Damos las gracias a Shanghai Tolo Biotech por su asistencia técnica durante el desarrollo de la norma C-Brick. Este trabajo fue apoyado por subvenciones del Programa de Investigación Prioritaria Estratégica de la Academia China de Ciencias (Grant No. XDB19040200).

1. Preparación de CRRNA <ol><li> Preparación de plantillas de CRRNA <ol><li> Re-suspender los oligonucleótidos individuales ( Tabla 1 ) en agua libre de RNasa a una concentración de 10 μM. </li><li> Se a~naden 22,5 μl de oligonucleótido de hebra superior (T7-F en la Tabla 1 ), 22,5 μl de oligonucleótido de cadena inferior ( Tabla 1 ) y 5 μl de tampón de recocido 10x a un tubo de PCR de 0,2 ml. Asegúrese de que el volumen total es de 50 μl. NOTA: En la Tabla 1 se muestran seis oligonucleótidos diferentes de hebras inferiores, cada uno de los cuales debería estar emparejado individualmente con la hebra superior T7-F. Las letras minúsculas de la Tabla 1 representan la secuencia a transcribir en la secuencia guía de CRRNA. Se puede usar tampón Taq PCR 10x en lugar del tampón de recocido 10x. </li><li> Coloque el tubo de PCR en un termociclador. </li><li> Ejecutar el programa de recocido: desnaturalización inicial a 95 ° C para5 min y luego un tiempo de reutilización de 95-20 ° C, con una disminución de 1 ° C por minuto en el termociclador. NOTA: Utilice inmediatamente las muestras para el paso 1.2.1. </li></ol></li><li> Transcripción y purificación de CRRNA <ol><li> Se añaden 38 μl de agua libre de RNasa, 8 μl de la plantilla de la etapa 1.1.4, 20 μl de tampón de transcripción 5x T7, 20 μl de mezcla NTP (10 μM), 4 μl de inhibidor RNasa recombinante (RRI) y 10 μL Μl de ARN polimerasa T7 a un tubo de microcentrífuga de 1,5 ml. Asegúrese de que el volumen total es de 100 μL. </li><li> Se pone el tubo de microcentrífuga en un baño de agua a 37 ° C durante la noche (durante aproximadamente 16 h). </li><li> Utilice un kit de limpieza y concentración de ARN para purificar el ARN transcrito; Siga el protocolo del fabricante. </li><li> Cuantificar los ARNs con espectrofotómetros UV-Vis y diluir el ARN a una concentración de 10 μ M. Utilice las muestras inmediatamente o almacénelas a -80 ° C. NOTA: La secuencia de CRRNAS se enumeran en la Tabla 2 . </li></ol></li></ol> 2. Construcción de piezas de C-Brick ( es decir, la inserción de partes biológicas en un vector estándar de C-Brick) NOTA: Este paso tiene tres sub-pasos. Para las partes biológicas cortas ( por ejemplo, promotores y terminadores), es mejor utilizar el método de PCR directa para insertar las partes biológicas en un vector estándar de C-Brick 4 . La secuencia completa del vector se muestra en los datos suplementarios, y la secuencia de prefijo y sufijo se muestra en la Figura 1 (paso 2.1, más adelante). Para las partes biológicas que pueden obtenerse fácilmente mediante PCR ( por ejemplo, con plantillas de ADN genómico, plásmidos o secuencias de ADN sintetizadas de novo ), es mejor utilizar el método de ensamblaje sin costuras para insertar las partes biológicas en un vector estándar de C-Brick (Paso 2.2, más adelante). Para las partes obtenidas de las normas BioBrick y BglBrick, la restricciónSe puede usar la digestión mediada por enzima y la ligación mediada por ligasa de T4-ADN para insertar las partes biológicas en un vector estándar de C-Brick (etapa 2.3, más adelante). <ol><li> Construcción mediante amplificación directa por PCR <ol><li> Diseñar y ordenar oligonucleótidos para la amplificación por PCR. NOTA: El extremo 5 &#39;del oligonucleótido contiene la secuencia de la parte de ADN, y el extremo 3&#39; del oligonucleótido contiene la secuencia del vector ( es decir, &quot;GGATCCACTAGTCTCTAGCTCG&quot; en el extremo 3 &#39;de la hebra delantera y &quot;GGATCCTTTCTCCTCTTTCTAG&quot; En la cadena inversa). En el extremo 5 &#39;del oligonucleótido no se puede diseñar ningún saliente ni un saliente de 20 pb. Ejemplos específicos se pueden encontrar en un estudio previo 4 . </li><li> Re-suspender oligonucleótidos individuales en agua ultra pura a una concentración de 10 μ M. </li><li> Preparar reacciones de PCR en hielo en un tubo de PCR de 0,2 ml: añadir 18 μl de agua ultra pura, 25 μL de 2x P1 μl de dNTPs (10 μM), 2,5 μl de cada uno de los cebadores directos e inversos (10 μM) del paso 2.1.2, 0,5 μl de vector estándar C-Brick (50 ng) como molde y 0,5 μl De DNA polimerasa de alta fidelidad. Asegúrese de que el volumen total es de 50 μl. </li><li> Coloque el tubo directamente en un termociclador e inicie el programa del termociclador. Utilizar las muestras inmediatamente o congelarlas y almacenarlas a -20 ° C. </li><li> Programa termociclador: un ciclo durante 3 min a 98 ° C; Treinta ciclos durante 10 s a 98 ° C, 20 s a 55 ° C y 2 min a 72 ° C; Y un ciclo durante 10 min a 72 ° C. Mantenga la muestra a 16 ° C. </li><li> Añadir 9 μl de la mezcla de la etapa 2.1.4 a un tubo de microcentrífuga de 1,5 ml. </li><li> Añadir 1 μl de DpnI e incubar durante 1 h en un baño de agua a 37 ° C. NOTA: Si los cebadores no tienen secuencias solapadas, añada 0,5 μL de polinucleótido quinasa T4 (PNK) y 0,5 μL de T4 DNA ligasa e incube enUn baño de agua a 22 ° C durante 1 h. De lo contrario, si los cebadores contienen una secuencia de superposición de ~ 20 nt, transformar directamente los productos tratados con DpnI en células compatibles con E. coli (DH10B) (etapa 2.4). El producto de PCR linealizado será circularizado por el sistema de recombinación en el huésped. </li><li> Utilice las muestras inmediatamente o guárdelas a -20 ° C. </li></ol></li><li> Construcción a través de un montaje sin fisuras <ol><li> Diseñar y ordenar oligonucleótidos para la amplificación por PCR. NOTA: El extremo 3 &#39;del oligonucleótido contiene la secuencia terminal de la parte de ADN y el extremo 5&#39; del oligonucleótido contiene el terminal de la secuencia de vector estándar linealizada de C - Brick ( es decir, &quot;CTAGAAAGAGGAGAAAGGATCC&quot; para el extremo 5 &#39; -end de la cadena delantera y &quot;CGAGCTAGAGACTAGTGGATCC&quot; para el extremo 5 &#39;de la cadena inversa). Ejemplos específicos se pueden encontrar en un estudio previo 4 . </li><li> Re-suspender el individuoUal en agua ultrapura a una concentración de 10 μM. </li><li> Preparar reacciones de PCR en hielo en un tubo de PCR de 0,2 ml: añadir 18 μl de agua ultra pura, 25 μL de tampón de PCR 2x, 1 μl de dNTP (10 μM), 2,5 μl de cada uno de los cebadores directos e inversos (10 μM ) De la etapa 2.2.2, 0,5 μl de plantilla (20-500 ng) y 0,5 μl de ADN polimerasa de alta fidelidad. Asegúrese de que el volumen total es de 50 μl. </li><li> Coloque el tubo directamente en el termociclador y ejecute el programa del termociclador. Utilizar las muestras inmediatamente o congelarlas y almacenarlas a -20 ° C. NOTA: Ajuste el programa del termociclador a: un ciclo durante 3 min a 98 ° C; 30 ciclos durante 10 s a 98 ° C, 20 s a 55 ° C (según la temperatura de recocido del cebador) y 1 min (según la longitud de las partes biológicas) a 72 ° C; Y un ciclo durante 10 min a 72 ° C. Mantenga la muestra a 16 ° C. </li><li> Purificar el producto de PCR utilizando un sistema de limpieza de PCRKit de temperatura; Siga el protocolo del fabricante. </li><li> Digerir el vector estándar C-Brick con BamHI: añadir 34 μl de agua ultra pura, 10 μL de plásmido (1 μg), 5 μL de tampón 10x y 1 μl de BamHI al tubo de microcentrífuga. Incubar durante 2 h a 37 ° C en un baño de agua. </li><li> Purificar el producto anterior usando un kit de sistema de limpieza de gel; Siga el protocolo del fabricante. </li><li> Añadir 2 μl de vector linealizado (50 ng) de la etapa 2.2.7, 5 μl de fragmento (200 ng) de la etapa 2.2.4, 2 μl de tampón de ensamblaje sin costura 5x y 1 μl de enzima de ensamblaje sin costura de un kit de ensamblaje sin costura A un tubo de microcentrífuga de 1,5 ml. Asegúrese de que el volumen total es de 10 μl. </li><li> Colocar esto en un baño de agua a 37 ° C durante 30 min. Utilizar las muestras inmediatamente o congelarlas y almacenarlas a -20 ° C. </li></ol></li><li> Construcción mediante digestión mediada por enzimas de restricción y ligación mediada por ligasa de T4 ADN. NOTA: Para las partes obtenidas de las normas BioBrick (etapa 2.3.4-2.3.7) y BglBrick (etapa 2.3.1-2.3.3), se puede utilizar la digestión mediada por enzimas de restricción y la ligación mediada por ligasa de T4-ADN para insertar la Biológicas en un vector estándar de C-Brick. <ol><li> Digerir las partes estándar de BglBrick con BamHI y BglII: añadir 34 μl de agua ultra pura, 10 μL de plásmido (2 μg), 5 μL de tampón 10x, 0,5 μL de BamHI y 0,5 μL de BglII en el tubo de microcentrífuga. Incubar durante 2 h en un baño de agua a 37 ° C. </li><li> Ejecutar una electroforesis en gel de agarosa al 1% y purificar el fragmento usando un kit de sistema de limpieza de gel. </li><li> Ligar el fragmento y el vector estándar de C-Brick: añadir 2 μl de vector linealizado (50 ng) de la etapa 2.1.12 y 6 μl de fragmento (200 ng) de la etapa 2.3.3 a un tubo de microcentrífuga de 1,5 ml. Añadir 1 μ l de 10 x T4 ADN ligasa buffer y 1 μ l de T4 DNA ligase. Incubar durante 2 h a 22 ° C. Utilice las muestras inmediatamente o freezE y almacenarlos a -20 ° C. </li><li> Digerir las partes estándar de BioBrick con XbaI y SpeI: añadir 34 μL de agua ultra pura, 10 μL de plásmido (2 μg), 5 μL de tampón 10x, 0,5 μL de XbaI y 0,5 μL de SpeI al tubo de microcentrífuga. Incubar durante 2 h en un baño de agua a 37 ° C. </li><li> Digerir el vector estándar de C-Brick con XbaI y SpeI: añadir 34 μL de agua ultrapura, 10 μL de plásmido (1 μg), 5 μl de tampón 10x, 0,5 μL de XbaI y 0,5 μl de SpeI al tubo de microcentrífuga . Incubar durante 2 h en un baño de agua a 37 ° C. </li><li> Ejecutar una electroforesis en gel de agarosa al 1% y purificar el fragmento de la etapa 2.3.4 y el vector linealizado de la etapa 2.3.5 con un kit de sistema de limpieza de gel; Siguiendo el protocolo del fabricante. </li><li> Ligar el fragmento y el vector C-Brick: añadir 2 μl de vector linealizado (50 ng) de la etapa 2.3.5 y 6 μl de fragmento (200 ng) de la etapa 2.3.4 a un tubo de microcentrífuga de 1,5 ml. AnuncioD 1 μl de tampón de ADN ligasa 10 x T4 y 1 μl de ADN ligasa T4. Incubar durante 2 h a 22 ° C. Utilizar las muestras inmediatamente o congelarlas y almacenarlas a -20 ° C. </li></ol></li><li> Añadir 10 μl de los productos de la etapa 2.1.8, 2.2.9, 2.3.3 o 2.3.7 para la transformación química en las células competentes de E. coli (DH10B). </li><li> Recoger varios clones a un líquido de 5 ml Luria-Bertani (LB) tubo e incubar a 37 ° C en un agitador (220 rpm) durante la noche. </li><li> Extraer el plásmido usando un kit de preparación de plásmido; Siga el protocolo del fabricante. </li><li> Identificar los clones correctos mediante la secuenciación de Sanger 11 . </li></ol> 3. Ensamblaje del C-Brick ( Figura 2 ) <ol><li> Digestión del vector C-Brick con Cpf1 <ol><li> Añadir 22,5 μl de agua libre de RNasa, 4 μl de tampón Cpf1 10x, 10 μl del plásmido de la etapa 2.6 (1 μg), 0,5 μL de RRI y 1 μg de# 181; L de Cpf1 (5 μM) a un tubo de microcentrífuga de 1,5 ml. NOTA: Cpf1 puede adquirirse comercialmente o purificarse siguiendo el protocolo en un estudio previo 4 . </li><li> Para insertar un fragmento de ADN extraño en los sitios T1 y T2, añadir 1 μl de CRRNA-T2 (10 μM) e incubar en un baño de agua a 37 ° C durante 30 min. A dd 1 μ l de CRRNA-T1 (10 μ M) y Cpf1 (5 μ M) durante otros 30 min. NOTA: Alternativamente, para insertar un fragmento de ADN extraño en los sitios T3 y T4, añadir 1 μl de CRRNA-T3 (10 μM) e incubar en un baño de agua a 37 ° C durante 30 minutos. Añadir 1 μ l de CRRNA-T4 (10 μ M) durante otros 30 min. </li><li> Añadir 1 μl de fosfatasa alcalina termosensible e incubar el tubo en un baño de agua a 37 ° C durante otras 1 h. </li><li> Ejecutar una electroforesis en gel de agarosa y purificar el vector utilizando un kit de sistema de limpieza de gel. Utilizar las muestras inmediatamente o congelarlas y almacenarlas a -20 ° C. </li></ol></Li <li> La digestión del fragmento de ADN con Cpf1 <ol><li> Añadir 21,5 μl de agua libre de RNasa, 4 μl de tampón Cpf1 10x, 10 μL de plásmido de la etapa 2.6 (2 μg), 0,5 μL de RRI y 2 μl de Cpf1 (5 μM) a un tubo de microcentrífuga de 1,5 ml. </li><li> Para insertar un fragmento de ADN extraño en los sitios T1 y T2, añadir 1 μl de CRRNA-T1 (10 μM) y 1 μl de CRRNA-T3 (10 μM) e incubar en un baño de agua a 37 ° C durante 2 h. NOTA: Alternativamente, añada 1 μl de CRRNA-T2 (10 μM) y 1 μl de CRRNA-T4 (10 μM) e incube en un baño de agua a 37 ° C durante 2 h. </li><li> Ejecutar una electroforesis en gel de agarosa y purificar el fragmento usando un kit de sistema de limpieza de gel. Utilizar las muestras inmediatamente o congelarlas y almacenarlas a -20 ° C. </li></ol></li><li> Ensamblaje de C-Brick y verificación adicional <ol><li> Ligar el fragmento de ADN extraño y el vector C-Brick: añadir 2 μl del vector linealizado (50 ng) de la etapa 3.1.4 y 6 μl del fragmento de ADN (200 ng) de la etapa 3.2.3 a un tubo de microcentrífuga de 1,5 ml. Añadir 1 μl de tampón de ADN ligasa 10 x T4 y 1 μl de ADN ligasa T4. Incubar durante 2 h a 22 ° C. Utilizar las muestras inmediatamente o congelarlas y almacenarlas a -20 ° C. </li><li> Añadir 10 μl de los productos de ligación (etapa 3.3.1) para la transformación química en células competentes de E. coli (DH10B). </li><li> Se agregan varios clones a un tubo LB líquido de 5 ml y se incuba durante la noche en un agitador a 220 rpm y 37ºC. </li><li> Extraer el plásmido usando un kit de preparación de plásmido; Siga el protocolo del fabricante. </li><li> Identificar los clones correctos mediante la secuenciación de Sanger 11 . </li></ol></li><li> Realice una nueva ronda de ensamblaje C-Brick. Los clones correctos de la etapa 3.3.4 pueden usarse como un nuevo vector de C-Brick o parte de ADN para un montaje iterativo de C-Brick adicional, siguiendo el mismo protocolo de los pasos 3.1-3.3. NOTA: T2 &#39;y T3&#39; sItes están diseñados como la copia de seguridad de los sitios T2 y T3 ( Figura 1a ). Para los plásmidos obtenidos de la etapa 2.3.7, sólo pueden utilizarse T2 &#39;y T3&#39; para el ensamblaje estándar de C-Brick. </li></ol>

<ol>
	<li>Canton, B., Labno, A., Endy, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Refinement+and+standardization+of+synthetic+biological+parts+and+devices.">Refinement and standardization of synthetic biological parts and devices.</a> Nat Biotechnol. 26 (7), 787-793 (2008).</li><li>Shetty, R. P., Endy, D., Knight, T. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+BioBrick+vectors+from+BioBrick+parts.">Engineering BioBrick vectors from BioBrick parts.</a> J Biol Eng. 2, (2008).</li><li>Knight, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Idempotent Vector Design for Standard Assembly of Biobricks. , 1-11 (2003).</li><li>Li, S. Y., Zhao, G. P., Wang, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=C-Brick:+A+New+Standard+for+Assembly+of+Biological+Parts+Using+Cpf1.">C-Brick: A New Standard for Assembly of Biological Parts Using Cpf1.</a> ACS Synth Biol. 5 (12), 1383-1388 (2016).</li><li>Anderson, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BglBricks:+A+flexible+standard+for+biological+part+assembly.">BglBricks: A flexible standard for biological part assembly.</a> J Biol Eng. 4 (1), (2010).</li><li>Liu, J. K., Chen, W. H., Ren, S. X., Zhao, G. P., Wang, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=iBrick:+a+new+standard+for+iterative+assembly+of+biological+parts+with+homing+endonucleases.">iBrick: a new standard for iterative assembly of biological parts with homing endonucleases.</a> PLoS One. 9 (10), e110852 (2014).</li><li>Hsu, P. D., Lander, E. S., Zhang, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+applications+of+CRISPR-Cas9+for+genome+engineering.">Development and applications of CRISPR-Cas9 for genome engineering.</a> Cell. 157 (6), 1262-1278 (2014).</li><li>Wright, A. V., Nunez, J. K., Doudna, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biology+and+Applications+of+CRISPR+Systems:+Harnessing+Nature's+Toolbox+for+Genome+Engineering.">Biology and Applications of CRISPR Systems: Harnessing Nature's Toolbox for Genome Engineering.</a> Cell. 164 (1-2), 29-44 (2016).</li><li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+programmable+dual-RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity.">A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-821 (2012).</li><li>Zetsche, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cpf1+is+a+single+RNA-guided+endonuclease+of+a+class+2+CRISPR-Cas+system.">Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system.</a> Cell. 163 (3), 759-771 (2015).</li><li>Sanger, F., Nicklen, S., Coulson, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+sequencing+with+chain-terminating+inhibitors.">DNA sequencing with chain-terminating inhibitors.</a> Proc Natl Acad Sci U S A. 74 (12), 5463-5467 (1977).</li><li>Engler, C., Kandzia, R., Marillonnet, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+one+pot,+one+step,+precision+cloning+method.">A one pot, one step, precision cloning method.</a> PLoS One. 3 (11), e3647 (2008).</li><li>Gibson, D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+assembly+of+DNA+molecules+up+to+several+hundred+kilobases.">Enzymatic assembly of DNA molecules up to several hundred kilobases.</a> Nat Methods. 6 (5), 343-345 (2009).</li><li>Casini, A., Storch, M., Baldwin, G. S., Ellis, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bricks+and+blueprints:+methods+and+standards+for+DNA+assembly.">Bricks and blueprints: methods and standards for DNA assembly.</a> Nat Rev Mol Cell Biol. 16 (9), 568-576 (2015).</li><li>Cameron, D. E., Bashor, C. J., Collins, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+brief+history+of+synthetic+biology.">A brief history of synthetic biology.</a> Nat Rev Microbiol. 12 (5), 381-390 (2014).</li><li>Keasling, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+biology+for+synthetic+chemistry.">Synthetic biology for synthetic chemistry.</a> ACS Chem Biol. 3 (1), 64-76 (2008).</li></ol>

Los autores no tienen nada que revelar.

Este protocolo describe un procedimiento para el ensamblaje de ADN estándar C-Brick. El paso más importante en este protocolo es la linealización del vector estándar de C-Brick; La escisión incompleta del vector podría afectar seriamente la tasa de éxito. Adicionalmente, aunque Cpf1 escinde principalmente secuencias de ADN diana en el patrón de escisión &quot;18-23&quot;, también se detectó una escisión imprecisa cerca de las dos bases 4 , lo que puede causar un pequeño número de mu...

La estandarización de las partes biológicas del ADN es importante para el desarrollo de la biología sintética 1 . El desarrollo de un procedimiento de ensamblaje de ADN puede reemplazar diseños experimentales ad hoc y eliminar muchos de los resultados inesperados que surgen durante el ensamblaje de componentes genéticos en sistemas más grandes. El estándar BioBrick (BBF RFC 10) fue uno de los primeros estándares de ensamblaje de ADN propuestos. Utiliza la secuencia de prefijo (que contiene sitios de corte EcoRI y XbaI) y la secuencia de sufijo (que contiene sitios de corte SpeI y PstI) 2 , 3 . Debido a que XbaI y SpeI tienen extremos cohesivos complementarios, las partes de ADN de BioBrick que se cortan con XbaI y SpeI se pueden unir, generando una nueva BioBrick para un montaje iterativo adicional. Algunos defectos han sido identificados con el uso del estándar BioBrick 4 . Por ejemplo, produce una cicatriz de 8 pbEntre las partes de ADN, que no permite la construcción de proteínas en fusión. Además, los cuatro tipos de sitios de restricción de 6 pb mencionados anteriormente deben retirarse de las partes de ADN, lo cual es muy inconveniente. El estándar BglBrick se estableció para resolver el primer problema 5 . Crea una cicatriz de 6 pb &quot;GGATCT&quot;, produciendo Gly-Ser y permitiendo la fusión de múltiples proteínas o dominios de proteínas. IBrick fue desarrollado para hacer frente al segundo problema 6 . Utiliza endonucleasas homing (HEs) que reconocen largas secuencias de ADN. Como los sitios de reconocimiento de HE rara vez existen en secuencias de ADN naturales, el estándar iBrick puede ser usado para la construcción directa de partes de iBrick sin modificar sus secuencias de ADN. Sin embargo, el estándar de iBrick deja una cicatriz de 21 pb entre las partes de ADN, lo que podría ser la razón de su impopularidad. En los últimos años, las repeticiones palindrómicas cortas intercaladas con intervalos regulares (CRISPR) se ha desarrollado rápidamente 7 , 8 . Entre las proteínas asociadas a CRISPR (Cas), la endonucleasa Cas9 de Streptococcus pyogenes es ahora ampliamente utilizada. En su mayor parte introduce introducciones de doble cadena de ADN (DSB) con extremos romos 9 . En 2015, Zhang y compañeros de trabajo caracterizaron Cpf1 (CRISPR de Prevotella y Francisella 1) por primera vez. Pertenece al sistema de tipo 2 CRISPR-Cas de tipo V y es una endonucleasa guiada por ARN de CRISRP (crRNA) 10 . A diferencia de Cas9, Cpf1 introduce un DSB con un 4 o 5 nt 5 &#39;sobresaliente 10 . Basándose en esta característica, Cpf1 se utilizó para desarrollar un estándar de ensamblaje de ADN, C-Brick 4 . En un vector estándar de C-Brick, cuatro sitios objetivo Cpf1 de T1 / T2 prefijados y T3 / T4 sufijados flanquean las partes biológicas; Esto es similar al estándar BioBrick. Como la escisión de los sitios T2 y T3 pProduce extremos pegajosos complementarios, es posible realizar el montaje iterativo de partes de ADN mientras se genera una cicatriz &quot;GGATCC&quot; entre las partes. Cabe destacar que el estándar C-Brick tiene dos ventajas principales: reconocer secuencias largas de blanco y dejar cicatrices cortas. La cicatriz de 6 pb &quot;GGATCC&quot; generada por C-Brick codifica Gly-Ser, que permite la construcción de proteínas de fusión. Además, el estándar C-Brick es también parcialmente compatible con los estándares BglBrick y BioBrick.

<table border="0" cellpadding="0" cellspacing="0" width="828">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">Comercial Oligonucleotide</td>
			<td style="width:160px;">Sangon Biotech</td>
			<td style="width:161px;"></td>
			<td style="width:191px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">10x Taq PCR Buffer</td>
			<td style="width:160px;">Transgen</td>
			<td style="width:161px;">#J40928</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">Ultra Pure Distilled Water</td>
			<td style="width:160px;">Invitrogen</td>
			<td style="width:161px;">10977-015</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">5x RNA Transcription Buffer</td>
			<td style="width:160px;">Thermo Scientific</td>
			<td style="width:161px;">K0441</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">T7 RNA polymerase</td>
			<td style="width:160px;">Thermo Scientific</td>
			<td style="width:161px;">#EP0111</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">NTP mixture</td>
			<td style="width:160px;">Sangon</td>
			<td style="width:161px;">#ND0056</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">RRI(Recombinant RNase Inhibitor)</td>
			<td style="width:160px;">Takara</td>
			<td style="width:161px;">2313A</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">RNA Clean &#38; Concentrator-5</td>
			<td style="width:160px;">Zymo Research</td>
			<td style="width:161px;">R1015</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">UV-Vis Spectrometer</td>
			<td style="width:160px;">Thermo Scientific</td>
			<td style="width:161px;">Nano-Drop 2000c</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">2x Phanta Max Buffer</td>
			<td style="width:160px;">Vazyme</td>
			<td style="width:161px;">PB505</td>
			<td>PCR buffer</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">dNTPs</td>
			<td style="width:160px;">Transgen</td>
			<td style="width:161px;">AD101</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:316px;">Phanta Max Super-Fidelity DNA Polymerase</td>
			<td style="width:160px;">Vazyme</td>
			<td style="width:161px;">P505-d1</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">Ezmax for One-step Cloning</td>
			<td style="width:160px;">Tolobio</td>
			<td style="width:161px;">24303-1</td>
			<td>seamless assembly kit</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">5x Buffer for Ezmax One-step Cloning</td>
			<td style="width:160px;">Tolobio</td>
			<td style="width:161px;">32006</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">BamHI</td>
			<td style="width:160px;">NEB</td>
			<td style="width:161px;">#R0136L</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">BamHI-HF</td>
			<td style="width:160px;">NEB</td>
			<td style="width:161px;">#R3136L</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">BglII&#160;</td>
			<td style="width:160px;">NEB</td>
			<td style="width:161px;">#R0144L</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">XbaI</td>
			<td style="width:160px;">NEB</td>
			<td style="width:161px;">#R0145L</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">SpeI</td>
			<td style="width:160px;">NEB</td>
			<td style="width:161px;">#R3133L</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">10x Buffer 3</td>
			<td style="width:160px;">NEB</td>
			<td style="width:161px;">#B7003S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">10x CutSmart Buffer</td>
			<td style="width:160px;">NEB</td>
			<td style="width:161px;">B7204S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">10x T4 DNA ligase Buffer</td>
			<td style="width:160px;">Tolobio</td>
			<td style="width:161px;">32002</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">T4 PNK</td>
			<td style="width:160px;">Tolobio</td>
			<td style="width:161px;">32206</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">T4 DNA ligase</td>
			<td style="width:160px;">Tolobio</td>
			<td style="width:161px;">32210</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">DpnI</td>
			<td style="width:160px;">NEB</td>
			<td style="width:161px;">#R01762</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">SV Gel and PCR clean-up system</td>
			<td style="width:160px;">Promega</td>
			<td style="width:161px;">A9282</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">Plasmid Mini Kit I</td>
			<td style="width:160px;">Omega</td>
			<td style="width:161px;">D6943-02</td>
			<td>plasmid preparation kit</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">thermosensitive alkaline phosphatase&#160;</td>
			<td style="width:160px;">Thermo Scientific</td>
			<td style="width:161px;">#EF0651</td>
			<td>FastAP</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">10x Cpf1 buffer</td>
			<td style="width:160px;">Tolobio</td>
			<td style="width:161px;">32008</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">Cpf1</td>
			<td style="width:160px;">Tolobio</td>
			<td style="width:161px;">32105</td>
			<td>FnCpf1</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">thermocycler</td>
			<td style="width:160px;">Applied Biosystems</td>
			<td style="width:161px;">veriti 96 well</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">C-Brick standard vector</td>
			<td style="width:160px;">Tolobio</td>
			<td style="width:161px;">98101</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">E. coli [DH10B]</td>
			<td style="width:160px;">Invitrogen</td>
			<td style="width:161px;">18297010</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">Luria-Bertani media (tryptone)</td>
			<td style="width:160px;">Oxoid</td>
			<td style="width:161px;">LP0042</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">Luria-Bertani media (yeast extract)</td>
			<td style="width:160px;">Oxoid</td>
			<td style="width:161px;">LP0021</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">Luria-Bertani media (NaCl)</td>
			<td style="width:160px;">Sangon Biotech</td>
			<td style="width:161px;">B126BA0007</td>
			<td></td>
		</tr>
	</tbody>
</table>

protocols for c-brick dna standard assembly using cpf1

La proteína Cpf1 asociada a CRISPR cliva ADN de doble cadena bajo la guía de ARN CRISPR (CRRNA), generando extremos pegajosos. Debido a esta característica, Cpf1 se ha utilizado para el establecimiento de un estándar de ensamblaje de ADN llamado C-Brick, que tiene la ventaja de sitios de reconocimiento largos y cicatrices cortas. En un vector estándar de C-Brick, hay cuatro sitios de reconocimiento Cpf1 - el prefijo (sitios T1 y T2) y el sufijo (sitios T3 y T4) - partes flanqueantes de ADN biológico. La escisión de los sitios T2 y T3 produce extremos pegajosos complementarios, que permiten el ensamblaje de partes de ADN con sitios T2 y T3. Mientras tanto, se genera una cicatriz corta &quot;GGATCC&quot; entre las piezas después del montaje. Como el plásmido recién formado contiene de nuevo los cuatro sitios de escisión de Cpf1, el método permite el ensamblaje iterativo de partes de ADN, que es similar a las de los patrones de BioBrick y BglBrick. Un procedimiento que describe el uso de la norma C-Brick para ensamblar partes de ADNSe describe aquí. El estándar de C-Brick puede ser ampliamente utilizado por científicos, estudiantes de posgrado y de pregrado, e incluso aficionados.

<html> Este protocolo demostró el ensamblaje de tres casetes de cromoproteína (cjBlue (BBa_K592011), eforRed (BBa_K592012), y amilGFP (BBa_K592010)). En primer lugar, las secuencias codificantes de los tres genes y terminadores mencionados anteriormente se clonaron individualmente en un vector estándar de C-Brick. Partes cortas de ADN, promotor y terminador, se introdujeron en el vector C-Brick mediante amplificación por PCR usando cebadores que contenían las partes cortas de ADN en ...

Watch this Scientific Journal Video about Protocols for C-Brick DNA Standard Assembly Using Cpf1 at JoVE.com

Protocols for C-Brick DNA Standard Assembly Using Cpf1

La proteína Cpf1 asociada con CRISPR puede ser guiada por un ARN CRISPR (crRNA) especialmente diseñado para escindir ADN de doble hebra en los sitios deseados, generando extremos pegajosos. Basándose en esta característica, se estableció un estándar de ensamblaje de ADN (C-Brick), y se describe aquí un protocolo que detalla su uso.

Protocolos para el ensamblaje estándar de ADN de C-Brick usando Cpf1

CRISPR-associated protein Cpf1 cleaves double-stranded DNA under the guidance of CRISPR RNA (crRNA), generating sticky ends. Because of this ...

protocols-for-c-brick-dna-standard-assembly-using-cpf1

Universidad de Cartagena UDEC

Research

JoVE Journal

Genetics

8.2K vistas.  Chinese Academy of Sciences.  La proteína Cpf1 asociada con CRISPR puede ser guiada por un ARN CRISPR (crRNA) especialmente diseñado para escindir ADN de doble hebra en los sitios deseados, generando extremos pegajosos. Basándose en esta característica, se estableció un estándar de ensamblaje de ADN (C-Brick), y se describe aquí un protocolo que detalla su uso. 

Video: Protocols for C-Brick DNA Standard Assembly Using Cpf1

Methyl-binding DNA capture Sequencing for Patient Tissues

Methylation is one of the essential epigenetic modifications to the DNA, which is responsible for the precise regulation of genes required for stable development and differentiation of different tissue types. Dysregulation of this process is often the hallmark of various diseases like cancer. Here, we outline one of the recent sequencing techniques, Methyl-Binding DNA Capture sequencing (MBDCap-seq), used to quantify methylation in various normal and disease tissues for large patient cohorts. We describe a detailed protocol of this affinity enrichment approach along with a bioinformatics pipeline to achieve optimal quantification. This technique has been used to sequence hundreds of patients across various cancer types as a part of the 1,000 methylome project (Cancer Methylome System).

Here we present a protocol to investigate genome wide DNA methylation in large scale clinical patient screening studies using the Methyl-Binding DNA Capture sequencing (MBDCap-seq or MBD-seq) technology and the subsequent bioinformatics analysis pipeline.

Secuenciación de captura de ADN de unión a metil-para tejidos del paciente

Methylation is one of the essential epigenetic modifications to the DNA, which is responsible for the precise regulation of genes required for stable ...

Investigación

Genética

Determination of the Optimal Chromosomal Location(s) for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach

The optimal chromosomal position(s) of a given DNA element was/were determined by transposon-mediated random insertion followed by fitness selection. In bacteria, the impact of the genetic context on the function of a genetic element can be difficult to assess. Several mechanisms, including topological effects, transcriptional interference from neighboring genes, and/or replication-associated gene dosage, may affect the function of a given genetic element. Here, we describe a method that permits the random integration of a DNA element into the chromosome of Escherichia coli and select the most favorable locations using a simple growth competition experiment. The method takes advantage of a well-described transposon-based system of random insertion, coupled with a selection of the fittest clone(s) by growth advantage, a procedure that is easily adjustable to experimental needs. The nature of the fittest clone(s) can be determined by whole-genome sequencing on a complex multi-clonal population or by easy gene walking for the rapid identification of selected clones. Here, the non-coding DNA region DARS2, which controls the initiation of chromosome replication in E. coli, was used as an example. The function of DARS2 is known to be affected by replication-associated gene dosage; the closer DARS2 gets to the origin of DNA replication, the more active it becomes. DARS2 was randomly inserted into the chromosome of a DARS2-deleted strain. The resultant clones containing individual insertions were pooled and competed against one another for hundreds of generations. Finally, the fittest clones were characterized and found to contain DARS2 inserted in close proximity to the original DARS2 location.

Determination of the Optimal Chromosomal Locations for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach

Here, the power of a transposon-mediated random insertion of a non-coding DNA element was used to resolve its optimal chromosomal position.

Determinación de la óptima Localización cromosómica de un elemento de DNA en Escherichia coli utilizando un nuevo enfoque mediada por transposones

The optimal chromosomal position(s) of a given DNA element was/were determined by transposon-mediated random insertion followed by fitness selection. In ...

Immunostaining for DNA Modifications: Computational Analysis of Confocal Images

For several decades, 5-methylcytosine (5mC) has been thought to be the only DNA modification with a functional significance in metazoans. The discovery of enzymatic oxidation of 5mC to 5-hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC) and 5-carboxylcytosine (5caC) as well as detection of N6-methyladenine (6mA) in the DNA of multicellular organisms provided additional degrees of complexity to the epigenetic research. According to a growing body of experimental evidence, these novel DNA modifications may play specific roles in different cellular and developmental processes. Importantly, as some of these marks (e. g. 5hmC, 5fC and 5caC) exhibit tissue- and developmental stage-specific occurrence in vertebrates, immunochemistry represents an important tool allowing assessment of spatial distribution of DNA modifications in different biological contexts. Here the methods for computational analysis of DNA modifications visualized by immunostaining followed by confocal microscopy are described. Specifically, the generation of 2.5 dimension (2.5D) signal intensity plots, signal intensity profiles, quantification of staining intensity in multiple cells and determination of signal colocalization coefficients are shown. Collectively, these techniques may be operational in evaluating the levels and localization of these DNA modifications in the nucleus, contributing to elucidating their biological roles in metazoans.

Newly discovered oxidized forms of 5-methylcytosine (oxi-mCs), 5-hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC) and 5-carboxylcytosine (5caC) may represent distinct DNA modifications with unique functional roles. Here a semi-quantitative workflow for visualization of oxi-mCs' spatial distribution, signal intensity profiling and colocalization is described.

Immunostaining para modificaciones de ADN: análisis computacional de imágenes confocales

For several decades, 5-methylcytosine (5mC) has been thought to be the only DNA modification with a functional significance in metazoans. The discovery of ...

Profiling DNA Replication Timing Using Zebrafish as an In Vivo Model System

DNA replication timing is an important cellular characteristic, exhibiting significant relationships with chromatin structure, transcription, and DNA mutation rates. Changes in replication timing occur during development and in cancer, but the role replication timing plays in development and disease is not known. Zebrafish were recently established as an in vivo model system to study replication timing. Here is detailed the protocols for using the zebrafish to determine DNA replication timing. After sorting cells from embryos and adult zebrafish, high-resolution genome-wide DNA replication timing patterns can be constructed by determining changes in DNA copy number through analysis of next generation sequencing data. The zebrafish model system allows for evaluation of the replication timing changes that occur in vivo throughout development, and can also be used to assess changes in individual cell types, disease models, or mutant lines. These methods will enable studies investigating the mechanisms and determinants of replication timing establishment and maintenance during development, the role replication timing plays in mutations and tumorigenesis, and the effects of perturbing replication timing on development and disease.

Profiling DNA Replication Timing Using Zebrafish as an In Vivo Model System

Zebrafish were recently used as an in vivo model system to study DNA replication timing during development. Here is detailed the protocols for using zebrafish embryos to profile replication timing. This protocol can be easily adapted to study replication timing in mutants, individual cell types, disease models, and other species.

Perfiles de sincronización de replicación de ADN utilizando el pez cebra como un sistema de modelo en Vivo

DNA replication timing is an important cellular characteristic, exhibiting significant relationships with chromatin structure, transcription, and DNA ...

Investigation of Protein Recruitment to DNA Lesions Using 405 Nm Laser Micro-irradiation

The DNA Damage Response (DDR) uses a plethora of proteins to detect, signal, and repair DNA lesions. Delineating this response is critical to understand genome maintenance mechanisms. Since recruitment and exchange of proteins at lesions are highly dynamic, their study requires the ability to generate DNA damage in a rapid and spatially-delimited manner. Here, we describe procedures to locally induce DNA damage in human cells using a commonly available laser-scanning confocal microscope equipped with a 405 nm laser line. Accumulation of genome maintenance factors at laser stripes can be assessed by immunofluorescence (IF) or in real-time using proteins tagged with fluorescent reporters. Using phosphorylated histone H2A.X (&#947;-H2A.X) and Replication Protein A (RPA) as markers, the method provides sufficient resolution to discriminate locally-recruited factors from those that spread on adjacent chromatin. We further provide ImageJ-based scripts to efficiently monitor the kinetics of protein relocalization at DNA damage sites. These refinements greatly simplify the study of the DDR dynamics.

Studying DNA damage repair kinetics requires a system to induce lesions at defined sub-nuclear regions. We describe a method to create localized double-stranded breaks using a laser-scanning confocal microscope equipped with a 405 nm laser and provide automated procedures to quantify the dynamics of repair factors at these lesions.

Investigación de reclutamiento de la proteína a las lesiones del ADN usando 405 Nm láser Micro-irradiación

The DNA Damage Response (DDR) uses a plethora of proteins to detect, signal, and repair DNA lesions. Delineating this response is critical to understand ...

Rare Event Detection Using Error-corrected DNA and RNA Sequencing

Conventional next-generation sequencing techniques (NGS) have allowed for immense genomic characterization for over a decade. Specifically, NGS has been used to analyze the spectrum of clonal mutations in malignancy. Though far more efficient than traditional Sanger methods, NGS struggles with identifying rare clonal and subclonal mutations due to its high error rate of ~0.5&#8211;2.0%. Thus, standard NGS has a limit of detection for mutations that are &#62;0.02 variant allele fraction (VAF). While the clinical significance for mutations this rare in patients without known disease remains unclear, patients treated for leukemia have significantly improved outcomes when residual disease is &#60;0.0001 by flow cytometry. In order to mitigate this artefactual background of NGS, numerous methods have been developed. Here we describe a method for Error-corrected DNA and RNA Sequencing (ECS), which involves tagging individual molecules with both a 16 bp random index for error-correction and an 8 bp patient-specific index for multiplexing. Our method can detect and track clonal mutations at variant allele fractions (VAFs) two orders of magnitude lower than the detection limit of NGS and as rare as 0.0001 VAF.

Next-generation sequencing (NGS) is a powerful tool for genomic characterization that is limited by the high error rate of the platform (~0.5&#8211;2.0%). We describe our methods of error-corrected sequencing that allow us to obviate the NGS error rate and detect mutations at variant allele fractions as rare as 0.0001.

Detección de eventos raros usando ADN Error corregido y secuenciación de ARN

Conventional next-generation sequencing techniques (NGS) have allowed for immense genomic characterization for over a decade. Specifically, NGS has been ...

Methodology for Accurate Detection of Mitochondrial DNA Methylation

Quantification of DNA methylation can be achieved using bisulfite sequencing, which takes advantage of the property of sodium bisulfite to convert unmethylated cytosine into uracil, in a single-stranded DNA context. Bisulfite sequencing can be targeted (using PCR) or performed on the whole genome and provides absolute quantification of cytosine methylation at the single base-resolution. Given the distinct nature of nuclear- and mitochondrial DNA, notably in the secondary structure, adaptions of bisulfite sequencing methods for investigating cytosine methylation in mtDNA should be made. Secondary and tertiary structure of mtDNA can indeed lead to bisulfite sequencing artifacts leading to false-positives due to incomplete denaturation poor access of bisulfite to single-stranded DNA. Here, we describe a protocol using an enzymatic digestion of DNA with BamHI coupled with bioinformatic analysis pipeline to allow accurate quantification of cytosine methylation levels in mtDNA. In addition, we provide guidelines for designing the bisulfite sequencing primers specific to mtDNA, in order to avoid targeting undesirable NUclear MiTochondrial segments (NUMTs) inserted into the nuclear genome.

Here, we present a protocol to allow accurate quantification of mitochondrial DNA (mtDNA) methylation. In this protocol, we describe an enzymatic digestion of DNA with BamHI coupled with a bioinformatic analysis pipeline which can be used to avoid overestimation of mtDNA methylation levels caused by the secondary structure of mtDNA.

Metodología para la detección exacta de la metilación del ADN mitocondrial

Quantification of DNA methylation can be achieved using bisulfite sequencing, which takes advantage of the property of sodium bisulfite to convert ...

A Customizable Protocol for String Assembly gRNA Cloning (STAgR)

The bacterial CRISPR/Cas9 system has substantially increased methodological options for life scientists. Due to its utilization, genetic and genomic engineering became applicable to a large range of systems. Moreover, many transcriptional and epigenomic engineering approaches are now generally feasible for the first time. One reason for the broad applicability of CRISPR lies in its bipartite nature. Small gRNAs determine the genomic targets of the complex, variants of the protein Cas9, and the local molecular consequences. However, many CRISPR approaches depend on the simultaneous delivery of multiple gRNAs into individual cells. Here, we present a customizable protocol for string assembly gRNA cloning (STAgR), a method that allows the simple, fast and efficient generation of multiplexed gRNA expression vectors in a single cloning step. STAgR is cost-effective, since (in this protocol) the individual targeting sequences are introduced by short overhang primers while the long DNA templates of the gRNA expression cassettes can be re-used multiple times. Moreover, STAgR allows single step incorporation of a large number of gRNAs, as well as combinations of different gRNA variants, vectors and promoters.

A Customizable Protocol for String Assembly gRNA Cloning STAgR

Here, we present string assembly gRNA cloning (STAgR), a method to easily multiplex gRNA vectors for CRISPR/Cas9 approaches. STAgR makes gRNA multiplexing simple, efficient and customizable.

Un protocolo adaptable para cadena montaje gRNA clonación (fantasía STAgR)

The bacterial CRISPR/Cas9 system has substantially increased methodological options for life scientists. Due to its utilization, genetic and genomic ...

Assessing Stem Cell DNA Integrity for Cardiac Cell Therapy

Stem and stem-cell-derived cells have immense potential as a regenerative therapy for various degenerative diseases. DNA is the storehouse of genetic data in all cells, including stem cells, and its integrity is fundamental to its regenerative ability. Stem cells undergo rapid propagation in labs to achieve the necessary numbers for transplantation. Accelerated cell growth leads to the loss of DNA integrity by accumulated metabolites, such as reactive oxygen, carbonyl, and alkylating agents. Transplanting these cells would result in poor engraftment and regeneration of the deteriorating organ. Moreover, transplanting DNA-damaged cells leads to mutations, DNA instability, cellular senescence, and possibly, life-threatening diseases such as cancer. Therefore, there is an immediate need for a quality control method to evaluate the cell's suitability for transplantation. Here, we provide step-by-step protocols for the assessment of the DNA integrity of stem cells prior to cell transplantation.

Here, we provide a detailed description of an experimental setup for an analysis of the assessment of DNA integrity in stem cells prior to cell transplantation.

Evaluar la integridad del ADN de la célula de vástago para terapia celular cardiaca

Stem and stem-cell-derived cells have immense potential as a regenerative therapy for various degenerative diseases. DNA is the storehouse of genetic data ...

High-Throughput DNA Plasmid Multiplexing and Transfection Using Acoustic Nanodispensing Technology

Cell transfection, indispensable for many biological studies, requires controlling many parameters for an accurate and successful achievement. Most often performed at low throughput, it is moreover time-consuming and error-prone, even more so when multiplexing several plasmids. We developed an easy, fast, and accurate method to perform cell transfection in a 384-well plate layout using acoustic droplet ejection (ADE) technology. The nanodispenser device used in this study&#160;is based on this technology and allows precise nanovolume delivery at high speed from a source well plate to a destination one. It can dispense and multiplex DNA and transfection reagent according to a predesigned spreadsheet. Here we present an optimal protocol to perform ADE-based high-throughput plasmid transfection which makes it possible to reach an efficiency of up to 90% and a nearly 100% cotransfection in cotransfection experiments. We extend initial work by proposing a user-friendly spreadsheet-based macro, able to manage up to four plasmids/wells from a library containing up to 1,536 different plasmids, and a tablet-based pipetting guide application. The macro designs the necessary template(s) of the source plate(s) and generates the ready-to-use files for the nanodispenser and tablet-based application. The four-steps transfection protocol involves i) a diluent dispense with a classical liquid handler, ii) plasmid distribution and multiplexing, iii) a transfection reagent dispense by the nanodispenser, and iv) cell plating on the prefilled wells. The described software-based control of ADE plasmid multiplexing and transfection allows even nonspecialists in the field to perform a reliable cell transfection in a fast and safe way. This method enables rapid identification of optimal settings for a given cell type and can be transposed to higher-scale and manual approaches. The protocol eases applications, such as human ORFeome protein (set of open reading frames [ORFs] in a genome) expression or CRISPR-Cas9-based gene function validation, in nonpooled screening strategies.

This protocol describes high-throughput plasmid transfection of mammalian cells in a 384-well plate using acoustic droplet ejection technology. The time-consuming, error-prone DNA dispensing and multiplexing, but also the transfection reagent dispensing, are software-driven and performed by a nanodispenser device. The cells are then seeded in these prefilled wells.

Multiplexación y transfección de plasmión de ADN de alto rendimiento mediante tecnología de nanodispensación acústica

Cell transfection, indispensable for many biological studies, requires controlling many parameters for an accurate and successful achievement. Most often ...