We thank Kelli Czarra and Megan Karwan for animal technical assistance, Kathleen Noer and Roberta Matthai for flow cytometry assistance, and Donna Butcher andMiriam R. Anver for pathology analysis. This project was supported by a grant from the Ely and Edythe Broad Foundation (to Scott Durum) and has been funded in whole or in part with federal funds from the National Cancer Institute, National Institutes of Health, under Contract No. HHSN261200800001E (MRA).

모든 동물 관리 및 암 연구 프레드릭 국립 연구소의 실험 동물위원회의 사용을위한 2011 가이드에 설명 된 실험 절차에 따라 적절한 치료를 받았다. BAC Recombineering에 의한 IL-22 tdTomato 기자 마우스의 1 세대 참고 : 마우스 의식해야하며, 유해 자극에 대한 응답으로 이동하지 않습니다. 70 % 에탄올로 소독 외과 영역 및 유리 비드 멸균기를 사용하여 모든 수술 도구 살균. <ol><li> 알칼리 추출법 10, 11을 사용하여 BAC DNA (RP23-401E11 클론 228391 bps의 길이)를 정제. 표적 유전자의 정확한 크기를 확인 RP23-401E11 5 μg의의를 SpeI 소화하여 BAC 클론의 특징. 참고 : BAC DNA는 14 조각으로 절단 하였다. </li><li> PLD53SC-A-GFP-B 셔틀 벡터의 없음 I / 샐 I 사이트에 TdTomato 리포터 유전자를 삽입(11)와 같은 사이트에서 GFP 유전자를 대체합니다. 이어서, 주형으로 BAC의 RP23-401E11를 사용하여 첫 번역 엑손에 상동 상자 (A 및 B)를 증폭하여, IL-22 (엑손 1) PCR (95 ℃, 2 분에 의해, 30 ~ 95 ° C의 30주기 초, 30 초, 55 ° C, 30 초 동안 72 ° C, 10 분간 72 ℃에서 최종 연장). 50 ㎕의 PCR 반응 시스템에서 추가 50 NG (1 μL) BAC DNA 프라이머 0.5 μL (10 μM), PCR 수퍼 믹스 고음질 40 μL 및 H 2 O 8 μL의 5&#39;-T GGCGCGCC GGAGCTGTGAAGAAAG 및 역 : 앞으로 상자를 참고 : 다음과 같이 A와 B 박스 프라이머는 5&#39; CAGAGATCGCACAAGTGTCAAC을; 앞으로 B 상자 : 5&#39;-G TTAATTAA CTGCCCGTCAACA 및 역 : 5&#39;-T GGCCGGCC TGAGCACCTGCTT CATC 10. 제한 효소 (오름차순 I와 팩맨 I)의 사이트는 밑줄로 표시됩니다. </li><li> 오름차순 I-소화 (A)의 500 NG와 팩맨 I-소화 B의 fragm 500 NG를 결찰엔트 1 시간 동안 16 ° C에서 PLD53SC - ATB (tdTomato) 벡터의 50 NG로. </li><li> 37 ° C에서 클로람페니콜 (20 μg의 / ㎖) 및 암피실린 (30 μg의 / ㎖)와 접시 한천 루리아 - 베르 타니 (LB)에 BAC-능력 전지 (11)와 문화 그들로 정제 PLD53SC - ATB 벡터 변환. 2 ~ 3 식민지 선택은 ch / 앰프 마스터 판에서 공동-통합 할 수 있습니다. </li><li> 20 μg의 / ㎖ 클로람페니콜 보충 LB 1 ㎖에 각 콜로니를 접종하고 37 ℃에서 1 시간, 225 rpm으로 그들을 품어. LB 아가 플레이트상에서 각각의 혼합물 100 μl를 확산 (펩톤 (140) 10g, 효모 추출물 한천 12 g을 물 1 L의 5g하여 pH 7.5) 클로람페니콜 자당 4-4.5 %로 보충. 37 ℃에서 밤새 문화를 품어. </li><li> 모두 크고 작은 식민지를 선택하고 클로람페니콜 두 LB 한천 플레이트에 그들을 replate. 그런 다음, 또는 30 초 동안 자외선없이 하나 번호판을 노출하고 추가 분석을 위해 자외선에 민감한 식민지를 선택. </li><li> tdTomato / IL-22 이형 프라이머 사용하여 PCR에 의해 수정 된 BAC의 DNA 식별 (정 : 5 &#39;ACT TGT GCG ATC TCT GAT GGT을, 역 : 5&#39;TGT AAT CGG GGA TGT CGG C를). 다음과 같은 열 순환기 조건은 2 분 동안 95 ° C; 30 초, 30 초 동안 56 ° C, 30 초 동안 72 ° C 95 ° C의 30주기; 10 분 동안 72 ℃에서 최종 연장. </li><li> 큰 준비 BAC DNA (12)의 직접 BAC 서열에 의해 BAC의 수정 된 영역의 순서를 확인합니다. </li><li> 의사 임신 한 C57BL / 6C 마우스에 미세 주입 접합자을 주입 할 때 복강에 0.25 %의 tribromoethanol의 용량을 가진받는 사람 마우스를 마취. </li><li> 일리노이-22-tdTomato BAC 반응 시스템 100 ㎕에 제한 endonucleasePi-SceI 제한 효소의 5 μL와 소화에 의해 (10 μg의) 구성 및 전핵 단계 (13)에서 C57BL / 6 여성의 수정란에 선형화 된 BAC DNA를 microinject 선형화. Scre표준 절차를 사용하여 꼬리 생검에서 분리 된 DNA의 서던 블롯 분석에 의해 형질 전환 마우스 갖추고 있습니다. </li></ol> 비장, 흉선, 림프절 및 파이어 판 2. 단일 셀 준비 참고 : IL-22 tdTomato 기자 마우스는 국립 암 연구소 (NCI, 프레데릭, MD)에서 유지되었다. 안락사 방법은 안락사에 대한 가장 최근의 AVMA 지침을 준수합니다. 모든 마우스는 CO 2 흡입 (14)를 이용하여 안락사시켰다. <ol><li> 공동 2 챔버에서 IL-22 tdTomato 마우스를 안락사 깨끗한 패드에 넣어. 70 % 알코올을 분무하여 복부 피부를 소독 및 오픈 잘라. 왼쪽 측면에서 비장과 흉골 뒤에 흉선을 제거합니다. </li><li> mesentericlymph 노드 (장간막 조직에 위치) 및 (소장의 회장 영역에 걸쳐 작은 lymphoidnodules) 파이어 패치를 수확, 진주 흰색 장간막은 마에 가까운 노드들이 가지고몸에서 전체 소장과 대장을 제거 먼저 미세 포인트 톱니 모양의 팁 집게를 해부하여 소장의 그는 벽. 장내 따라 확장 된 타원형 패치 (파이어 패치)를 찾아 가위로 잘라. PBS / 1 % 소 태아 혈청 (FBS) 빙냉 완충액 단일 세포 현탁액에 개별적으로 두 젖 슬라이드 사이 이러한 림프 조직 (림프절 및 파이어 패치) 연마. </li><li> 단계 2.2에서와 동일한 방법을 사용하여 비장 또는 흉선 조직을 말하다. 500 XG에 8 분, 4 ° C를위한 비장 현탁액을 원심 분리기. 세포 펠렛에 비장 당 ACK 용균 버퍼의 1 ML을 추가합니다. </li><li> 잘 혼합하고 1 분간 방치 할 수 있습니다. 각 샘플에 멸균 인산 완충 생리 식염수 (PBS) 버퍼 9 ML을 추가합니다. 적혈구를 제거하기 위해 500 × g으로 4 ℃에서 8 분 동안 원심 분리에 의해 스핀 다운. 참고 : 흉선 세포에 ACK 용균 버퍼를 추가하지 마십시오. </li><li> PBS 및 P 5ml에 생성 된 백혈구를 재현 탁100㎛의 세포 여과기를 통하여 세포 엉덩이. 8 분 동안 500 XG에서 원심 분리하여 세포 알약을 수집합니다. </li><li> RPMI 매체 또는 FACS 완충액 5 ml의 세포를 재현 탁 및 0.4 % 트리 판 블루 염색 / PBS 용액을 이용하여 생존 세포 수를 계산. </li></ol> 장내에서 상피내 림프구와 얇은 판의 propria 세포의 3. 분리 <ol><li> 바로 항문 위 (가까운 부록에) 회장, 전체 대장에 십이지장에서 (옆에 위장), 단계 2.1에서와 같이 복부 피부를 열고 소장을 잘라. 여분의 지방과 장간막 조직하여 집게를 제거합니다. 얼음처럼 차가운 PBS 즉시 창자를 넣습니다. </li><li> 소장의 말단 지역을 따라 파이어 패치 (소, 거친 결절)을 찾습니다. 집게 andopen 가위를 사용하여 세로 장을 사용하여 질량을 제거합니다. 철저하게 얼음처럼 차가운 PBS 10 mL로 장을 세척하십시오. </li><li> 예비 분해 완충액 (5 mM의 EDTA 20ml에 조직을 인큐베이션및 통 천천히 회전 (50 RPM)와 37 ° C에서 30 분 동안 행크의 균형 소금 솔루션 (HBSS))에 1 mM의 디티 오 트레이 톨. 이 배양 후 각 강렬한 텍싱 (12,000 rpm에서 30 초)함으로써, 상피내 림프구 (IELs)를 포함하는, 상피 세포 층을 제거하고, 100㎛의 셀 스트레이너를 통해 모든 조직을 통과한다. </li><li> 37 ° C에서 30 분 동안 인큐베이션 초 조직 새로운 EDTA 용액 20 ㎖를 추가한다. 100 μm의 셀 스트레이너를 통해 IEL의 분수를 전달하고 이전 분수로 수영장. 얼음에 남아있는 소장의 조각을 유지 단계 3.9에서 처리한다. </li><li> 4 ℃에서 5 분 동안 800 XG에서 풀링 된 IEL의 분수를 원심 분리기. HBSS / 5 % FBS 10 mL로 풀링 IEL의 분수를 세척하고 800 XG에 5 분, 4 ° C를 위해 그들을 스핀 다운. </li><li> 44 % 콜로 이달 실리카 매질 (15)의 8 mL 중에 세포를 재현 탁하고 5 ㎖의 67 % 콜로 이달 실리카 매체로 오버레이. 44 % / 67 원심 분리기실온에서 20 분간 1,500 × g으로 0.5 %에 대한 세포 혼합액 구배. </li><li> 계면에서의 주파수 대역에서 IEL 세포를 수집한다. 첫째, 1 ML의 피펫을 사용하여 상층 액 (5 ㎖)의 상단 층을 제거. 그 후, 콜로이드 실리카 매질 구배의 계면에서 수확 IELs. </li><li> RPMI 배지 10 ㎖를 추가하여 IELs을 씻으십시오. 800 XG에 5 분, 4 ° C를위한 세포를 스핀 다운. 단계 3.15에 대한 RPMI 5 ㎖에 IELs을 재현 탁. </li><li> 고유 층 림프구 분리 (LPLS)의 경우, (1 ㎜) 가위를 사용하여 작은 조각으로 단계 3.4로부터의 창자 조직 절편 말하다 및 (콜라게나 0.05 g, DNaseI 0.05 g을 분해 완충액 10 mL로 조각 다이제스트 37 ° C에서 15 ~ 20 분 동안 RPMI / 5 % FBS에서 디스 파제 II) 0.3 g. </li><li> 70 μm의 셀 스트레이너를 통해 혼합물을 필터링합니다. 플로우를 통해 상층 액을 방출 LPL이 포함되어 있습니다. </li><li> 완전 정상 (단계 3.9-3.10를 반복하여 장 단편을 소화, 그들은해야합니다) 3 회 반복. 마다 LPLS을 함유하는 상등액을 풀링. </li><li> 1,500 × g으로하고, 실온에서 5 분 동안 원심 분리하여 세포를 수집하고 RPMI / 5 % FBS에 재현 탁 펠릿. 40 μm의 셀 스트레이너를 통해 전달합니다. </li><li> 40:80 콜로이드 실리카 매질 구배의 40 % 분율의 10 ml의 세포 펠렛을 재현 탁하고, 15 ㎖의 튜브에 80 % 분획 5 ㎖에 입혀. </li><li> 1,500 × g으로하고, 실온 15 20 분 동안 원심 분리하여 밀도 구배 분리를 수행한다. </li><li> 단계 3.7에 설명 된대로 LPLS를 수집합니다. PBS의 10 ㎖로 한 번에 씻어 PBS / 1 % FBS가 버퍼 또는 RPMI 배지 1 ㎖에 펠렛을 재현 탁. </li><li> 0.4 % 트립 판 블루 염색 / PBS 용액을 이용하여 생존 세포 (IELs 및 LPLS 모두) 개수. </li></ol> 대장염에서 IL-22 tdTomato 4. 식 <ol><li> 1 × 10의 농도에서 IL-22 TdTomato 마우스에서 하나의 비장 세포 현탁액을 준비 &lt;SUP&gt; 7 세포 단계 2.1-2.4에 기재된 멸균 PBS에 / ㎖. </li><li> 마우스 CD4 세포 제외 분리 방법 (10)을 사용하여 CD4 + T 세포를 정제 하였다. , 및 안티 CD45RB-FITC (클론 16A (PBS / 1 % FBS 버퍼에, 복제 RM4-5 0.5 μL / 1 × 10 6 세포)를 방지 CD4-APC와 PBS 0.5 μL / 1 × 10 6 세포를 라벨 30 분 동안 4 ° C에서 배양하여 / 1 % FBS 버퍼). </li><li> 500 XG에 5 분, 4 ° C를위한 세포를 스핀 다운. PBS / 1 % FBS 버퍼의 2 ml의 세포를 세척하고 PBS / 1 % FBS 염색 버퍼 1 ㎖에서 그들을 재현 탁. </li><li> 기계 (16) 세포 계측법 흐름에 표시된 T 세포를 실행합니다. 게이트는 A-T 세포 집단에서 세포 및 CD4 + 정렬 CD45RB 높은 이중 양성 세포 (488 nm 내지 633 nm의 레이저 파장에서 검출). </li><li> 500 XG에 5 분, 4 ° C에 대한 원심 분리에 의해 정렬 된 세포를 수확. 1 × 10 6에 멸균 PBS 완충액으로 세포를 재현 탁 펠렛 </SUP&gt; 세포 / ㎖. - / - 마우스받는 Rag1 ofeach 복막 내로 세포 (0.5 × 106)를 주입한다. </li><li> 다양한 시점에서 CO 2 하에서받는 마우스를 희생한다. 단계 2.1 및 2.2에 기술 된 바와 같이, 장간막 림프절 및 소장과 대장 수확. 조직를 해결하기 위해 밤새 각 장간막 림프절을 넣고 잘라 오픈 소장 (종이 / 장 / 종이 샌드위치)를 4 % 파라 포름 알데히드에 (흄 후드 처리 PFA). 16 ~ 24 시간 동안 18 % 자당과 함께 PFA를 교체 한 후 절편의 조직을 동결. </li><li> 조직 17, 18, 19 잘라 저온 유지 장치 기계를 사용합니다. 약 60 분 동안 실온으로 조직 절편을 가온하고 실온에서 10 분 동안 아세톤에 배치. 약 5 분 동안 실온에서 건조한다. </li><li> , 초과 FBS를 추가 피펫으로 제거하고, 1 항 RFP를 추가 : 200 희석 0.1의 %의 BSA / 1X PBS. 60 분 동안 37 ℃에서 인큐베이션 항체. </li><li> 10 분 동안 1X PBS의 부분을 씻어 조직에 대응하는 차 항체 (염소 항 - 토끼 (568))을 적용, 1 희석 : 300 1 %의 BSA / 1X PBS, 실온에서 30 분 동안. </li><li> 10 분 동안 1X PBS에서 슬라이드를 씻어 그들을 건조 닦아 및 커버 슬립을 추가합니다. </li><li> 40X 목표를 사용하여 (여기 필터 540-580 nm의 RFP) 일관된 조명 아래 형광 현미경으로 모든 샘플을 시각화합니다. </li></ol>

<ol>
	<li>Awasthi, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cutting+edge:+IL-23+receptor+gfp+reporter+mice+reveal+distinct+populations+of+IL-17-producing+cells.">Cutting edge: IL-23 receptor gfp reporter mice reveal distinct populations of IL-17-producing cells.</a> J Immunol. 182, 5904-5908 (2009).</li><li>Price, A. E., Reinhardt, R. L., Liang, H. E., Locksley, R. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Marking+and+quantifying+IL-17A-producing+cells+in+vivo.">Marking and quantifying IL-17A-producing cells in vivo.</a> PLoS One. 7, e39750 (2012).</li><li>Kamanaka, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+interleukin-10+in+intestinal+lymphocytes+detected+by+an+interleukin-10+reporter+knockin+tiger+mouse.">Expression of interleukin-10 in intestinal lymphocytes detected by an interleukin-10 reporter knockin tiger mouse.</a> Immunity. 25, 941-952 (2006).</li><li>Sonnenberg, G. F., Fouser, L. A., Artis, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Border+patrol:+regulation+of+immunity,+inflammation+and+tissue+homeostasis+at+barrier+surfaces+by+IL-22.">Border patrol: regulation of immunity, inflammation and tissue homeostasis at barrier surfaces by IL-22.</a> Nat Immunol. 12, 383-390 (2011).</li><li>Dumoutier, L., Louahed, J., Renauld, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cloning+and+characterization+of+IL-10-related+T+cell-derived+inducible+factor+(IL-TIF),+a+novel+cytokine+structurally+related+to+IL-10+and+inducible+by+IL-9.">Cloning and characterization of IL-10-related T cell-derived inducible factor (IL-TIF), a novel cytokine structurally related to IL-10 and inducible by IL-9.</a> J Immunol. 164, 1814-1819 (2000).</li><li>Cella, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+human+natural+killer+cell+subset+provides+an+innate+source+of+IL-22+for+mucosal+immunity.">A human natural killer cell subset provides an innate source of IL-22 for mucosal immunity.</a> Nature. 457, 722-725 (2009).</li><li>Sanos, S. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RORgammat+and+commensal+microflora+are+required+for+the+differentiation+of+mucosal+interleukin+22-producing+NKp46++cells.">RORgammat and commensal microflora are required for the differentiation of mucosal interleukin 22-producing NKp46+ cells.</a> Nat Immunol. 10, 83-91 (2009).</li><li>Spits, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Innate+lymphoid+cells--a+proposal+for+uniform+nomenclature.">Innate lymphoid cells--a proposal for uniform nomenclature.</a> Nat Rev Immunol. 13, 145-149 (2013).</li><li>Mazzucchelli, R. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualization+and+identification+of+IL-7+producing+cells+in+reporter+mice.">Visualization and identification of IL-7 producing cells in reporter mice.</a> PLoS One. 4, e7637 (2009).</li><li>Shen, W., Hixon, J. A., McLean, M. H., Li, W. Q., Durum, S. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IL-22-Expressing+Murine+Lymphocytes+Display+Plasticity+and+Pathogenicity+in+Reporter+Mice.">IL-22-Expressing Murine Lymphocytes Display Plasticity and Pathogenicity in Reporter Mice.</a> Front Immunol. 6, 662 (2015).</li><li>Gong, S., Yang, X. W., Li, C., Heintz, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+modification+of+bacterial+artificial+chromosomes+(BACs)+using+novel+shuttle+vectors+containing+the+R6Kgamma+origin+of+replication.">Highly efficient modification of bacterial artificial chromosomes (BACs) using novel shuttle vectors containing the R6Kgamma origin of replication.</a> Genome Res. 12, 1992-1998 (2002).</li><li>Shen, W., Huang, Y., Tang, Y., Liu, D. P., Liang, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+general+method+to+modify+BACs+to+generate+large+recombinant+DNA+fragments.">A general method to modify BACs to generate large recombinant DNA fragments.</a> Mol Biotechnol. 31, 181-186 (2005).</li><li>Cho, A., Haruyama, N., Kulkarni, A. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+transgenic+mice.">Generation of transgenic mice.</a> Curr Protoc Cell Biol. Chapter. Chapter 19, Unit 19 11 (2009).</li><li>Danneman, P. J., Stein, S., Walshaw, S. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Humane+and+practical+implications+of+using+carbon+dioxide+mixed+with+oxygen+for+anesthesia+or+euthanasia+of+rats.">Humane and practical implications of using carbon dioxide mixed with oxygen for anesthesia or euthanasia of rats.</a> Lab Anim Sci. 47, 376-385 (1997).</li><li>Omata, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+coccidian+enteroepithelial+stages+of+Toxoplasma+gondii+from+the+intestinal+mucosa+of+cats+by+Percoll+density-gradient+centrifugation.">Isolation of coccidian enteroepithelial stages of Toxoplasma gondii from the intestinal mucosa of cats by Percoll density-gradient centrifugation.</a> Parasitol Res. 83, 574-577 (1997).</li><li>Kumar, N., Borth, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Flow-cytometry+and+cell+sorting:+an+efficient+approach+to+investigate+productivity+and+cell+physiology+in+mammalian+cell+factories.">Flow-cytometry and cell sorting: an efficient approach to investigate productivity and cell physiology in mammalian cell factories.</a> Methods. 56, 366-374 (2012).</li><li>Fischer, A. H., Jacobson, K. A., Rose, J., Zeller, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryosectioning+tissues.">Cryosectioning tissues.</a> CSH Protoc. 2008, pdb.prot4991 (2008).</li><li>Hilbe, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+automated+cellular+imaging+system+and+manual+microscopy+for+immunohistochemically+stained+cryostat+sections+of+lung+cancer+specimens+applying+p53,+ki-67+and+p120.">Comparison of automated cellular imaging system and manual microscopy for immunohistochemically stained cryostat sections of lung cancer specimens applying p53, ki-67 and p120.</a> Oncol Rep. 10, 15-20 (2003).</li><li>Suzuki, Y., Furukawa, M., Abe, J., Kashiwagi, M., Hirose, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Localization+of+porcine+trappin-2+(SKALP/elafin)+in+trachea+and+large+intestine+by+in+situ+hybridization+and+immunohistochemistry.">Localization of porcine trappin-2 (SKALP/elafin) in trachea and large intestine by in situ hybridization and immunohistochemistry.</a> Histochem Cell Biol. 114, 15-20 (2000).</li><li>Wolk, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IL-22+increases+the+innate+immunity+of+tissues.">IL-22 increases the innate immunity of tissues.</a> Immunity. 21, 241-254 (2004).</li><li>Brand, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IL-22+is+increased+in+active+Crohn's+disease+and+promotes+proinflammatory+gene+expression+and+intestinal+epithelial+cell+migration.">IL-22 is increased in active Crohn's disease and promotes proinflammatory gene expression and intestinal epithelial cell migration.</a> Am J Physiol Gastrointest Liver Physiol. 290, G827-G838 (2006).</li><li>Nagalakshmi, M. L., Rascle, A., Zurawski, S., Menon, S., Waal Malefyt, d. e., R, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interleukin-22+activates+STAT3+and+induces+IL-10+by+colon+epithelial+cells.">Interleukin-22 activates STAT3 and induces IL-10 by colon epithelial cells.</a> Int Immunopharmacol. 4, 679-691 (2004).</li><li>Maloy, K. J., Powrie, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intestinal+homeostasis+and+its+breakdown+in+inflammatory+bowel+disease.">Intestinal homeostasis and its breakdown in inflammatory bowel disease.</a> Nature. 474, 298-306 (2011).</li><li>Andoh, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interleukin-22,+a+member+of+the+IL-10+subfamily,+induces+inflammatory+responses+in+colonic+subepithelial+myofibroblasts.">Interleukin-22, a member of the IL-10 subfamily, induces inflammatory responses in colonic subepithelial myofibroblasts.</a> Gastroenterology. 129, 969-984 (2005).</li><li>Bhan, A. K., Mizoguchi, E., Smith, R. N., Mizoguchi, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colitis+in+transgenic+and+knockout+animals+as+models+of+human+inflammatory+bowel+disease.">Colitis in transgenic and knockout animals as models of human inflammatory bowel disease.</a> Immunol Rev. 169, 195-207 (1999).</li><li>Mombaerts, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneous+development+of+inflammatory+bowel+disease+in+T+cell+receptor+mutant+mice.">Spontaneous development of inflammatory bowel disease in T cell receptor mutant mice.</a> Cell. 75, 274-282 (1993).</li><li>Powrie, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immune+regulation+in+the+intestine:+a+balancing+act+between+effector+and+regulatory+T+cell+responses.">Immune regulation in the intestine: a balancing act between effector and regulatory T cell responses.</a> Ann N Y Acad Sci. 1029, 132-141 (2004).</li><li>Ahlfors, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IL-22+fate+reporter+reveals+origin+and+control+of+IL-22+production+in+homeostasis+and+infection.">IL-22 fate reporter reveals origin and control of IL-22 production in homeostasis and infection.</a> J Immunol. 193, 4602-4613 (2014).</li></ol>

The authors have nothing to disclose.

IL-22는 타고난 호스트 방어 및 조직 리모델링에 필수적인 역할을한다. IL-22 생산 세포는 세포 내 염색 생체 확인되었다. 그러나, 여전히 정상 상태 또는 염증성 질환의 하나, 반응계에서 IL-22의 발현을 추적하는 것이 곤란 남아있다. 이 프로토콜은 생체 내에서 리포터 발현 세포 지역화 우리 가능하게하는 IL-22 리포터 마우스 모델을 개발하기위한 새로운 방법을 설명한다. 리포?...

리포터 유전자의 세포 유형 특정 표현은 적극적으로 항상성과 교란 된 상태에서 조직의 목표를 발현하는 세포를 식별하는 데 유용합니다. 그것은 또한 다른 특성을 연구하기 위해, 생존을 유지 이러한 세포의 정제 할 수 있습니다. 리포터 생쥐 특정 사이토 카인, 전사 인자와 조절 요소에 대한 작용 기전을 밝히는데 이용 하였다. 이전 전략 1, 2, 3은 주로 마우스 염색체 시간 소모적이고 비용이 많이 드는 절차 표적 유전자좌에 리포터 노킹에 의존해왔다. 그러므로, 리포터 생쥐의 발생을위한 간단한 방법이 바람직하다. 사이토 카인은 세포 간 신호 전달을 통해 면역 반응을 조절하는 작은 분비 단백질 / 펩티드의 다양한 클래스입니다. 인터루킨 22 (IL-22)는 많은과 사이토 카인 장벽 쿵푸 등의 활동을보고있다nction, 조직 복구 및 염증 4. IL-22은 T 초기 셀 제품 5로 발견되었지만, 후속 리포트 인간 6 마우스 (7)과 선천성 림프구 (8)의 다른 클래스에서 자연 살해 (NK) 세포에서의 발현을 입증 하였다. 항체와 얼룩에 IL-22 이전에 필요한 생체 자극과 permeabilization의 광범위한 IL-22 생산 세포의 관찰, 시각화에도 불구하고. 따라서, 신규 한 IL-22 리포터 생쥐 항상성 병원성 과정에서 IL-22의 기능을 연구하기위한 유용한 도구가 될 것이다. 여기서는 생체 내 및 시험 관내에서 IL-22 생산 세포를 관찰 할 간략한 리포터 트랜스 제닉 마우스 모델을 개발 하였다. 혈중 알코올 농도를 recombineering 방법 9를 사용하여, 우리는 IL-22에 폴리 LOC의 신호 단편을 tdTomato cDNA 서열을 삽입우리와 우리는 가능한 한 IL-22의 자연 조절을 모방하고자하기 때문에 다른 번역되지 않은 지역, 엑손, 규제 요소, 교란되지 않은 엑손 1을 대체했다. 리포터 삽입 부위는 IL-22 그 자체 빠르게 분비 달리 생산 세포 내부 리포터의 축적의 결과로, 신호 서열을 방해. 이 새로운 방법은 다른 분비 단백질 리포터 생쥐의 발생에도 적용 할 수있다.

<table border="0" cellpadding="0" cellspacing="0" width="775">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:164px;">RP23-401E11 BAC</td>
			<td style="width:151px;">Thermo Fisher Scientific</td>
			<td style="width:116px;">RPCI23.C</td>
			<td style="width:345px;">Need gene ID: 50929</td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:164px;">NucleoBond BAC 100</td>
			<td style="width:151px;">Takara Clontech</td>
			<td style="width:116px;">740579</td>
			<td style="width:345px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:164px;">PCR SuperMix High Fidelity</td>
			<td style="width:151px;">Thermo Fisher Scientific</td>
			<td style="width:116px;">10790020</td>
			<td style="width:345px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:164px;">PI-SceI</td>
			<td style="width:151px;">New England Biolabs</td>
			<td style="width:116px;">R0696S</td>
			<td style="width:345px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:164px;">SpeI</td>
			<td style="width:151px;">New England Biolabs</td>
			<td style="width:116px;">R0133S</td>
			<td style="width:345px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:164px;">LB Broth</td>
			<td>Thermo Fisher Scientific</td>
			<td style="width:116px;">10855-001</td>
			<td style="width:345px;">1L: 10 g SELECT Peptone 140, 5 g SELECT Yeast Extract, 5 g sodium chloride&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:164px;">Anti-mouse CD3</td>
			<td style="width:151px;">eBioscience</td>
			<td style="width:116px;">11-0031</td>
			<td style="width:345px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:164px;">Anti-mouse CD4</td>
			<td style="width:151px;">eBioscience</td>
			<td style="width:116px;">17-0041</td>
			<td style="width:345px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:164px;">Anti-mouse CD45</td>
			<td>Thermo Fisher Scientific</td>
			<td style="width:116px;">MCD4530</td>
			<td style="width:345px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:164px;">Anti-mouse CD45RB</td>
			<td style="width:151px;">eBioscience</td>
			<td style="width:116px;">11-0455</td>
			<td style="width:345px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:164px;">Anti-mouse RFP</td>
			<td style="width:151px;">Abcam</td>
			<td style="width:116px;">Ab62341</td>
			<td style="width:345px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:164px;">HBSS, no calcium, no magnesium, no phenol red</td>
			<td style="width:151px;">Thermo Fisher Scientific</td>
			<td style="width:116px;">14175145</td>
			<td style="width:345px;">KCl, KH2PO4, Na2HPO4, NaHCO3, NaCl, D-Glucose</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:164px;">Dnase I</td>
			<td style="width:151px;">Roche</td>
			<td style="width:116px;">10104159001</td>
			<td style="width:345px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:164px;">ACK lysing buffer</td>
			<td style="width:151px;">Thermo Fisher Scientific</td>
			<td style="width:116px;">A1049201</td>
			<td style="width:345px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:164px;">Percoll</td>
			<td style="width:151px;">GE healthcare life sciences</td>
			<td style="width:116px;">17-0891-01</td>
			<td style="width:345px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:164px;">Collagenase D</td>
			<td style="width:151px;">Roche</td>
			<td style="width:116px;">11088858001</td>
			<td style="width:345px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:164px;">Dispase II (neutral protease, grade II)</td>
			<td style="width:151px;">Roche</td>
			<td style="width:116px;">4942078001</td>
			<td style="width:345px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:164px;">IX70 inverted fluorescence microscope</td>
			<td style="width:151px;">Olympus</td>
			<td style="width:116px;"></td>
			<td style="width:345px;">Ask for quote</td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:164px;">Nikon Eclipse 80i microscope</td>
			<td style="width:151px;">Nikon</td>
			<td style="width:116px;"></td>
			<td style="width:345px;">Ask for quote</td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:164px;">Dynal shaker</td>
			<td style="width:151px;">Electron Microscopy Science</td>
			<td style="width:116px;">61050-10</td>
			<td style="width:345px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:164px;">FACSAria</td>
			<td style="width:151px;">BD Bioscience</td>
			<td style="width:116px;"></td>
			<td style="width:345px;">Ask for quote</td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:164px;">LSRII SORP/flow cytometry</td>
			<td style="width:151px;">Becton, Dickinson and Company&#160;</td>
			<td style="width:116px;"></td>
			<td style="width:345px;">Ask for quote</td>
		</tr>
	</tbody>
</table>

visualization of il-22-expressing lymphocytes using reporter mice

리포터 생쥐 널리 표적 유전자의 발현을 관찰 지역화 사용되고있다. 이 프로토콜은 새로운 유전자 변형 기자 마우스 모델을 수립하기위한 전략에 초점을 맞추고 있습니다. 우리는이 사이토 카인은 염증 조직 손상을 복구에 기여하는 부위에 중요 활동을 갖기 때문에, 인터루킨 (IL) (22)의 유전자 발현을 가시화하도록 선택. 리포터 시스템은 생체 내에서 제품을 식별하는 다른 방법에 비해 상당한 이점을 제공한다. IL-22의 경우, 다른 연구는 먼저 조직으로부터 세포를 격리 한 후, 시험관 내에서 세포를 재 자극. IL-22, 정상적으로 분비, 약물을 사용하여 균체 내에 포집하고, 세포 염색하여 시각화 하였다. 이 방법은 IL-22을 제조 할 셀을 식별하는, 그러나 생체 내에서 그렇게 한 여부를 결정하지 않는다. 리포터 설계는 이러한 WA에서 IL-22 유전자에 형광 단백질 (tdTomato)에 대한 유전자를 삽입 포함형광 단백질 따라서 분비 할 수없는 예는 생체 내에서 생산 세포 안에 갇혀 남아. 형광 제작자는 조직 절편 또는 유동 세포 계측법을 통하여 생체 외 분석에 의해 시각화 될 수있다. 리포터의 실제 구성 프로세스는 IL-22 유전자를 함유 된 세균 인공 염색체를 포함 recombineering. 이 조작 된 후 염색체 마우스 게놈에 도입 하였다. 항상성 IL-22 발현은 리포터 분석을 유동 세포 계측법에 의한 비장, 흉선, 림프절, 파이어 판 및 소장을 포함하여 다른 마우스 조직에서 관찰되었다. 대장염은 T 세포 (CD4 + CD45RBhigh) 전송에 의해 유도하고, 기자의 발현을 시각화했다. 양성 T 세포 장간막 림프절 제 존재하고 그들 선단부 소장과 결장 조직의 고유 층 내부에 축적. BAC에를 사용하는 전략은 IL-22 EXPRES에 비해 좋은 충실도 기자의 표현을 주었다시온, 그리고 노크 절차보다 간단하다.

쥐 IL-22 리포터 유전자는 IL-22 궤적을 운반하는 박테리아 인공 염색체를 수정 recombineering를 사용하여 만들었습니다. 도 1은 sacBII 유전자 양성 선택 마커 및 항생제 클로람페니콜 내성 유전자를 함유하는 11 pBACe3.6 벡터의도를 나타낸다. 도 2에 도시 된 바와 같이, 엑손 1에 tdTomato를 도입 한 후, 신호 펩티드 서열이 중단되었다...

Watch this Scientific Journal Video about Visualization of IL-22-expressing Lymphocytes Using Reporter Mice at JoVE.com

Visualization of IL-22-expressing Lymphocytes Using Reporter Mice

We describe here a transgenic reporter mouse model to visualize the IL-22-producing cells inside different mouse tissues. This method can be used to track the location of other cytokines or secretary proteins in the mouse.

기자 마우스를 사용하여 IL-22 발현 림프구의 시각화

Reporter mice have been widely used to observe the localization of expression of targeted genes. This protocol focuses on a strategy to establish a new ...

visualization-of-il-22-expressing-lymphocytes-using-reporter-mice

Universidad de Cartagena UDEC

Research

JoVE Journal

Immunology and Infection

8.7K 조회수.  National Cancer Institute, National Institutes of Health. We describe here a transgenic reporter mouse model to visualize the IL-22-producing cells inside different mouse tissues. This method can be used to track the location of other cytokines or secretary proteins in the mouse. 

비디오: Visualization of IL-22-expressing Lymphocytes Using Reporter Mice

Visualization of Bacterial Toxin Induced Responses Using Live Cell Fluorescence Microscopy

Bacterial toxins bind to cholesterol in membranes, forming pores that allow for leakage of cellular contents and influx of materials from the external environment. The cell can either recover from this insult, which requires active membrane repair processes, or else die depending on the amount of toxin exposure and cell type1. In addition, these toxins induce strong inflammatory responses in infected hosts through activation of immune cells, including macrophages, which produce an array of pro-inflammatory cytokines2. Many Gram positive bacteria produce cholesterol binding toxins which have been shown to contribute to their virulence through largely uncharacterized mechanisms.
Morphologic changes in the plasma membrane of cells exposed to these toxins include their sequestration into cholesterol-enriched surface protrusions, which can be shed into the extracellular space, suggesting an intrinsic cellular defense mechanism3,4. This process occurs on all cells in the absence of metabolic activity, and can be visualized using EM after chemical fixation4. In immune cells such as macrophages that mediate inflammation in response to toxin exposure, induced membrane vesicles are suggested to contain cytokines of the IL-1 family and may be responsible both for shedding toxin and disseminating these pro-inflammatory cytokines5,6,7. A link between IL-1&beta; release and a specific type of cell death, termed pyroptosis has been suggested, as both are caspase-1 dependent processes8. To sort out the complexities of this macrophage response, which includes toxin binding, shedding of membrane vesicles, cytokine release, and potentially cell death, we have developed labeling techniques and fluorescence microscopy methods that allow for real time visualization of toxin-cell interactions, including measurements of dysfunction and death (Figure 1). Use of live cell imaging is necessary due to limitations in other techniques. Biochemical approaches cannot resolve effects occurring in individual cells, while flow cytometry does not offer high resolution, real-time visualization of individual cells. The methods described here can be applied to kinetic analysis of responses induced by other stimuli involving complex phenotypic changes in cells.

Methods for purifying the cholesterol binding toxin streptolysin O from recombinant E. coli and visualization of toxin binding to live eukaryotic cells are described. Localized delivery of toxin induces rapid and complex changes in targeted cells revealing novel aspects of toxin biology.

라이브 세포 형광 현미경을 사용하여 박테리아 독소 유도 응답의 시각화

Bacterial toxins bind to cholesterol in membranes, forming pores that allow for leakage of cellular contents and influx of materials from the external ...

연구

면역학 및 감염병학

Isolation of Lymphocytes from Mouse Genital Tract Mucosa

Mucosal surfaces, including in the gastrointestinal, urogenital, and respiratory tracts, provide portals of entry for pathogens, such as viruses and bacteria 1. Mucosae are also inductive sites in the host to generate immunity against pathogens, such as the Peyers patches in the intestinal tract and the nasal-associated lymphoreticular tissue in the respiratory tract. This unique feature brings mucosal immunity as a crucial player of the host defense system. Many studies have been focused on gastrointestinal and respiratory mucosal sites. However, there has been little investigation of reproductive mucosal sites. The genital tract mucosa is the primary infection site for sexually transmitted diseases (STD), including bacterial and viral infections. STDs are one of the most critical health challenges facing the world today. Centers for Disease Control and Prevention estimates that there are 19 million new infectious every year in the United States. STDs cost the U.S. health care system $17 billion every year 2, and cost individuals even more in immediate and life-long health consequences. In order to confront this challenge, a greater understanding of reproductive mucosal immunity is needed and isolating lymphocytes is an essential component of these studies. Here, we present a method to reproducibly isolate lymphocytes from murine female genital tracts for immunological studies that can be modified for adaption to other species. The method described below is based on one mouse.&#x2003;

An efficient way to isolate lymphocytes from mouse genital tract is described. This method takes advantage of enzyme digestion and Percoll gradient separation to allow efficient isolation. This technique is also adaptable to for use in other species

마우스 성기 요로 점막에서 림프구의 분리

Mucosal surfaces, including in the gastrointestinal, urogenital, and respiratory tracts, provide portals of entry for pathogens, such as viruses and ...

Isolation and Th17 Differentiation of Na&iuml;ve CD4 T Lymphocytes

Th17 cells are a distinct subset of T cells that have been found to produce interleukin 17 (IL-17), and differ in function from the other T cell subsets including Th1, Th2, and regulatory T cells. Th17 cells have emerged as a central culprit in overzealous inflammatory immune responses associated with many autoimmune disorders. In this method we purify T lymphocytes from the spleen and lymph nodes of C57BL/6 mice, and stimulate purified CD4+ T cells under control and Th17-inducing environments. The Th17-inducing environment includes stimulation in the presence of anti-CD3 and anti-CD28 antibodies, IL-6, and TGF-&#946;. After incubation for at least 72 hours and for up to five days at 37 &#176;C, cells are subsequently analyzed for the capability to produce IL-17 through flow cytometry, qPCR, and ELISAs. Th17 differentiated CD4+CD25- T cells can be utilized to further elucidate the role that Th17 cells play in the onset and progression of autoimmunity and host defense. Moreover, Th17 differentiation of CD4+CD25- lymphocytes from distinct murine knockout/disease models can contribute to our understanding of cell fate plasticity.

Isolation and Th17 Differentiation of Na&#239;ve CD4 T Lymphocytes

With effector functions distinct from other T cell subsets, Th17 cells have been centrally implicated in inflammatory autoimmunity. This in vitro Th17 differentiation protocol provides a means to determine whether na&#239;ve CD4+ T lymphocytes can differentiate into Th17 cells, and to further examine their role in autoimmunity and host response.

분리 및 나이브 CD4 T 림프구의 TH17 분화

Th17 cells are a distinct subset of T cells that have been found to produce interleukin 17 (IL-17), and differ in function from the other T cell subsets ...

Long Term Intravital Multiphoton Microscopy Imaging of Immune Cells in Healthy and Diseased Liver Using CXCR6.Gfp Reporter Mice

Liver inflammation as a response to injury is a highly dynamic process involving the infiltration of distinct subtypes of leukocytes including monocytes, neutrophils, T cell subsets, B cells, natural killer (NK) and NKT cells. Intravital microscopy of the liver for monitoring immune cell migration is particularly challenging due to the high requirements regarding sample preparation and fixation, optical resolution and long-term animal survival. Yet, the dynamics of inflammatory processes as well as cellular interaction studies could provide critical information to better understand the initiation, progression and regression of inflammatory liver disease. Therefore, a highly sensitive and reliable method was established to study migration and cell-cell-interactions of different immune cells in mouse liver over long periods (about 6 hr) by intravital two-photon laser scanning microscopy (TPLSM) in combination with intensive care monitoring.
The method provided includes a gentle preparation and stable fixation of the liver with minimal perturbation of the organ; long term intravital imaging using multicolor multiphoton microscopy with virtually no photobleaching or phototoxic effects over a time period of up to 6 hr, allowing tracking of specific leukocyte subsets; and stable imaging conditions due to extensive monitoring of mouse vital parameters and stabilization of circulation, temperature and gas exchange.
To investigate lymphocyte migration upon liver inflammation CXCR6.gfp knock-in mice were subjected to intravital liver imaging under baseline conditions and after acute and chronic liver damage induced by intraperitoneal injection(s) of carbon tetrachloride (CCl4).
CXCR6 is a chemokine receptor expressed on lymphocytes, mainly on Natural Killer T (NKT)-, Natural Killer (NK)- and subsets of T lymphocytes such as CD4 T cells but also mucosal associated invariant (MAIT) T cells1. Following the migratory pattern and positioning of CXCR6.gfp+ immune cells allowed a detailed insight into their altered behavior upon liver injury and therefore their potential involvement in disease progression.

Stable intravital high-resolution imaging of immune cells in the liver is challenging. Here we provide a highly sensitive and reliable method to study migration and cell-cell-interactions of immune cells in mouse liver over long periods (about 6 hours) by intravital multiphoton laser scanning microscopy in combination with intensive care monitoring.

CXCR6.Gfp 기자 마우스를 사용하여 건강하고 병에 걸린 간에서 면역 세포의 장기 생체 내에 다중 광자 현미경 이미징

Liver inflammation as a response to injury is a highly dynamic process involving the infiltration of distinct subtypes of leukocytes including monocytes, ...

Intravital Imaging of Neutrophil Priming Using IL-1&#946; Promoter-driven DsRed Reporter Mice

Neutrophils are the most abundant leukocytes in human blood circulation and are quickly recruited to inflammatory sites. Priming is a critical event that enhances the phagocytic functionality of neutrophils. Although extensive studies have unveiled the existence and importance of neutrophil priming during infection and injury, means of visualizing this process in vivo have been unavailable. The protocol provided enables monitoring of the dynamic process of neutrophil priming in living animals by combining three methodologies: 1) DsRed reporter signal &#8212; used as a measure of priming 2) in vivo neutrophil labeling &#8212; achieved by injection of fluorescence-conjugated anti-lymphocyte antigen 6G (Ly6G) monoclonal antibody (mAb) and 3) intravital confocal imaging. Several critical steps are involved in this protocol: oxazolone-induced mouse ear skin inflammation, appropriate sedation of animals, repeated injections of anti-Ly6G mAb, and prevention of focus drift during imaging. Although a few limitations have been observed, such as the limit of continuous imaging time (~ 8 hr) in one mouse and the leakage of fluorescein isothiocyanate-dextran from blood vessels in the inflammatory state, this protocol provides a fundamental framework for intravital imaging of primed neutrophil behavior and function, which can easily be expanded to examination of other immune cells in mouse inflammation models.

This current protocol employs fluorescent reporters, in vivo labeling, and intravital imaging techniques to enable monitoring of the dynamic process of neutrophil priming in living animals.

IL-1β의 발기인 기반을 DsRed 기자 마우스를 사용 호중구 초벌의 생체 내에 영상

Neutrophils are the most abundant leukocytes in human blood circulation and are quickly recruited to inflammatory sites. Priming is a critical event that ...

Isolation and Activation of Murine Lymphocytes

B and T cells, with their extremely diverse antigen-receptor repertoires, have the ability to mount specific immune responses against almost any invading pathogen1,2. Understandably, such intricate abilities are controlled by a large number of molecules involved in various cellular processes to ensure timely and spatially regulated immune responses3. Here, we describe experimental procedures that allow rapid isolation of highly purified murine lymphocytes using magnetic cell sorting technology. The resulting purified lymphocytes can then be subjected to various in vitro or in vivo functional assays, such as the determination of lymphocyte signaling capacity upon stimulation by immunoblotting4 and the investigation of proliferative abilities by 3H-thymidine incorporation or carboxyfluorescein diacetate succinimidyl ester (CFSE) labeling5-7. In addition to comparing the functional capacities of control and genetically modified lymphocytes, we can also determine the T cell stimulatory capacity of antigen-presenting cells (APCs) in vivo, as shown in our representative results using transplanted CFSE-labeled OT-I T cells.

Lymphocytes are the major players in adaptive immune responses. Here, we present a lymphocyte purification protocol to determine the physiological functions of the desired molecules in lymphocyte activation in vitro and in vivo. The described experimental procedures are suitable for comparing functional capacities between control and genetically modified lymphocytes.

분리 및 쥐 림프구의 활성화

B and T cells, with their extremely diverse antigen-receptor repertoires, have the ability to mount specific immune responses against almost any invading ...

Visualization of Biofilm Formation in Candida albicans Using an Automated Microfluidic Device

Candida albicans is the most common fungal pathogen of humans, causing about 15% of hospital-acquired sepsis cases. A major virulence attribute of C. albicans is its ability to form biofilms, structured communities of cells attached to biotic and abiotic surfaces. C. albicans biofilms can form on host tissues, such as mucosal layers, and on medical devices, such as catheters, pacemakers, dentures, and joint prostheses. Biofilms pose significant clinical challenges because they are highly resistant to physical and chemical perturbations, and can act as reservoirs to seed disseminated infections. Various in vitro assays have been utilized to study C. albicans biofilm formation, such as microtiter plate assays, dry weight measurements, cell viability assays, and confocal scanning laser microscopy. All of these assays are single end-point assays, where biofilm formation is assessed at a specific time point. Here, we describe a protocol to study biofilm formation in real-time using an automated microfluidic device under laminar flow conditions. This method allows for the observation of biofilm formation as the biofilm develops over time, using customizable conditions that mimic those of the host, such as those encountered in vascular catheters. This protocol can be used to assess the biofilm defects of genetic mutants as well as the inhibitory effects of antimicrobial agents on biofilm development in real-time.

Visualization of Biofilm Formation in Candida albicans Using an Automated Microfluidic Device

This protocol describes the use of a customizable automated microfluidic device to visualize biofilm formation in Candida albicans under host physiological conditions.

Candida albicans 자동 미세 장치를 사용 하 여에서 Biofilm 형성의 시각화

Candida albicans is the most common fungal pathogen of humans, causing about 15% of hospital-acquired sepsis cases. A major virulence attribute of C. ...

Imaging Mycobacterium tuberculosis in Mice with Reporter Enzyme Fluorescence

Reporter enzyme fluorescence (REF) utilizes substrates that are specific for enzymes present in target organisms of interest for imaging or detection by fluorescence or bioluminescence. We utilize BlaC, an enzyme expressed constitutively by all M. tuberculosis strains. REF allows rapid quantification of bacteria in lungs of infected mice. The same group of mice can be imaged at many time points, greatly reducing costs, enumerating bacteria more quickly, allowing novel observations in host-pathogen interactions, and increasing statistical power, since more animals per group are readily maintained. REF is extremely sensitive due to the catalytic nature of the BlaC enzymatic reporter and specific due to the custom flourescence resonance energy transfer (FRET) or fluorogenic substrates used. REF does not require recombinant strains, ensuring normal host-pathogen interactions. We describe the imaging of M. tuberculosis infection using a FRET substrate with maximal emission at 800 nm. The wavelength of the substrate allows sensitive deep tissue imaging in mammals. We will outline aerosol infection of mice with M. tuberculosis, anesthesia of mice, administration of the REF substrate, and optical imaging. This method has been successfully applied to evaluating host-pathogen interactions and efficacy of antibiotics targeting M. tuberculosis.

Imaging Mycobacterium tuberculosis in Mice with Reporter Enzyme Fluorescence

We describe the optical imaging of mice infected with Mycobacterium tuberculosis (M. tuberculosis) using reporter enzyme fluorescence (REF). This protocol facilitates the sensitive and specific detection of M. tuberculosis in pre-clinical animal models for pathogenesis, therapeutics and vaccine research.

기자 효소 형광와 쥐에서 이미징 결핵균

Reporter enzyme fluorescence (REF) utilizes substrates that are specific for enzymes present in target organisms of interest for imaging or detection by ...

Probiotic Studies in Neonatal Mice Using Gavage

Adult mouse models have been widely used to understand the mechanism behind disease progression in humans. The applicability of studies done in adult mouse models to neonatal diseases is limited. To better understand disease progression, host responses and long-term impact of interventions in neonates, a neonatal mouse model likely is a better fit. The sparse use of neonatal mouse models can in part be attributed to the technical difficulties of working with these small animals. A neonatal mouse model was developed to determine the effects of probiotic administration in early life and to specifically assess the ability to establish colonization in the newborn mouse intestinal tract. Specifically, to assess probiotic colonization in the neonatal mouse, Lactobacillus plantarum (LP) was delivered directly into the neonatal mouse gastrointestinal tract. To this end, LP was administered to mice by feeding through intra-esophageal (IE) gavage. A highly reproducible method was developed to standardize the process of IE gavage that allows an accurate administration of probiotic dosages while minimizing trauma, an aspect particularly important given the fragility of newborn mice. Limitations of this process include possibilities of esophageal irritation or damage and aspiration if gavaged incorrectly. This approach represents an improvement on current practices because IE gavage into the distal esophagus reduces the chances of aspiration. Following gavage, the colonization profile of the probiotic was traced using quantitative polymerase chain reaction (qPCR) of the extracted intestinal DNA with LP specific primers. Different litter settings and cage management techniques were used to assess the potential for colonization-spread. The protocol details the intricacies of IE neonatal mouse gavage and subsequent colonization quantification with LP.

This study details the process of gavaging precise amounts of probiotics to neonatal mice. The experimental set-up was optimized to include but is not limited to probiotic dosing, methods of administration, and quantification of bacteria in the intestines.

Gavage를 사용 하 여 신생아 쥐에 있는 Probiotic 연구

Adult mouse models have been widely used to understand the mechanism behind disease progression in humans. The applicability of studies done in adult ...

Intravital Imaging of Intraepithelial Lymphocytes in Murine Small Intestine

Intraepithelial lymphocytes expressing &#947;&#948; T cell receptor (&#947;&#948; IEL) play a key role in immune surveillance of the intestinal epithelium. Due in part to the lack of a definitive ligand for the &#947;&#948; T cell receptor, our understanding of the regulation of &#947;&#948; IEL activation and their function in vivo remains limited. This necessitates the development of alternative strategies to interrogate signaling pathways involved in regulating &#947;&#948; IEL function and the responsiveness of these cells to the local microenvironment. Although &#947;&#948; IELs are widely understood to limit pathogen translocation, the use of intravital imaging has been critical to understanding the spatiotemporal dynamics of IEL/epithelial interactions at steady-state and in response to invasive pathogens. Herein, we present a protocol for visualizing IEL migratory behavior in the small intestinal mucosa of a GFP &#947;&#948; T cell reporter mouse using inverted spinning disk confocal laser microscopy. Although the maximum imaging depth of this approach is limited relative to the use of two-photon laser-scanning microscopy, spinning disk confocal laser microscopy provides the advantage of high speed image acquisition with reduced photobleaching and photodamage. Using 4D image analysis software, T cell surveillance behavior and their interactions with neighboring cells can be analyzed following experimental manipulation to provide additional insight into IEL activation and function within the intestinal mucosa.

We describe a method to visualize GFP-labeled &#947;&#948; IELs using intravital imaging of murine small intestine by inverted spinning disk confocal microscopy. This technique enables the tracking of live cells within the mucosa for up to 4 h and can be used to investigate a variety of intestinal immune-epithelial interactions. &#160;