkripsiyon yanıt 4 genler18için gerekli olan ER bağlayıcı siteleri (ERBS) tanımlar. Biz de östrojen transkripsiyon yanıt üretimde işbirliği siteleri tanımlamak için arttırıcılar kombinasyonları hedefli. En fazla 50 siteler potansiyel olarak aynı anda tespit gen ifade değişikliklerle hedeflenebilir ki bulduk. ChIP-seq ve RNA-seq kullanarak, Enhancer-i aynı anda birden fazla arttırıcılar eğitim için çok özel bir teknik olduğunu gösterdi.
Bu protokol için Enhancer-i, bir doku kültürü ortamında aynı anda birden fazla arttırıcılar fonksiyonel çalışma sağlayan esnek bir teknik gerçekleştirme adımları açıklar. Artırıcı-i genetik silme işlemine son derece ilişkilidir ama histon uyku (HDACs) üzerinde bağlıdır geçici etkinliğini kaldırmayı sağlar. Kılavuzu RNA'ların aksine viral vektörler aracılığıyla kararlı tümleştirme geçici transfection üzerinden sunarak, bu iletişim kuralı ifade ve potansiyel H3K9me3 yayılmasını önler. Bu protokolü ayrıntılar kılavuzu RNA tasarım ve Gibson derleme yolu ile transfection, klonlama RNA'ların lipofection kullanma kılavuzu ve qPCR tarafından elde edilen gen ekspresyon Analizi değiştirir. Biz de Enhancer-i genom ve transcriptome düzeyinde hedefleme özgüllüğü değerlendirmek için yöntemler içerir. Bu teknik eğitim için geliştirilen gen düzenlemesi er arttırıcılar insan kanser hücre hatlarında bağlı, herhangi bir memeli artırıcı diseksiyon için geçerlidir.

<table border="0" cellpadding="0" cellspacing="0" width="742">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:344px;">ZR 96-well Quick-RNA Kit</td>
			<td style="width:112px;">Zymo Research</td>
			<td style="width:119px;">R1053</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Power SYBR Green RNA-to-CT 1-Step</td>
			<td>Applied Biosystems</td>
			<td>4389986</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:344px;">AflII restriction enzyme</td>
			<td style="width:112px;">NEB</td>
			<td style="width:119px;">R0520S</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:344px;">Phusion High-Fidelity PCR Master Mix with HF Buffer</td>
			<td style="width:112px;">NEB</td>
			<td style="width:119px;">M0531L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:344px;">NEBuilder HiFi DNA Assembly Master Mix</td>
			<td style="width:112px;">NEB</td>
			<td style="width:119px;">E2621L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:344px;">FuGENE HD</td>
			<td style="width:112px;">Promega</td>
			<td style="width:119px;">E2312</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:344px;">DNA Clean &#38; Concentrator Kit</td>
			<td style="width:112px;">Zymo Research</td>
			<td style="width:119px;">D4013</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:344px;">Buffer RLT Plus</td>
			<td style="width:112px;">Qiagen</td>
			<td style="width:119px;">1053393</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:344px;">b-estradiol</td>
			<td style="width:112px;">Sigma-Aldrich</td>
			<td style="width:119px;">E2758</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:344px;">Human: Ishikawa cells</td>
			<td style="width:112px;">ECACC</td>
			<td style="width:119px;">99040201</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:344px;">H3K27ac rabbit polyclonal</td>
			<td style="width:112px;">Active Motif&#160;</td>
			<td style="width:119px;">39133</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:344px;">H3K9me3 rabbit polyclonal</td>
			<td style="width:112px;">Abcam&#160;</td>
			<td style="width:119px;">ab8898</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:344px;">FLAG mouse monoclonal</td>
			<td style="width:112px;">Sigma-Aldrich&#160;</td>
			<td style="width:119px;">F1804</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:344px;">ER alpha rabbit polyclonal</td>
			<td style="width:112px;">Santa Cruz</td>
			<td style="width:119px;">sc-544</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:344px;">pGL3-U6-PGK-Puro plasmid</td>
			<td style="width:112px;">Addgene&#160;</td>
			<td style="width:119px;">51133</td>
			<td style="width:167px;">Shen et al., 2014</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:344px;">gRNA_cloningVector plasmid</td>
			<td style="width:112px;">Addgene&#160;</td>
			<td style="width:119px;">41824</td>
			<td style="width:167px;">Mali et al., 2013</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:344px;">AflII U6 puromycin plasmid</td>
			<td style="width:112px;">Addgene&#160;</td>
			<td style="width:119px;">106404</td>
			<td>Carleton et al., 2017</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:344px;">SID4X-dCas9-KRAB plasmid</td>
			<td style="width:112px;">Addgene&#160;</td>
			<td style="width:119px;">106399</td>
			<td>Carleton et al., 2017</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:344px;">2-Mercaptoethanol</td>
			<td style="width:112px;">Sigma-Aldrich</td>
			<td style="width:119px;">M6250-10ML</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:344px;">UltraPure DNase/RNase-Free Distilled Water</td>
			<td style="width:112px;">ThermoFisher Scientific</td>
			<td style="width:119px;">10977-023</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:344px;">Opti-MEM I Reduced Serum Medium</td>
			<td style="width:112px;">Gibco</td>
			<td align="right" style="width:119px;">31985070</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:344px;">KAPA Stranded mRNA-Seq Kit, with KAPA mRNA Capture Beads</td>
			<td style="width:112px;">Kapa Biosytems</td>
			<td style="width:119px;">KK8420</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:344px;">Pierce Protease and Phosphatase Inhibitor Mini Tablets</td>
			<td style="width:112px;">ThermoFisher Scientific</td>
			<td style="width:119px;">A32959</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:344px;">Formaldehyde solution</td>
			<td style="width:112px;">Sigma-Aldrich</td>
			<td style="width:119px;">252549-25ML</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:344px;">Geneticin Selective Antibiotic (G418 Sulfate) (50 mg/mL)</td>
			<td style="width:112px;">ThermoFisher Scientific</td>
			<td align="right" style="width:119px;">10131035</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:344px;">LB Broth</td>
			<td style="width:112px;">ThermoFisher Scientific</td>
			<td align="right" style="width:119px;">10855001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:344px;">Quick-DNA Miniprep Kit</td>
			<td style="width:112px;">Zymo Research</td>
			<td style="width:119px;">D3020</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:344px;">Quick-Load Purple 2-Log DNA Ladder</td>
			<td style="width:112px;">NEB</td>
			<td style="width:119px;">N0050S</td>
			<td></td>
		</tr>
	</tbody>
</table>

dissection of enhancer function using multiplex crispr-based enhancer interference in cell lines

Birden çok arttırıcılar, genellikle belirli bir gen düzenleyen henüz çoğu genler için bu hangi arttırıcılar gen ekspresyonu için gereklidir ve bu arttırıcılar transkripsiyon bir yanıt üretmek için birleştirmek nasıl belirsizdir. Arttırıcılar milyonlarca tanımlandığı gibi yüksek üretilen iş araçları bir genom geniş ölçekte artırıcı işlevini belirlemek için gereklidir. Nükleaz-usta Cas9 kullanarak genetik silme işlemlerini yapma artırıcı işlev eğitim için geçerli yöntemleri içerir, ancak birden çok ardışık klonal hücre satırı olmalıdır gibi bu tekniği kullanarak birden çok arttırıcılar Kombinatorik etkileri çalışma zordur oluşturulan. Burada, Enhancer-i, onların endojen loci, aynı anda birden fazla arttırıcılar fonksiyonel sorgulama için izin veren bir CRISPR parazit tabanlı yöntem mevcut. Artırıcı-i nükleaz eksikliği için erimiş iki baskıcı etki alanlarının Cas9, SID ve KRAB, artırıcı deaktivasyon histon deasetilasyonu hedeflenen loci, üzerinden elde etmek için kullanır. Bu iletişim kuralı Kılavuzu RNA'lar hedef bölgeleri geçici inactivation etkinleştirmek için geçici transfection kullanır ve doku kültürü ayarları uyaranların indüklenebilir transkripsiyon yanıtlarını engelleme özellikle etkilidir. Artırıcı-i genomik hedefleme ve küresel gen ekspresyonu üzerindeki etkileri hem de çok özel. Bu iletişim kuralı elde edilen sonuçlar bir artırıcı gen ekspresyonu, katkı büyüklüğü ve katkı tarafından yakındaki diğer arttırıcılar nasıl etkilenir katkıda olup olmadığını anlamak için yardımcı.

Şekil 1 bir şematik iletişim kuralında tanımlanan iş akışı gösterir. ER-bağlı arttırıcılar östrojen düzenlenir gen ChIP-seq (Şekil 2A) ile tanımlanan 3 bağlayıcı siteleri yakın olan MMP17, yakınındaki katkılarıyla RNA'ların yol belirlemek için her bölge için dizayn edilmiştir. Kılavuzu RNA'lar, sıra her ER çevreleyen bir 600-900 bp pencere tasarlamak için ilgi bağlama sitesi seçilen ve Kılavuzu RNA tasarım programına. Kılavuzu kaynaklanan RNA 0-2 hedeften siteleri BLAT kullanarak insan genomu uyumlu tahmin diziler. Dört üst üste rehberlik ChIP-seq tarafından tanımlanmış bölgesine yayılmış RNA'ların ve DNaseI aşırı duyarlılık (Şekil 2B) hedefleme için seçildi. (Tablo 1) ek sırası aşağı akım klonlama ve sonucu olan 59 nükleotit parçaları sipariş edilen kolaylaştırmak için her iki ucu için eklendi. Elimize RNA'ların seyreltilmiş ve site ve kısa bir PCR tarafından havuza alınmış Kılavuzu Homoloji bölgeler önce Gibson derleme eklemek için gerçekleştirildi. Beklenen Kılavuzu RNA ürün dizisinin 20 basepairs 59 basepair her sonuna kadar ekleyecek olan "U6_internal" primerler (Tablo 1), kullanılarak kısa bir PCR sonra Kılavuzu RNA parça, bir ~ 100 basepair sırada ortaya çıkan Şekil 2C gösterir. Gibson derleme, bu kılavuzu RNA havuzları bakteri dönüştürülmüş ve plazmid minipreps ertesi gün hazırlanmıştır. Şekil 2B sonuçları nerede MMP17 yakın birden çok arttırıcılar yalnız hedeflenir artırıcı diseksiyon deney ve birlikte Geliștirici-i kullanarak gösterir. Enhancer-i tarafından hedef siteleri ile siyah bir altıgen gösterilir. Belirtilen Site Hedefleme Rehberi RNA plazmid stabil SID4X-dCas9-KRAB ifade bir östrojen yoksun Ishikawa hücre kültürünü transfected. İki gün sonra medya değiştirildi ve puromisindir transfected hücreler için zenginleştirmek için eklendi. Ertesi gün, 8 saat 10 nM estradiol tedavi aşağıdaki hücre hasat edildi. RNA izole edildi ve bir tek adımlı qPCR gerçekleştirildi. Site 3 Bu koşullarda (Şekil 2B, şerit II-IV) katkı sağlamamaktadır Örneğin, siteleri 1 ve 2 MMP17, bir tam östrojenik yanıt için gerekli iken. Ne zaman sadece 2 veya 3 sitelerdir etkin (VI ve VII), östrojen yanıttır ne zaman yok sitelerdir için benzer aktif (VIII), bu sitelerde bağımsız olarak katkıda bulunamaz düşündüren. 1 sitesi bazı ifade katkıda bulunabilir tek başına (v), ama en büyük etkinlik siteleri 1 ve 2 etkin olduğunda görülür (IV).
(Şekil 3A), aynı anda 4 farklı genler yakınındaki 10 arttırıcılar işlemek için RNA'ların karmaşık takımlık rehberlik 42 artırıcı kılavuzları ve 16 organizatörü kılavuzları içeren oluşturulan. Kılavuzu RNA oligos Başlangıç Kılavuzu RNA uzantısı PCR (adım 3.3) önce havuza alınmış ve elde edilen PCR ürünleri Saflaştırılmış ve Gibson derleme kullanarak boş puromisindir U6 klonlama vektör ile kombine. Gibson derleme birden çok bağımsız dönüşümleri gerçekleştirilen ve kaplama. Tabakları LB kazınmış ve 2-4 h önce maxiprep için dışarı büyümeye izin. Bu kılavuzu RNA havuzları stabil SID4X-dCas9-KRAB ifade bir östrojen yoksun Ishikawa hücre kültürünü transfected ve (Şekil 2B) açıklandığı gibi tedavi Şekil 3B temsilcisi indirimleri gen ifadesinde qPCR tarafından gösterir. İndirimleri Enhancer-i gelen sözde hedef gen organizatörü hedefleyerek elde edilen benzer. Şekil 3 c seyreltme kılavuzun etkileri RNA'ların Enhancer-i kullanarak östrojen yanıt azalma gösterir. 1:50 G0S2 hala yakınındaki artırıcı Hedefleme Rehberi RNA havuzu seyreltme Enhancer-i ilâ 50 hedeflemek için kullanılabilir düşündüren gen ekspresyonu önemli azalma verimleri hemen siteler. Ancak, devre dışı bırakma, daha duyarlı algılama yöntemleri istihdam edilmektedir sürece sitelerin yüzlerce aynı anda hedeflenemediği gösteren seyreltilmiş.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57883/57883fig1.jpg"> Şekil 1. Protokolü Enhancer-ı. kullanarak çok katmanlı artırıcı diseksiyon için şematik Kılavuzu RNA'ların (kırmızı ve mavi) kullanarak e-net ve seçili UCSC genom tarayıcı kullanarak tasarlanmıştır. Dört kılavuzu RNA'ların bu faiz (ChIP-seq tarafından tanımlanan transkripsiyon faktörü bağlayıcı siteleri) bölgelerinde yayılan seçilir. Faiz (kırmızı ve mavi) bölgeye göre havuza Kılavuzu RNA oligonucleotides Gibson derleme ve dönüşüm önce Homoloji bölgeleri (turuncu) eklemek için bir PCR tabi. Elde edilen plazmid havuzları stabil SID4X-dCas9-KRAB ifade hücre hatları veya vahşi-türü hücre SID4X-dCas9-KRAB plazmid ile birlikte lipofection yolu ile transfected. Kılavuzu RNA plazmid havuzları ayrı ayrı bir zamanda veya aynı anda birden çok site hedeflemek için birlikte tek bir site hedeflemek için transfected. Transfected hücre kılavuzu RNA'ları içeren hücreler için zenginleştirmek için antibiyotik ile tedavi edilir. ~ 72 h sonrası transfection hücre hasat. Nükleik asitler qPCR, RNA-seq veya çip seq. için çıkarılan <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/57883/57883fig1large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57883/57883fig2.jpg"> Şekil 2. Kılavuzu MMP17için RNA tasarım ve artırıcı diseksiyon. (A) genom tarayıcı ekran görüntüsü yakınındaki hedef için ER Alfa bağlı arttırıcılar (gri) MMP17. Bu rakam Carleton, et al. değiştirildi 18. (B) Kılavuzu RNA siteleri18bağlama 3 için tasarımlar. Bağlama için ChIP-seq tarafından tanımlandığı şekilde ER hedef ve 4 Kılavuzu RNA'ların kiremit bu bölgede sitedir. Bağlama Makinası açıklıklı, DNaseI hassasiyet sinyali Kılavuzu RNA tasarım için hedef sırasını tanımlamak için de kullanılabilir. ChIP-seq ve DNaseI HS veri ile 10 nM estradiol Homoloji bölgeleri eklemek için kısa bir PCR geçirmiş Gibson montaj için hazır 1 h. (C) temsilcisi Kılavuzu RNA serileri için tedavi Ishikawa hücrelerden elde edilmiştir. (D) MMP17 göreli ifade, özel bölgelerin Enhancer-i ve bir 8-h10 nM estradiol tedavi ile hedefleme takip qPCR ile ölçülür. MMP17 estradiol ile tedavi değil hücrelerdeki CTCF ve ifade düzeyini ifade görelidir. RNA'lar hedef organizatörü denetim Rehberi IL1RN. Tüm hata çubukları SEM temsil eden, çift yıldız belirtmek p < 0,01 ve tek yıldız belirtmek p < 0,05 eşleştirilmiş bir t-test. Bu rakam Carleton, değiştirilmiş ve ark. 18. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/57883/57883fig2large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57883/57883fig3.jpg"> Şekil 3. Birden çok arttırıcılar ile aynı anda farklı genler yakınındaki hedefleme havuzlu Enhancer-ı. (A) şeması bağlayıcı siteleri ve havuza alınan Enhancer-i içinde var olmak hedef için organizatör. (B) ifade E2 tedavi Ishikawa hücrelerde Enhancer-i plazmid Havuzu (yeşil), organizatörü-i plazmid Havuzu (mavi) veya kontrol gRNAs (beyaz)18transfected sonra qPCR tarafından ölçülen üzerinde etkileri. Tüm genler önemli bir azalma Enhancer-i ile görülmektedir. Bu rakam Carleton, güncellenmiştir ve ark. 18. E2 tedaviden sonra G0S2 ifade düzeyleri üzerine etkisi Ishikawa hücrelerde transfected Kılavuzu G0S2hedefleme RNA'ların farklı miktarda (C) . Hatta küçük miktarlarda Kılavuzu RNA ile önemli bir azalma görülebilir (1:50 seyreltme), ilâ düşündüren 50 siteler hedef aynı anda. Tüm hata çubukları SEM temsil eden, çift yıldız belirtmek p < 0,01 ve tek yıldız belirtmek p < 0,05 eşleştirilmiş bir t-test. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/57883/57883fig3large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>Adı</td>
			<td>Sıra</td>
		</tr>
<tr>
<td>U6_internal_F</td>
			<td>TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCG</td>
		</tr>
<tr>
<td>U6_internal_R</td>
			<td>GACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC</td>
		</tr>
<tr>
<td>U6_PCR_F</td>
			<td>CCAATTCAGTCGACTGGATCCGGTA</td>
		</tr>
<tr>
<td>U6_PCR_R</td>
			<td>AAAAAAAGCACCGACTCGGTGCCA</td>
		</tr>
<tr>
<td>gRNA_qPCR_F</td>
			<td>GCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCG</td>
		</tr>
<tr>
<td>gRNA_qPCR_R</td>
			<td>AAAAAGCACCGACTCGGTGCC</td>
		</tr>
<tr>
<td>dCas9_qPCR_F</td>
			<td>GTGACCGAGGGAATGAGAAA</td>
		</tr>
<tr>
<td>dCas9_qPCR_R</td>
			<td>AGCTGCTTCACGGTCACTTT</td>
		</tr>
<tr>
<td>pAC95_PCR_F</td>
			<td>AGAAGAGAAAGGTGGAGGCC</td>
		</tr>
<tr>
<td>pAC95_PCR_R</td>
			<td>CGTCACCGCATGTTAGAAGG</td>
		</tr>
<tr>
<td>SID4X_PCR_F</td>
			<td>CAATAGAAACTGGGCTTGTCG</td>
		</tr>
<tr>
<td>SID4X_PCR_R</td>
			<td>TCGTGCTTCTTATCCTCTTCC</td>
		</tr>
</tbody></table>Tablo 1. Kılavuz RNA uzantısı ve sıralama, qPCR ve füzyon protein tespiti için kullanılan astar.

Watch this Scientific Journal Video about Dissection of Enhancer Function Using Multiplex CRISPR-based Enhancer Interference in Cell Lines at JoVE.com

Dissection of Enhancer Function Using Multiplex CRISPR-based Enhancer Interference in Cell Lines

Bu iletişim kuralını tasarlayın ve çoğaltılmış arttırıcılar deactivating füzyon protein SID4X-dCas9-KRAB, olarak da bilinen artırıcı girişim (Enhancer-i) ile hedefleme gerçekleştirmek için gereken adımları açıklar. Bu iletişim kuralı gen ekspresyonu düzenleyen arttırıcılar tanımlaması sağlar ve ortak bir hedef geni düzenleyen arttırıcılar arasındaki ilişkileri diseksiyon kolaylaştırır.

Diseksiyon artırıcı işlevi hücre hatlarında Multiplex artırıcı CRISPR tabanlı girişim kullanma

Multiple enhancers often regulate a given gene, yet for most genes, it remains unclear which enhancers are necessary for gene expression, and how these ...

dissection-enhancer-function-using-multiplex-crispr-based-enhancer

Universidad de Cartagena UDEC

Research

JoVE Journal

Genetics

9.2K Görüntüleme.  University of Utah. Bu iletişim kuralını tasarlayın ve çoğaltılmış arttırıcılar deactivating füzyon protein SID4X-dCas9-KRAB, olarak da bilinen artırıcı girişim (Enhancer-i) ile hedefleme gerçekleştirmek için gereken adımları açıklar. Bu iletişim kuralı gen ekspresyonu düzenleyen arttırıcılar tanımlaması sağlar ve ortak bir hedef geni düzenleyen arttırıcılar arasındaki ilişkileri diseksiyon kolaylaştırır.

Video: Dissection of Enhancer Function Using Multiplex CRISPR-based Enhancer Interference in Cell Lines

RNA Interference-based Investigation of the Function of Heat Shock Protein 27 during Corneal Epithelial Wound Healing

Small interfering RNA (siRNA) is among the most widely used RNA interference methods for the short-term silencing of protein-coding genes. siRNA is a synthetic RNA duplex created to specifically target a mRNA transcript to induce its degradation and it has been used to identify novel pathways in various cellular processes. Few reports exist regarding the role of phosphorylated heat shock protein 27 (HSP27) in corneal epithelial wound healing. Herein, cultured human corneal epithelial cells were divided into a scrambled control-siRNA transfected group and a HSP27-specific siRNA-transfected group. Scratch-induced directional wounding assays, and western blotting, and flow cytometry were then performed. We conclude that HSP27 has roles in corneal epithelial wound healing that may involve epithelial cell apoptosis and migration. Here, step-by-step descriptions of sample preparation and the study protocol are provided.

Herein, we present a protocol to use heat shock protein 27 (HSP27)-specific small interfering RNA to assess the function of HSP27 during corneal epithelial wound healing. RNA interference is the best method for effectively knocking-down gene expression to investigate protein function in various cell types.

Kornea Epitel Yara İyileşmesi sırasında Isı Şoku Protein 27 Fonksiyon RNA Girişim tabanlı İncelenmesi

Small interfering RNA (siRNA) is among the most widely used RNA interference methods for the short-term silencing of protein-coding genes. siRNA is a ...

Genetik

Single-cell Gene Expression Using Multiplex RT-qPCR to Characterize Heterogeneity of Rare Lymphoid Populations

Gene expression heterogeneity is an interesting feature to investigate in lymphoid populations. Gene expression in these cells varies during cell activation, stress, or stimulation. Single-cell multiplex gene expression enables the simultaneous assessment of tens of genes1,2,3. At the single-cell level, multiplex gene expression determines population heterogeneity4,5. It allows for the distinction of population heterogeneity by determining both the probable mix of diverse precursor stages among mature cells and also the diversity of cell responses to stimuli.
Innate lymphoid cells (ILC) have been recently described as a population of innate effectors of the immune response6,7. In this protocol, cell heterogeneity of the ILC hepatic compartment is investigated during homeostasis.
Currently, the most widely used technique to assess gene expression is RT-qPCR. This method measures gene expression only one gene at a time. Additionally, this method cannot estimate heterogeneity of gene expression, since multiple cells are needed for one test. This leads to the measurement of the average gene expression of the population. When assessing large numbers of genes, RT-qPCR becomes a time-, reagent-, and sample-consuming method. Hence, the trade-offs limit the number of genes or cell populations that can be evaluated, increasing the risk of missing the global picture.
This manuscript describes how single-cell multiplex RT-qPCR can be used to overcome these limitations. This technique has benefited from recent microfluidics technological advances1,2. Reactions occurring in multiplex RT-qPCR chips do not exceed the nanoliter-level. Hence, single-cell gene expression, as well as simultaneous multiple gene expression, can be performed in a reagent-, sample-, and cost-effective manner. It is possible to test cell gene signature heterogeneity at the clonal level between cell subsets within a population at different developmental stages or under different conditions4,5. Working on rare populations with large numbers of conditions at the single-cell level is no longer a restriction.

This protocol describes how to assess the expression of a large array of genes at the clonal level. Single-cell RT-qPCR produces highly reliable results with a strong sensitivity for hundreds of samples and genes.

Multiplex RT-qPCR kullanarak tek hücreli Gen İfadesi Nadir Lenfoid Populasyonlarının Farklılıkları karakterize etmek

Gene expression heterogeneity is an interesting feature to investigate in lymphoid populations. Gene expression in these cells varies during cell ...

Detection of Copy Number Alterations Using Single Cell Sequencing

Detection of genomic changes at single cell resolution is important for characterizing genetic heterogeneity and evolution in normal tissues, cancers, and microbial populations. Traditional methods for assessing genetic heterogeneity have been limited by low resolution, low sensitivity, and/or low specificity. Single cell sequencing has emerged as a powerful tool for detecting genetic heterogeneity with high resolution, high sensitivity and, when appropriately analyzed, high specificity. Here we provide a protocol for the isolation, whole genome amplification, sequencing, and analysis of single cells. Our approach allows for the reliable identification of megabase-scale copy number variants in single cells. However, aspects of this protocol can also be applied to investigate other types of genetic alterations in single cells.

Single cell sequencing is an increasingly popular and accessible tool for addressing genomic changes at high resolution. We provide a protocol that uses single cell sequencing to identify copy number alterations in single cells.

Tek Hücre sıralama kullanarak Kopya sayısı Değişmeler Algılama

Detection of genomic changes at single cell resolution is important for characterizing genetic heterogeneity and evolution in normal tissues, cancers, and ...

Chromatin Immunoprecipitation (ChIP) in Mouse T-cell Lines

Signaling pathways regulate gene expression programs via the modulation of the chromatin structure at different levels, such as by post-translational modifications (PTMs) of histone tails, the exchange of canonical histones with histone variants, and nucleosome eviction. Such regulation requires the binding of signal-sensitive transcription factors (TFs) that recruit chromatin-modifying enzymes at regulatory elements defined as enhancers. Understanding how signaling cascades regulate enhancer activity requires a comprehensive analysis of the binding of TFs, chromatin modifying enzymes, and the occupancy of specific histone marks and histone variants. Chromatin immunoprecipitation (ChIP) assays utilize highly specific antibodies to immunoprecipitate specific protein/DNA complexes. The subsequent analysis of the purified DNA allows for the identification the region occupied by the protein recognized by the antibody. This work describes a protocol to efficiently perform ChIP of histone proteins in a mature mouse T-cell line. The presented protocol allows for the performance of ChIP assays in a reasonable timeframe and with high reproducibility.

Chromatin Immunoprecipitation ChIP in Mouse T-cell Lines

This work describes a protocol for chromatin immunoprecipitation (ChIP) using a mature mouse T-cell line. This protocol is suitable to investigate the distribution of specific histone marks at specific promoter sites or genome-wide.

Fare T-hücresi Hatlarında Kromatin İmmünopresipitasyonu (ChIP)

Signaling pathways regulate gene expression programs via the modulation of the chromatin structure at different levels, such as by post-translational ...

Genome Editing in Mammalian Cell Lines using CRISPR-Cas

The clustered regularly interspaced short palindromic repeats (CRISPR) system functions naturally in bacterial adaptive immunity, but has been successfully repurposed for genome engineering in many different living organisms. Most commonly, the wildtype CRISPR associated 9 (Cas9) or Cas12a endonuclease is used to cleave specific sites in the genome, after which the DNA double-stranded break is repaired via the non-homologous end joining (NHEJ) pathway or the homology-directed repair (HDR) pathway depending on whether a donor template is absent or present respectively. To date, CRISPR systems from different bacterial species have been shown to be capable of performing genome editing in mammalian cells. However, despite the apparent simplicity of the technology, multiple design parameters need to be considered, which often leave users perplexed about how best to carry out their genome editing experiments. Here, we describe a complete workflow from experimental design to identification of cell clones that carry desired DNA modifications, with the goal of facilitating successful execution of genome editing experiments in mammalian cell lines. We highlight key considerations for users to take note of, including the choice of CRISPR system, the spacer length, and the design of a single-stranded oligodeoxynucleotide (ssODN) donor template. We envision that this workflow will be useful for gene knockout studies, disease modeling efforts, or the generation of reporter cell lines.

CRISPR-Cas is a powerful technology to engineer the complex genomes of plants and animals. Here, we detail a protocol to efficiently edit the human genome using different Cas endonucleases. We highlight important considerations and design parameters to optimize editing efficiency.

Memeli hücre CRISPR-Cas kullanarak satırları genom düzenleme

The clustered regularly interspaced short palindromic repeats (CRISPR) system functions naturally in bacterial adaptive immunity, but has been ...

Manipulation of Gene Function in Mexican Cavefish

Cave animals provide a compelling system for investigating the evolutionary mechanisms and genetic bases underlying changes in numerous complex traits, including eye degeneration, albinism, sleep loss, hyperphagia, and sensory processing. Species of cavefish from around the world display a convergent evolution of morphological and behavioral traits due to shared environmental pressures between different cave systems. Diverse cave species have been studied in the laboratory setting. The Mexican tetra, Astyanax mexicanus, with sighted and blind forms, has provided unique insights into biological and molecular processes underlying the evolution of complex traits and is well-poised as an emerging model system. While candidate genes regulating the evolution of diverse biological processes have been identified in A. mexicanus, the ability to validate a role for individual genes has been limited. The application of transgenesis and gene-editing technology has the potential to overcome this significant impediment and to investigate the mechanisms underlying the evolution of complex traits. Here, we describe a different methodology for manipulating gene expression in A. mexicanus. Approaches include the use of morpholinos, Tol2 transgenesis, and gene-editing systems, commonly used in zebrafish and other fish models, to manipulate gene function in A. mexicanus. These protocols include detailed descriptions of timed breeding procedures, the collection of fertilized eggs, injections, and the selection of genetically modified animals. These methodological approaches will allow for the investigation of the genetic and neural mechanisms underlying the evolution of diverse traits in A. mexicanus.&#160;

We describe approaches for the manipulation of genes in the evolutionary model system Astyanax mexicanus. Three different techniques are described: Tol2-mediated transgenesis, targeted manipulation of the genome using CRISPR/Cas9, and knockdown of expression using morpholinos. These tools should facilitate the direct investigation of genes underlying the variation between surface- and cave-dwelling forms.

Meksika Cavefish işlevinde Gene manipülasyon

Cave animals provide a compelling system for investigating the evolutionary mechanisms and genetic bases underlying changes in numerous complex traits, ...

Mass Spectrometry-Based Proteomics Analyses Using the OpenProt Database to Unveil Novel Proteins Translated from Non-Canonical Open Reading Frames

Genome annotation is central to today's proteomic research as it draws the outlines of the proteomic landscape. Traditional models of open reading frame (ORF) annotation impose two arbitrary criteria: a minimum length of 100 codons and a single ORF per transcript. However, a growing number of studies report expression of proteins from allegedly non-coding regions, challenging the accuracy of current genome annotations. These novel proteins were found encoded either within non-coding RNAs, 5' or 3' untranslated regions (UTRs) of mRNAs, or overlapping a known coding sequence (CDS) in an alternative ORF. OpenProt is the first database that enforces a polycistronic model for eukaryotic genomes, allowing annotation of multiple ORFs per transcript. OpenProt is freely accessible and offers custom downloads of protein sequences across 10 species. Using OpenProt database for proteomic experiments enables novel proteins discovery and highlights the polycistronic nature of eukaryotic genes. The size of OpenProt database (all predicted proteins) is substantial and need be taken in account for the analysis. However, with appropriate false discovery rate (FDR) settings or the use of a restricted OpenProt database, users will gain a more realistic view of the proteomic landscape. Overall, OpenProt is a freely available tool that will foster proteomic discoveries.

OpenProt is a freely accessible database that enforces a polycistronic model of eukaryotic genomes. Here, we present a protocol for the use of OpenProt databases when interrogating mass spectrometry datasets. Using OpenProt database for analysis of proteomic experiments allows for discovery of novel and previously undetectable proteins.

Kütle spektrometresi tabanlı proteomik analizleri roman proteinler açıklayacak OpenProt veritabanı kullanarak kanonik olmayan açık okuma çerçevesi tercüme

Genome annotation is central to today's proteomic research as it draws the outlines of the proteomic landscape. Traditional models of open reading frame ...

Designing Automated, High-throughput, Continuous Cell Growth Experiments Using eVOLVER

Continuous culture methods enable cells to be grown under quantitatively controlled environmental conditions, and are thus broadly useful for measuring fitness phenotypes and improving our understanding of how genotypes are shaped by selection. Extensive recent efforts to develop and apply niche continuous culture devices have revealed the benefits of conducting new forms of cell culture control. This includes defining custom selection pressures and increasing throughput for studies ranging from long-term experimental evolution to genome-wide library selections and synthetic gene circuit characterization. The eVOLVER platform was recently developed to meet this growing demand: a continuous culture platform with a high degree of scalability, flexibility, and automation. eVOLVER provides a single standardizing platform that can be (re)-configured and scaled with minimal effort to perform many different types of high-throughput or multi-dimensional growth selection experiments. Here, a protocol is presented to provide users of the eVOLVER framework a description for configuring the system to conduct a custom, large-scale continuous growth experiment. Specifically, the protocol guides users on how to program the system to multiplex two selection pressures &#8212; temperature and osmolarity &#8212; across many eVOLVER vials in order to quantify fitness landscapes of Saccharomyces cerevisiae mutants at fine resolution. We show how the device can be configured both programmatically, through its open-source web-based software, and physically, by arranging fluidic and hardware layouts. The process of physically setting up the device, programming the culture routine, monitoring and interacting with the experiment in real-time over the internet, sampling vials for subsequent offline analysis, and post experiment data analysis are detailed. This should serve as a starting point for researchers across diverse disciplines to apply eVOLVER in the design of their own complex and high-throughput cell growth experiments to study and manipulate biological systems.

The eVOLVER framework enables high-throughput continuous microbial culture with high resolution and dynamic control over experimental parameters. This protocol demonstrates how to apply the system to conduct a complex fitness experiment, guiding users on programming automated control over many individual cultures, measuring, collecting, and interacting with experimental data in real-time.

EVOLVER kullanarak otomatik, yüksek verimlilik, sürekli hücre büyüme denemeleri tasarlama

Continuous culture methods enable cells to be grown under quantitatively controlled environmental conditions, and are thus broadly useful for measuring ...

Pooled CRISPR-Based Genetic Screens in Mammalian Cells

Genome editing using the CRISPR-Cas system has vastly advanced the ability to precisely edit the genomes of various organisms. In the context of mammalian cells, this technology represents a novel means to perform genome-wide genetic screens for functional genomics studies. Libraries of guide RNAs (sgRNA) targeting all open reading frames permit the facile generation of thousands of genetic perturbations in a single pool of cells that can be screened for specific phenotypes to implicate gene function and cellular processes in an unbiased and systematic way. CRISPR-Cas screens provide researchers with a simple, efficient, and inexpensive method to uncover the genetic blueprints for cellular phenotypes. Furthermore, differential analysis of screens performed in various cell lines and from different cancer types can identify genes that are contextually essential in tumor cells, revealing potential targets for specific anticancer therapies. Performing genome-wide screens in human cells can be daunting, as this involves the handling of tens of millions of cells and requires analysis of large sets of data. The details of these screens, such as cell line characterization, CRISPR library considerations, and understanding the limitations and capabilities of CRISPR technology during analysis, are often overlooked. Provided here is a detailed protocol for the successful performance of pooled genome-wide CRISPR-Cas9 based screens.

CRISPR-Cas9 technology provides an efficient method to precisely edit the mammalian genome in any cell type and represents a novel means to perform genome-wide genetic screens. A detailed protocol discussing the steps required for the successful performance of pooled genome-wide CRISPR-Cas9 screens is provided here.

Memeli Hücrelerinde Havuzlu CRISPR Tabanlı Genetik Ekranlar

Genome editing using the CRISPR-Cas system has vastly advanced the ability to precisely edit the genomes of various organisms. In the context of mammalian ...

Identification of Enhancer-Promoter Contacts in Embryoid Bodies by Quantitative Chromosome Conformation Capture (4C)

During mammalian development, cell fates are determined through the establishment of regulatory networks that define the specificity, timing, and spatial patterns of gene expression. Embryoid bodies (EBs) derived from pluripotent stem cells have been a popular model to study the differentiation of the main three germ layers and to define regulatory circuits during cell fate specification. Although it is well-known that tissue-specific enhancers play an important role in these networks by interacting with promoters, assigning them to their relevant target genes still remains challenging. To make this possible, quantitative approaches are needed to study enhancer-promoter contacts and their dynamics during development. Here, we adapted a 4C method to define enhancers and their contacts with cognate promoters in the EB differentiation model. The method uses frequently cutting restriction enzymes, sonication, and a nested-ligation-mediated PCR protocol compatible with commercial DNA library preparation kits. Subsequently, the 4C libraries are subjected to high-throughput sequencing and analyzed bioinformatically, allowing detection and quantification of all sequences that have contacts with a chosen promoter. The resulting sequencing data can also be used to gain information about the dynamics of enhancer-promoter contacts during differentiation. The technique described for the EB differentiation model is easy to implement.

Identification of Enhancer-Promoter Contacts in Embryoid Bodies by Quantitative Chromosome Conformation Capture 4C

We report the application of quantitative chromosome conformation capture followed by high-throughput sequencing in embryoid bodies generated from embryonic stem cells. This technique allows to identify and quantitate the contacts between putative enhancers and promoter regions of a given gene during embryonic stem cell differentiation.

Kantitatif Kromozom Konformasyon Yakalama (4C) ile Embriyoid Cisimlerde Arttırıcı-Organizatör Kontalarının Belirlenmesi

During mammalian development, cell fates are determined through the establishment of regulatory networks that define the specificity, timing, and spatial ...