Wir möchten, dass der verstorbene Dr. Paul H. Patterson für seine Beiträge zum Fortschritt der MIA-Modell zu ehren, Autismus und Schizophrenie-Forschung. Wir erkennen an Sarkis K. Mazmanian für seine große Unterstützung auf diesem Protokoll; Ruben M. Bayon, Yvette Garcia-Flores, Karen C. Lencioni und Leslie A. Neumann für administrative Unterstützung; Ali Khoshnan und Jan C. Ko für die Unterstützung bei der Verfilmung; Elaine Y. Hsiao und Natalia Malkova für ihre Beratung auf MIA Induktion; Jeffrey S. Cochrane, Joaquin Gutierrez, Kwan F. Lee, Jaime Rodriguez, Lorena C. Sandovals und Natalie A. Verduzco für ihre Fachtierhaltung. Diese Arbeit wurde durch das NIH Conte-Center-Preis (NIH 5P50MH086383-04, Paul H. Patterson) unterstützt; Autismus spricht (# 7670, Paul H. Patterson); Simons Foundation (# 322839, zu Sarkis K. Mazmanian); NIH Ausbildung Grant (NIH / NRSA T32GM07616 K.-HC); Caltech Sommer Wissenschaftliche Fellowship (SURF) (bis ZY); Amgen Scholars Program am California Institute of Technology (zu ZY); und Postdoctoral Fellowship from National Science Council, Taiwan (NSC 101-2917-I-564-039, W.-LW).

Alle Protokolle wurden im Rahmen der Genehmigung des California Institute of Technology Institutional Animal Care und Use Committee (IACUC) durchgeführt. 1. Vorbereitung für Timed-Paarung Paare <ol><li> Verwenden Sie mindestens sechs Dämme für Verhaltensexperimente und 3 für die Genexpressionsanalyse. HINWEIS: die doppelte Anzahl der geschätzten weiblichen Mäusen, da nur etwa 50% der Mäuse aus der timed-mating eingesteckt werden. </li><li> Verwenden weibliche Mäuse ohne vorherige Schwangerschaft und bei 8-16 Wochen alt sind. HINWEIS: Weibliche Mäuse, die vor sexuellen Kontakt mit männlichen Mäusen haben, aber noch nicht schwanger gewesen sind akzeptabel. </li><li> Haus der weiblichen Mäusen zusammen und legen Sie die Käfige nebeneinander, um ihre Östrocyclus zu synchronisieren. Verwenden Sie ein Standard-Mäuse Käfig mit einer Höhe von mehr als 5,5 Zoll und einer 75 Quadratzoll Innenboden Gehäuse von 5 erwachsenen Mäusen zu ermöglichen. Beschriften Sie jede weibliche Maus mit einem Ohr Schlag. </li></ol> 2. Einrichten Timed-mating Pair <ol><li> Stellen Sie die timed-Paarung 0-2 Stunden, bevor der Dunkel-Zyklus beginnt. Legen Sie zwei weibliche Mäuse in jedem Käfig. Nehmen Sie die Mäuse heraus und wiegen sie einzeln. Nehmen Sie das Körpergewicht der einzelnen weiblichen Maus. </li><li> Legen Sie eine männliche Maus in jedem Käfig mit den beiden weiblichen Mäusen. Verwenden trio Paarungs das väterliche Verwechselung Effekt zu minimieren. </li></ol> 3. Vaginalpfropfens Check (E0.5) <ol><li> Überprüfen Sie die weibliche Mäuse 0-4 Stunden nach der Dunkel-Zyklus endet. Heben Sie vorsichtig die weibliche Maus aus der Basis des Schwanzes und lassen Sie die Maus, um das Drahtgitter, Käfig oben oder Käfigrand zu greifen. </li><li> Suchen Sie nach Anzeichen von Vaginalpfropfens: Vaginalpfropfens ist eine sichtbare weißliche Masse in die vaginale Öffnung. Wenn der Stecker nicht offensichtlich ist, legen Sie vorsichtig mit einem 200 ul Pipettenspitze in die vaginale Öffnung. Widerstand von Koagulation bestätigt Vaginalpfropfens Bildung. Überprüfen Sie die Vaginalpfropfens einmal pro Tag. HINWEIS: Vaginal Stecker ist nur ein Hinweis darauf, dass der Kopulation, aufgetreten ist und daher nicht funktioniert guarantee Schwangerschaft. Vaginalpfropfens kann schwierig sein, in bestimmten Stämmen von Mäusen zu identifizieren. Wenden Sie sich an einen erfahrenen Mäuse Betreuer, die Genauigkeit der Stecker Identifizierung zu erhöhen. </li><li> Bewegen Sie die gesteckten Mäuse in einen neuen Käfig und Gruppe beherbergen sie. Definieren Sie den Tag der Vaginalpfropfens Aussehen wie embryonale 0,5 Tage (E0.5). </li></ol> 4. Auf E10.5-11.5, Check für Schwangerschaft <ol><li> Heben Sie vorsichtig die Basis des Schwanzes und lassen Sie die Maus, um das Drahtgitter, Käfig oben oder Käfigrand zu greifen. Beachten Sie die Bauchbereich auf Anzeichen einer Schwangerschaft zu überprüfen, zum Beispiel eine Ausbuchtung im Bauch (Abbildung 1). HINWEIS: Das Zeichen der Schwangerschaft ist immer deutlicher bei E11,5 als bei E10,5. </li><li> Wiegen Sie die Mäuse Schwangerschaft zu überprüfen. Die schwangere Maus wiegt im Allgemeinen ungefähr 20% schwerer bei E10.5 und 30% schwerer bei E12.5 im Vergleich zu einer nicht-schwangeren Maus (Abbildung 2). Einfamilienhaus die schwangere Mäuse in saubere Käfige. </li></ol> 5. 20 mg /kg Poly (I: C) Herstellung <ol><li> Verwenden Sie mindestens sechs Dämme pro Gruppe für Verhaltensexperimente und 3 pro Gruppe für die Genexpressionsanalyse. Bereiten Sie die entsprechende Menge an Poly (I: C) Lösung. </li><li> Wiegen Sie die poly (I: C) -Pulver in einem 50 ml konischen Röhrchen eine Endkonzentration von 40 mg / ml herzustellen. Um die Spannung, die durch Injektionsvolumen zu minimieren und zu standardisieren, injizieren 5 ul poly (I: C) Lösung pro Gramm Körpergewicht der Maus (5 &amp; mgr; l / g bzw. 5 ml / kg). Zu induzieren MIA injizieren wir 20 mg Poly (I: C) pro kg. HINWEIS: Die Konzentration von Poly (I: C) Lösung erforderlich ist (20 mg / kg) / (5 ml / kg) = 4 mg / ml. Da das poly (I: C) Pulver enthält 10% poly (I: C), benötigen wir eine Endkonzentration von (4 mg / ml) /0.1= 40 mg / ml Poly (I: C), um Lösung. ACHTUNG: Die Poly (I: C) Pulver ist sehr leicht. Achten Sie darauf, keine Pulver zu verlieren, während aus dem Spachtel auf den konischen Röhrchen übertragen. </li><li> Fügen Sie die entsprechenden Volumen von 0,9% Natriumchlorid (Kochsalzlösung) in den konischen Wannee und die Kappe schließen. Lösen Sie das Pulver durch sanft die Salztropfen über der Poly-Walzen (I: C) Pulver, bis die Lösung klar ist. Zentrifugieren Sie die konische Röhrchen bei 800 g für 1 min (3C). Filtern die poly (I: C) Lösung von 0,22-um-Filter. Übertragen die poly (I: C) Lösung eines 1,5 oder 2 ml Mikrozentrifugenröhrchen. Optional: ein Spektralphotometer Verwenden Sie das 260/280 Verhältnis des Poly (I: C) zu messen Lösung. Sicherstellen , dass das Verhältnis zwischen 1,54 bis 1,82 (3) , wie vom Hersteller beschrieben. HINWEIS: Die Kochsalzlösung verwendet Poly aufzulösen (I: C) Pulver und dienen als Kontroll Injektion sollte steril und pharmazeutischer Qualität sein. </li></ol> 6. Saline oder Poly (I: C) Injection auf E12.5 <ol><li> Wiegen Sie die Maus auf die Waage und steckte es wieder in den Käfig. Verwenden Sie die folgende Formel, um das Volumen der Injektion sowohl für Kochsalzlösung und Poly zu berechnen (I: C) Mäuse: Körpergewicht (g), multipliziert mit 5 = gewünschte Injektionsvolumen (ul). Verwenden Sie ein 0,3 ml insul(I: C) Lösung, beispielsweise 150 &amp; mgr; l für eine 30 g Maus in der Spritze das berechnete Volumen Kochsalzlösung oder 20 mg / kg Poly auszuarbeiten. </li><li> holen Sie vorsichtig die Maus durch die Basis des Schwanzes und legen Sie es auf der Oberseite des Käfigs. Behandeln Sie die Maus verwirrende Effekte sanft durch Stress ausgelöst zu vermeiden. Führen Sie die Nadel, Fase auf, bei etwa 20 ° gegenüber der Maus in die Mitte seiner beiden oberen Nippel (Abbildung 4), und injizieren , um die Kochsalzlösung oder Poly (I: C) Lösung. HINWEIS: Die Nadel sollte für jede Maus nach der Injektion ersetzt werden. </li><li> Platzieren Sie die Maus wieder in seinen Käfig. Legen Sie die Käfige in einer ruhigen, wenig Verkehr Zimmer, die anderen verwirrende Effekte zu vermeiden. </li></ol> 7. Der Tag nach Poly (I: C) Injektion (E13.5) <ol><li> Schauen Sie sich die injizierten Mäuse am folgenden Morgen. Verwenden Sie eine Skala Körpergewicht zu messen. HINWEIS: Poly (I: C) injiziert trächtige Mäuse gewinnen in der Regel weniger Gewicht als Salz Mäuse am Tag nach inj injiziertection. </li><li> Bitte nicht stören die Mäuse, bis die Nachkommen geboren werden. </li></ol> 8. Spur von MIA Nachkommen <ol><li> Um die verwirrende Wirkung von MIA Induktion zu minimieren, befolgen Sie die unten aufgeführten Richtlinien die Verwendung von MIA Nachkommen zu messen. <ol><li> Schließen Sie die Würfe von Frühgeborenen oder verzögerte Geburt, oder wenn die Wurfgröße kleiner als 5. </li><li> Euthanize die übermäßigen Welpen von CO 2 , wenn die Wurfgröße größer als 10 ist. </li></ol></li></ol> 9. Optional: Überprüfen Sie die akute Entzündungsantwort nach MIA <ol><li> Opfere die schwangere Mäuse 3 Stunden nach der Kochsalzlösung oder Poly (I: C) Injektion mit dem beschriebenen Verfahren in der Tierpflege Institution Ausschuss genehmigten Protokoll. HINWEIS: Cervical Dislokation wird oft bevorzugt , da sie die Wirkung von CO 2 / Euthanasie Medikamente auf dem Damm und embryo minimiert. </li><li> Sammeln Sie die Milz von den erwachsenen schwangeren Mäusen und zu isolieren, die Plazenta und fetale brain unter dem Stereomikroskop. <ol><li> Für Milz Sammlung, legen Sie die Maus auf die Dissektion Platte und 70% Ethanol auf den Bauchbereich der schwangeren Mäusen sprühen. ein Paar sterile Schere unter dem Brustkorb durch die Haut einen vertikalen Schnitt in der Mitte der Bauchbereich zu machen. </li><li> Die Milz liegt in der linken überlegen Bauch. Verwenden einer Pinzette, die Milz zu isolieren. Rollen Sie die Milz auf heikle Aufgabe Wischer, um das Fettgewebe um das Organ zu entfernen. Sammeln Sie in etwa 50 mg Milzgewebe und legen Sie sie einzeln in Eppendorf-Röhrchen mit 500 &amp; mgr; l RNA stabilisieren Puffer oder TRIzol zu Nukleinsäure-Abbau zu verhindern. Lagern Sie die Proben bei -80 ° C Gefrierschrank bis zur Verwendung. </li><li> Für Plazenta Sammlung, ziehen Sie vorsichtig die Gebärmutterhörner aus dem Körper. Legen Sie die Gebärmutterhörner in einer Petrischale gefüllt mit autoklavierten phosphatgepufferter Salzlösung (PBS) und lassen Sie die Schüssel auf dem Eis. Verwenden Sie zwei Zangen die Gebärmutterwand aufreißen und die Fruchtblase aus. <ol><li>Verwenden Sie vorsichtig die Pinzette die Fruchtblase zu öffnen, ohne die Plazenta und den Fötus schädigen. Trennen Sie die Plazenta von der Fötus und schneiden die Nabelschnur so nah an der Plazenta wie möglich. Entfernen Sie die Fruchtblase Trümmer aus der Plazenta. Legen Sie die Plazenta einzeln in Eppendorf-Röhrchen mit 500 &amp; mgr; l RNA-Puffer oder TRIzol stabilisieren. Lagern Sie die Probe bei -80 ° C Gefrierschrank bis zur Verwendung. </li></ol></li><li> Für fötale Gehirn Sammlung, Speicherung der Fötus in der RNA-Puffer von Schritt 9.2.2 bis Dissektion stabilisieren. Necken die pialen Membran aus dem Ventrikel des Gehirns mit zarten # 5 Pinzette unter dem Stereomikroskop ab. Entfernen Sie vorsichtig alle die Membran von der fetalen Gehirns. Legen Sie die fötale Gehirn einzeln in Eppendorf-Röhrchen mit 500 &amp; mgr; l RNA-Puffer oder TRIzol stabilisieren. Lagern Sie die Probe bei -80 ° C Gefrierschrank bis zur Verwendung. </li></ol></li><li> Extrahieren Sie die RNA aus dem Gewebe und wandeln die RNA in cDNA. Analysieren Sie den IL - 6 - Gen - Expression in der cDNA durch real-time PCR. </li><li> Extrahieren Sie die RNA aus den Geweben durch Befolgen der Herstellung Protokoll TRIzol. Wenn die Gewebe in RNA Stabilisierungspuffer gespeichert. Tauen Sie die Probe und drehen Sie den Puffer nach unten. Übertragen Sie das Gewebe durch die Spitze auf einen anderen eppendorf mit 500 ul TRIzol und RNA-Extraktion fortzusetzen. </li><li> Verwenden Sie ein Spektralfotometer, die Konzentration, 260/280 und 260/230 Verhältnis der RNA zu messen. Sicherstellen, dass die Verhältnisse über 2,0 sind. </li><li> Beseitigen die DNA Kontamination durch behandelt, um die RNA mit DNase I. Mix 1 &amp; mgr; g RNA, 1 &amp; mgr; l 10X-Reaktionspuffer, 1 &amp; mgr; l RNase-Free DNase und Nuklease-freies Wasser bis zu einem Endvolumen von 10 &amp; mgr; l. Inkubieren des Mastermix bei 37 ° C für 30 min. 1 &amp; mgr; l DNase Stop-Lösung, um die Reaktion zu beenden. Inkubieren der Mischung bei 65 ° C für 10 min. </li><li> Kehrt die RNA in cDNA transkribiert. Verwenden 20 ul-Reaktionen und bis zu 1 &amp; mgr; g Gesamt-RNA pro Reaktion. Mix 4 ul 5x Transkription (RT) Reaktionsmischung Puffer umkehren, 1 &amp; mgr; l reverse Transkriptase, 11 &amp; mgr; l RNA - Matrize nach der Behandlung mit DNase I und 4 &amp; mgr; l Nuklease-freies H 2 O , um eine endgültige 20 &amp; mgr; l Lösung herzustellen. Den Thermocycler Bedingungen für die RT. Ein allgemeiner Zustand sind: Schritt 1: 25 ° C für 5 min; Schritt 2: 42 ° C für 30 min; Schritt 3: 85 ° C für 5 min; Schritt 4: Halten bei 4 ° C. Verdünnen Sie die cDNA 5 mal. Für die kurzfristige Lagerung, speichern Sie die cDNA bei 4 ° C. Für die Langzeitlagerung gefrier die cDNA bei -20 ° C. </li><li> Analysieren Sie den IL - 6 - Gen - Expression in der cDNA durch real-time PCR und normalisieren die IL - 6 - Genexpression zu ß-Actin - Genexpression. <ol><li> Machen Sie einen Master - Mix für IL - 6 und β-Actin - Erkennung. Verwenden Sie 25 ul Reaktion, die Master - Mix für jedes Gen enthält 12,5 ul SYBR Green Mix, 0,5 ul 10 uM Vorwärtsprimer, 0,5 ul 10 uM Reverse - Primer und 6,5 ul Nuklease-freies H 2 O. </li><li> Platz 5 ul 5x verdünnt cDNA eint die Unterseite des Brunnens von optischen 96-Well-Reaktionsplatte. Je 20 ul Master-Mix in jede Vertiefung eine endgültige 25 &amp; mgr; l PCR-Mix zu machen. Verdreifachen jedes Gen für jede Probe. Verschließen Sie die Platte durch eine optische Klebefolie verwendet wird. Spin down die Platte bei 800 × g für 3 min bei 4 ° C Verwenden Sie das Standardprogramm von real-time PCR: Schritt 1: 50 ° C für 2 min; Schritt 2: 95 ° C für 10 min; Schritt 3: 40 Zyklen von 95 ° C für 15 sec und die Temperatur 60 ° C für 1 min. Fügen Sie einen zusätzlichen Schritt für -Dissoziationskurve. </li></ol></li></ol> Untersuchen 10. die Verhaltensauffälligkeiten in MIA Erwachsene Kinder (Optional): <ol><li> Führen Sie die Verhaltenstests im Alter von 8-12 Wochen. Ändern Sie den Käfig Bettwäsche mindestens 3 Tage vor dem Test. Akklimatisieren die Mäuse auf die Verhaltenstestraum mindestens 30 min vor dem Test. </li><li> Für Präpulsinhibition (PPI), hemmen die Mäuse in Plexiglaszylinder mit einem piezoelektrischen Sensor darunter. Akklimatisieren die Mäuse auf die PPIKammer für 5 min. Setzen Sie die Mäuse mit 6 Studien mit 120 dB weißes Rauschen (Schreckhaftigkeit). </li><li> Dann setzen die Mäuse mit randomisierten Mischungen von 14 Studien von Hintergrundgeräuschen, 14 Studien mit Startle, 14 Studien mit Prepuls 5 dB (5 dB höher als Hintergrundrauschen) + Startle (PPI5) und 14 Studien mit Prepuls 15 dB (15 dB höher als Hintergrundrauschen + Startle (PPI15). </li><li> Der Mittelwert der Schreckhaftigkeit für die ersten 6 Studien von 120 dB Studien. Der Mittelwert der Schreckhaftigkeit für die anderen einzelnen Stimulationen. Covert den Wert auf Präpulsinhibition durch (Startle - PPI5 oder PPI15) / Startle. </li><li> Für Open-Feldtest, legen Sie die Maus in die Ecke eines offenen Platz Arena (50 x 50 x 50 cm 3). Notieren Sie sich die Flugbahn der Maus für 10 min durch eine Decke montierten Kamera. Definieren Sie die Mitte der Arena als der mittleren Zone (17 x 17 cm 2). Quantifizieren Sie die zurückgelegte Strecke, Mittelzone Einträge und Zeit in Mittelzone verbracht manuell oder durch bildbasierte automatische Analyse-Software. </li&gt; <li> Für Marmor Vergraben Test akklimatisieren Sie die Maus auf einen Testkäfig mit Druck 5cm tief, sauber, Aspen Kiefer Betten für 10 min. Bringen Sie die Maus auf seine homecage. Sanft legen Sie 20 marineblau 1,5 cm Durchmesser Glasmurmeln in der Art und Weise von 4 x 5-Anordnung. Platzieren Sie die Maus zurück in den Testkäfig mit Murmeln für 10 min. Zählen Sie die Murmeln, die in der 10 min Prüfdauer begraben wurde. </li></ol> 11. Überprüfen Sie die Zerebelläre Neuropathologie in MIA Erwachsene Kinder (Optional): <ol><li> Euthanize die Saline und MIA erwachsenen Nachkommen von Betäubungsmittel. Perfundieren die Maus mit 50 ml PBS und anschließend 50 ml 4% Paraformaldehyd durch die Herz-Kreislauf-System. </li><li> Entfernen Sie das Gehirn sorgfältig und Postfix das Gehirn in 4% Paraformaldehyd über Nacht bei 4 ° C. Spülen Sie das Gehirn mit PBS dreimal und speichern das Gehirn in PBS mit 0,02% Natriumazid in einem 4 ° C Kühlschrank bis zur Verwendung. HINWEIS: Das nachfixiert Gehirn kann in PBS mit 0,02% sod gespeichert werdenium Azid im Kühlschrank für bis zu einem Monat. </li><li> Abschnitt das Gehirn in 50 &amp; mgr; m dünne Scheiben sagittal mit Vibratom. Sammeln Sie die Gehirnschnitte mit einem weichen Pinsel Stift. Beenden Sie die endogene Peroxidase-Aktivität durch die Abschnitte in 0,6% Wasserstoffperoxid für 30 Minuten bei Raumtemperatur inkubiert. </li><li> Inkubieren der Abschnitte in anti-Calbindin Antikörper in Blockierungspuffer (10% Ziegenserum mit 0,1% Triton X-100 und 0,02% Natriumazid in PBS) verdünnt, über Nacht bei Raumtemperatur. Dann Inkubieren der Abschnitte in entsprechende in biotinylierter sekundärer Antikörper verdünnt Puffer für 2 Stunden bei Raumtemperatur blockiert. </li><li> Inkubieren der Abschnitte in Avidin DH - biotinylierter Peroxidase-Komplex H-Puffer des Biotin für 1 Stunde bei Raumtemperatur zu detektieren. Entwickeln Sie die Abschnitte durch Peroxidase-Substrat mit dem Antigen zu visualisieren. Waschen der Schnitte mit PBS dreimal zwischen den Schritten. Montieren Sie die Schnitte auf Objektträger. Bild die Abschnitte unter dem Mikroskop. </li></ol&gt;

<ol>
	<li>Brown, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epidemiologic+studies+of+exposure+to+prenatal+infection+and+risk+of+schizophrenia+and+autism.">Epidemiologic studies of exposure to prenatal infection and risk of schizophrenia and autism.</a> Dev Neurobiol. 72 (10), 1272-1276 (2012).</li><li>Fatemi, S. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+viral+theory+of+schizophrenia+revisited:+abnormal+placental+gene+expression+and+structural+changes+with+lack+of+evidence+for+H1N1+viral+presence+in+placentae+of+infected+mice+or+brains+of+exposed+offspring.">The viral theory of schizophrenia revisited: abnormal placental gene expression and structural changes with lack of evidence for H1N1 viral presence in placentae of infected mice or brains of exposed offspring.</a> Neuropharmacology. 62 (3), 1290-1298 (2012).</li><li>Shi, L., Tu, N., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+influenza+infection+is+likely+to+alter+fetal+brain+development+indirectly:+the+virus+is+not+detected+in+the+fetus.">Maternal influenza infection is likely to alter fetal brain development indirectly: the virus is not detected in the fetus.</a> Int J Dev Neurosci. 23 (2-3), 299-305 (2005).</li><li>Knuesel, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+and+abnormal+brain+development+across+CNS+disorders.">Maternal immune activation and abnormal brain development across CNS disorders.</a> Nat Rev Neurol. 10 (11), 643-660 (2014).</li><li>Meyer, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prenatal+poly(i:C)+exposure+and+other+developmental+immune+activation+models+in+rodent+systems.">Prenatal poly(i:C) exposure and other developmental immune activation models in rodent systems.</a> Biol Psychiatry. 75 (4), 307-315 (2014).</li><li>Meyer, U., Feldon, J., Yee, B. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+review+of+the+fetal+brain+cytokine+imbalance+hypothesis+of+schizophrenia.">A review of the fetal brain cytokine imbalance hypothesis of schizophrenia.</a> Schizophr Bull. 35 (5), 959-972 (2009).</li><li>Boksa, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+prenatal+infection+on+brain+development+and+behavior:+a+review+of+findings+from+animal+models.">Effects of prenatal infection on brain development and behavior: a review of findings from animal models.</a> Brain Behav Immun. 24 (6), 881-897 (2010).</li><li>Hsiao, E. Y., McBride, S. W., Chow, J., Mazmanian, S. K., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+an+autism+risk+factor+in+mice+leads+to+permanent+immune+dysregulation.">Modeling an autism risk factor in mice leads to permanent immune dysregulation.</a> Proc Natl Acad Sci U S A. 109 (31), 12776-12781 (2012).</li><li>Ito, H. T., Smith, S. E., Hsiao, E., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+alters+nonspatial+information+processing+in+the+hippocampus+of+the+adult+offspring.">Maternal immune activation alters nonspatial information processing in the hippocampus of the adult offspring.</a> Brain Behav Immun. 24 (6), 930-941 (2010).</li><li>Smith, S. E., Li, J., Garbett, K., Mirnics, K., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+alters+fetal+brain+development+through+interleukin-6.">Maternal immune activation alters fetal brain development through interleukin-6.</a> J Neurosci. 27 (40), 10695-10702 (2007).</li><li>Shi, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+the+maternal+immune+system+alters+cerebellar+development+in+the+offspring.">Activation of the maternal immune system alters cerebellar development in the offspring.</a> Brain Behav Immun. 23 (1), 116-123 (2009).</li><li>Hsiao, E. Y., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+the+maternal+immune+system+induces+endocrine+changes+in+the+placenta+via+IL-6.">Activation of the maternal immune system induces endocrine changes in the placenta via IL-6.</a> Brain Behav Immun. 25 (4), 604-615 (2011).</li><li>Wu, W. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+interaction+between+maternal+immune+activation+and+alpha+7+nicotinic+acetylcholine+receptor+in+regulating+behaviors+in+the+offspring.">The interaction between maternal immune activation and alpha 7 nicotinic acetylcholine receptor in regulating behaviors in the offspring.</a> Brain Behav Immun. , (2015).</li><li>Garay, P. A., Hsiao, E. Y., Patterson, P. H., McAllister, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+causes+age-+and+region-specific+changes+in+brain+cytokines+in+offspring+throughout+development.">Maternal immune activation causes age- and region-specific changes in brain cytokines in offspring throughout development.</a> Brain Behav Immun. 31, 54-68 (2013).</li><li>Garbett, K. A., Hsiao, E. Y., Kalman, S., Patterson, P. H., Mirnics, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+maternal+immune+activation+on+gene+expression+patterns+in+the+fetal+brain.">Effects of maternal immune activation on gene expression patterns in the fetal brain.</a> Transl Psychiatry. 2, e98 (2012).</li><li>Hsiao, E. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbiota+modulate+behavioral+and+physiological+abnormalities+associated+with+neurodevelopmental+disorders.">Microbiota modulate behavioral and physiological abnormalities associated with neurodevelopmental disorders.</a> Cell. 155 (7), 1451-1463 (2013).</li><li>Naviaux, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antipurinergic+therapy+corrects+the+autism-like+features+in+the+poly(IC)+mouse+model.">Antipurinergic therapy corrects the autism-like features in the poly(IC) mouse model.</a> PLoS One. 8 (3), e57380 (2013).</li><li>Pratt, L., Ni, L., Ponzio, N. M., Jonakait, G. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+inflammation+promotes+fetal+microglial+activation+and+increased+cholinergic+expression+in+the+fetal+basal+forebrain:+role+of+interleukin-6.">Maternal inflammation promotes fetal microglial activation and increased cholinergic expression in the fetal basal forebrain: role of interleukin-6.</a> Pediatr Res. 74 (4), 393-401 (2013).</li><li>Schwartzer, J. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+and+strain+specific+interactions+in+the+development+of+autism-like+behaviors+in+mice.">Maternal immune activation and strain specific interactions in the development of autism-like behaviors in mice.</a> Transl Psychiatry. 3, e240 (2013).</li><li>Khan, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+effects+of+maternal+immune+activation+on+depression-like+behavior+in+the+mouse.">Long-term effects of maternal immune activation on depression-like behavior in the mouse.</a> Transl Psychiatry. 4, e363 (2014).</li><li>Workman, A. D., Charvet, C. J., Clancy, B., Darlington, R. B., Finlay, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+transformations+of+neurodevelopmental+sequences+across+mammalian+species.">Modeling transformations of neurodevelopmental sequences across mammalian species.</a> J Neurosci. 33 (17), 7368-7383 (2013).</li><li>Abazyan, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prenatal+interaction+of+mutant+DISC1+and+immune+activation+produces+adult+psychopathology.">Prenatal interaction of mutant DISC1 and immune activation produces adult psychopathology.</a> Biol Psychiatry. 68 (12), 1172-1181 (2010).</li><li>Meyer, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adult+behavioral+and+pharmacological+dysfunctions+following+disruption+of+the+fetal+brain+balance+between+pro-inflammatory+and+IL-10-mediated+anti-inflammatory+signaling.">Adult behavioral and pharmacological dysfunctions following disruption of the fetal brain balance between pro-inflammatory and IL-10-mediated anti-inflammatory signaling.</a> Mol Psychiatry. 13 (2), 208-221 (2008).</li><li>Vuillermot, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prenatal+immune+activation+interacts+with+genetic+Nurr1+deficiency+in+the+development+of+attentional+impairments.">Prenatal immune activation interacts with genetic Nurr1 deficiency in the development of attentional impairments.</a> J Neurosci. 32 (2), 436-451 (2012).</li><li>Bechard, A., Nicholson, A., Mason, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Litter+size+predicts+adult+stereotypic+behavior+in+female+laboratory+mice.">Litter size predicts adult stereotypic behavior in female laboratory mice.</a> J Am Assoc Lab Anim Sci. 51 (4), 407-411 (2012).</li><li>Harvey, L., Boksa, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+stereological+comparison+of+GAD67+and+reelin+expression+in+the+hippocampal+stratum+oriens+of+offspring+from+two+mouse+models+of+maternal+inflammation+during+pregnancy.">A stereological comparison of GAD67 and reelin expression in the hippocampal stratum oriens of offspring from two mouse models of maternal inflammation during pregnancy.</a> Neuropharmacology. 62 (4), 1767-1776 (2012).</li></ol>

The authors have nothing to disclose.

MIA Induktion zu unterschiedlichen Zeitfenstern stört unterschiedliche Entwicklung des Gehirns Ereignisse bei Nagern und folglich führt zu unterschiedlichen Verhaltensstörungen und Neuropathologien bei den Nachkommen. Hier beschrieben wir ein Protokoll zu induzieren MIA in Mäusen, die mit Poly (I: C) Injektion an E12.5. Diese Methode der MIA Induktion führt zu Verhaltens, neurologische, immunologische und Magen - Darm - Anomalien im Zusammenhang mit Autismus und Schizophrenie bei den Nachkommen 8,10,11,16.</su...

Das Konzept der mütterlichen Immunaktivierung (MIA) stammt aus den epidemiologischen Studien über die Assoziation der Infektion der Mutter mit Autismus und Schizophrenie 1. Aufgrund des Fehlens von nachweisbarem replizierenden viralen Pathogenen in der Plazenta oder fetalen Gehirn nach mütterlichen Virusinfektion 2,3, wird die Wirkung der Infektion auf die Nachkommen Hypothese eher durch die Aktivierung des mütterlichen Immunsystem verursacht werden , als die Pathogene selbst . Polycytidylsäure: Um die Ursache-Wirkungs-Beziehung zwischen MIA und psychiatrischen Störungen, die Injektion von chemisch synthetisierten, viral mimic doppelsträngige RNA polyinosinic aufzuklären (poly (I: C)) in schwangeren Nagetieren wurde als Tiermodell für MIA weit verbreitet 4,5. Poly (I: C) von Toll-like-Rezeptor erkannt wird 3 (TLR3) und die systemische Verabreichung von Poly (I: C) induziert viral wie akute Entzündungsreaktion. Einer der Mechanismen, durch die poly (I: C) produces Verhaltensstörungen und Neuropathologien bei den Nachkommen wird durch ein Ungleichgewicht von pro- und anti - inflammatorischen Zytokinen in der mütterlichen Plazenta-fetalen Achse 6 verursacht. Mehrere Gruppen haben die MIA - Modell angenommen , die Ätiologie von psychiatrischen Störungen 7 und aufgrund der unterschiedlichen Interessen zwischen Forschungsgruppen, verschiedenen Zeitpunkten der Immunaktivierung verwendet worden , um zu verstehen , 7 verschiedene Störungen auf die Entwicklung des Gehirns und das Verhalten zu erreichen. Das Paul H. Patterson Labor am California Institute of Technology nimmt die Strategie der Injektion von Poly (I: C) in trächtigen Mäusen an embryonalen 12,5 Tage (E12,5), die erfolgreich unter Beweis gestellt hat, dass MIA induzieren Verhaltens-, neurologische fähig ist, und immunologische Veränderungen bei den Nachkommen , die mit Autismus und Schizophrenie 8-11 verbunden sind. Unser Stand der Arbeiten zeigen , dass MIA Nachwuchs Verhaltensauffälligkeiten zeigen (zB soziale impairment, Kommunikationsdefizit, repetitive Verhalten, Angst-ähnliches Verhalten und latente Hemmung Defizit 8,10,12), Immundysregulation und Zytokine Ungleichgewicht 8,13,14, Veränderung des fötalen Gehirns Genexpression 15, Verlust der Purkinje - Zellen in Läppchen VII von Cerebellum 11, Veränderung der synaptischen Eigenschaften in Hippocampus 9, Gen - Umwelt - Interaktion x 13, Veränderung der Darmdurchlässigkeit und Darmmikrobiota Zusammensetzung 16. Darüber hinaus werden therapeutische und prophylaktische Strategien auch von diesem Modellsystem 13,16,17 entwickelt. Durch die Induktion MIA bei E12,5, andere haben gezeigt , dass MIA fötalen Mikrogliaaktivierung und cholinergen Entwicklungs Veränderung in basalen Vorderhirns 18, Stamm spezifische Wechselwirkung 19, Gehirn zerebralen synaptosomaler ultra Anomalien, zerebrale mitochondrialen Atmungskette Überfunktion abnormalties, Herabregulation der zerebralen synaptischen Moleküle 17 erzeugt .depressiv-ähnliche Verhaltensweisen, Beeinträchtigung der Kognition und des Hippocampus Langzeit - Potenzierung (LTP), und das Defizit von Erwachsenen Neurogenese im Hippocampus 20. Hier bieten wir eine detaillierte Methode, wie MIA zu induzieren bei E12,5 von Poly (I: C), sowie Paradigmen, wie dieses Modell anzuwenden, um die Entstehung von Autismus und Schizophrenie zu studieren. Es ist wichtig zu beachten , dass MIA ein Risikofaktor für eine Vielzahl von Erkrankungen ist 4, und dessen Ergebnisse sind extrem empfindlich gegenüber der Zeit und Methode der Induktion sowie die Haltung der trächtigen Muttertieren. Als solche auch kleinere Unstimmigkeiten zwischen den Laboratorien führen oft zu geringe Reproduzierbarkeit und / oder unterschiedlichen Phänotypen bei den Nachkommen. Unsere Methode ist für die Interessenten an einem Studium MIA als Umweltrisikofaktor für Autismus und Schizophrenie speziell entwickelt, und die detaillierte Beschreibung wird es den Forschern zur Verfügung gestellt helfen, die Reproduzierbarkeit ihrer Daten zu verbessern.

<table><tbody><tr><td>Polyinosinic&amp;ndash;polycytidylic acid potassium salt</td><td>SIGMA</td><td>P9582</td><td></td></tr><tr><td>0.9% sodium chloride INJ. USP</td><td>HOSPIRA</td><td>NDC 0409-4888-10</td><td></td></tr><tr><td>MONOJECT insuline syrinage 3/10 ml 29 G x 1/2&quot;</td><td>COVIDIEN</td><td>8881600145</td><td></td></tr><tr><td>50 ml conical screw cap tubes</td><td>USA SCIENTIFIC</td><td>1500-1211</td><td></td></tr><tr><td>Nanodrop 1000 spectrophotometer</td><td>THERMO SCIENTIFIC</td><td>1000</td><td>Optional</td></tr><tr><td>Stereomicroscope</td><td>Wild Heerbrugg</td><td>M5A</td><td>Optional</td></tr><tr><td>Dumont #5 Forceps Inox Tip Size .10 X .06 mm</td><td>Roboz</td><td>RS-5045</td><td>Optional</td></tr><tr><td>RNAlater RNA stabilization reagent</td><td>Qiagen</td><td>76104</td><td>Optional</td></tr><tr><td>TRIzol reagent</td><td>Life Technologies</td><td>15596-026&amp;nbsp;</td><td>Optional</td></tr><tr><td>RQ1 Rnase-free DNase</td><td>Promega</td><td>M610A</td><td>Optional</td></tr><tr><td>iScript cDNA synthesis kit</td><td>Bio-Rad</td><td>170-8891</td><td>Optional</td></tr><tr><td>FastStart universal SYBR green master mix with ROX&amp;nbsp;</td><td>Roche</td><td>4913922001</td><td>Optional</td></tr><tr><td>Real-time PCR</td><td>ABI</td><td>7300</td><td>Optional</td></tr><tr><td>Primer: Il6 forward</td><td>Life Technologies</td><td>TAGTCCTTCCTACCCCAATTTCC</td><td>Optional</td></tr><tr><td>Primer: Il6 Reverse</td><td>Life Technologies</td><td>TTGGTCCTTAGCCACTCCTTC</td><td>Optional</td></tr><tr><td>Primer: beta-actin forward</td><td>Life Technologies</td><td>AGAGGGAAATCGTGCGTGAC</td><td>Optional</td></tr><tr><td>Primer: beta-actin Reverse</td><td>Life Technologies</td><td>CAATAGTGATGACCTGGCCGT</td><td>Optional</td></tr><tr><td>MicroAmp optical 96-well reaction plate</td><td>Life Technologies</td><td>4306737</td><td>Optionl</td></tr><tr><td>MicroAmp optical adhesive film&amp;nbsp;</td><td>Life Technologies</td><td>4311971</td><td>Optionl</td></tr><tr><td>EthoVision</td><td>Noldus</td><td>EthoVision</td><td>Optionl</td></tr><tr><td>SR-LAB apparatus (PPI)</td><td>San Diego Instruments&amp;nbsp;</td><td>SR-LAB</td><td>Optionl</td></tr><tr><td>Marbles</td><td>PENN-PLAX</td><td>Blue gem stones marbles</td><td>Optionl</td></tr><tr><td>Dulbecco&#039;s Phosphate-Buffered Saline (DPBS)</td><td>Life Technologies</td><td>21600-069</td><td>Optionl</td></tr><tr><td>Paraformaldehyde</td><td>MACRON</td><td>2621-59</td><td>Optionl</td></tr><tr><td>Vibratome</td><td>Leica</td><td>VT1000 S</td><td>Optionl</td></tr><tr><td>Sodium azide</td><td>Sigma</td><td>S2002</td><td>Optionl</td></tr><tr><td>Triton x-100</td><td>Sigma</td><td>X100</td><td>Optionl</td></tr><tr><td>Hydrogen peroxide solution</td><td>Sigma</td><td>18312</td><td>Optionl</td></tr><tr><td>Goat serum</td><td>Vector Laboratories</td><td>S-1000</td><td>Optionl</td></tr><tr><td>Rabbit anti-calbindin antibody</td><td>Abcam</td><td>ab11426</td><td>Optionl</td></tr><tr><td>Biotinlyated goat anti-rabbit IgGantibody</td><td>Vector Laboratories</td><td>BA-1000</td><td>Optionl</td></tr><tr><td>VECTASTAIN ABC Kit</td><td>Vector Laboratories</td><td>PK-4000</td><td>Optionl</td></tr></tbody></table>

induction of maternal immune activation in mice at mid-gestation stage with viral mimic poly(i:c)

Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric disorders. Numerous studies have demonstrated that MIA model is able to show face, construct, and predictive validity that are relevant to autism and schizophrenia. To model MIA, investigators often use viral mimic polyinosinic:polycytidylic acid (poly(I:C)) to activate the immune system in pregnant rodents. Generally, the offspring from immune activated dam exhibit behavioral abnormalities and physiological alterations that are associated with autism and schizophrenia. However, poly(I:C) injection with different dosages and at different time points could lead to different outcomes by perturbing brain development at different stages. Here we provide a detailed method of inducing MIA by intraperitoneal (i.p.) injection of 20 mg/kg poly(I:C) at mid-gestational embryonic 12.5 days (E12.5). This method has been shown to induce acute inflammatory response in the maternal-placental-fetal axis, which ultimately results in the brain perturbations and behavioral phenotypes that are associated with autism and schizophrenia.

<html> Die Injektion von 20 mg / kg Poly (I: C) bei E12,5 konnte eine akute Entzündungsreaktion in der mütterlichen Plazenta-fetale Achse hervorrufen und eine chronische Wirkung auf die Entwicklung des Gehirns und Verhaltens - Phänotypen 12,13 auszufällen. Erhöhte Niveaus eines proinflammatorischen Cytokin, Interleukin (IL) -6, ist ein zuverlässiger Indikator einer akuten Entzündungsreaktion nach MIA. Die Spitzenzeit für IL6 Genexpression in der Plazenta und f?...

Watch this Scientific Journal Video about Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C at JoVE.com

Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C

Die Induktion der mütterliche Immunaktivierung bei Mäusen in der Mitte der Schwangerschaft Bühne mit Viral Mimic Poly (I: C)

Maternal immune activation (MIA) is a model for an environmental risk factor of autism and schizophrenia. The goal of this article is to provide a step-by-step procedure of how to induce MIA in the pregnant mice in order to enhance the reproducibility of this model.

Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric ...

induction-maternal-immune-activation-mice-at-mid-gestation-stage-with

Universidad de Cartagena UDEC

Research

JoVE Journal

Immunology and Infection

Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic Poly(I:C)

18.3K Aufrufe.  California Institute of Technology. Maternal immune activation (MIA) is a model for an environmental risk factor of autism and schizophrenia. The goal of this article is to provide a step-by-step procedure of how to induce MIA in the pregnant mice in order to enhance the reproducibility of this model.

Serie: Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C

A Mouse Model of in Utero Transplantation

The transplantation of stem cells and viruses in utero has tremendous potential for treating congenital disorders in the human fetus. For example, in utero transplantation (IUT) of hematopoietic stem cells has been used to successfully treat patients with severe combined immunodeficiency.1,2 In several other conditions, however, IUT has been attempted without success.3 Given these mixed results, the availability of an efficient non-human model to study the biological sequelae of stem cell transplantation and gene therapy is critical to advance this field. We and others have used the mouse model of IUT to study factors affecting successful engraftment of in utero transplanted hematopoietic stem cells in both wild-type mice4-7 and those with genetic diseases.8,9 The fetal environment also offers considerable advantages for the success of in utero gene therapy. For example, the delivery of adenoviral10, adeno-associated viral10, retroviral11, and lentiviral vectors12,13 into the fetus has resulted in the transduction of multiple organs distant from the site of injection with long-term gene expression. in utero gene therapy may therefore be considered as a possible treatment strategy for single gene disorders such as muscular dystrophy or cystic fibrosis. Another potential advantage of IUT is the ability to induce immune tolerance to a specific antigen. As seen in mice with hemophilia, the introduction of Factor IX early in development results in tolerance to this protein.14 
In addition to its use in investigating potential human therapies, the mouse model of IUT can be a powerful tool to study basic questions in developmental and stem cell biology. For example, one can deliver various small molecules to induce or inhibit specific gene expression at defined gestational stages and manipulate developmental pathways. The impact of these alterations can be assessed at various timepoints after the initial transplantation. Furthermore, one can transplant pluripotent or lineage specific progenitor cells into the fetal environment to study stem cell differentiation in a non-irradiated and unperturbed host environment.
The mouse model of IUT has already provided numerous insights within the fields of immunology, and developmental and stem cell biology. In this video-based protocol, we describe a step-by-step approach to performing IUT in mouse fetuses and outline the critical steps and potential pitfalls of this technique.

A Mouse Model of in Utero Transplantation

The mouse model of in utero transplantation is a versatile tool that can be used to study the potential clinical applications of stem cell transplantation and gene therapy in the fetus. In this protocol, we present a general approach to performing this technique

Einem Mausmodell der In Utero Transplantation

The transplantation of stem cells and viruses in utero has tremendous potential for treating congenital disorders in the human fetus.  For example, in ...

Forschung

Medizin

Assessment of Maternal Vascular Remodeling During Pregnancy in the Mouse Uterus

The placenta mediates the exchange of factors such as gases and nutrients between mother and fetus and has specific demands for supply of blood from the maternal circulation. The maternal uterine vasculature needs to adapt to this temporary demand and the success of this arterial remodeling process has implications for fetal growth. Cells of the maternal immune system, especially natural killer (NK) cells, play a critical role in this process. Here we describe a method to assess the degree of remodeling of maternal spiral arteries during mouse pregnancy. Hematoxylin and eosin-stained tissue sections are scanned and the size of the vessels analysed. As a complementary validation method, we also present a qualitative assessment for the success of the remodeling process by immunohistochemical detection of smooth muscle actin (SMA), which normally disappears from within the arterial vascular media at mid-gestation. Together, these methods enable determination of an important parameter of the pregnancy phenotype. These results can be combined with other endpoints of mouse pregnancy to provide insight into the mechanisms underlying pregnancy-related complications.

This protocol describes a technique to assess changes in the maternal vasculature during pregnancy in mice. Using stereological methods, remodeling of the decidual spiral arteries is assessed quantitatively and the results confirmed qualitatively using immunohistochemistry.

Beurteilung der Maternal Vascular Remodeling während der Schwangerschaft in der Gebärmutter Maus

The placenta mediates the exchange of factors such as gases and nutrients between mother and fetus and has specific demands for supply of blood from the ...

Entwicklungsbiologie

Use of In vivo Imaging to Monitor the Progression of Experimental Mouse Cytomegalovirus Infection in Neonates

Human Cytomegalovirus (HCMV or HHV-5) is a life-threatening pathogen in immune-compromised individuals. Upon congenital or neonatal infection, the virus can infect and replicate in the developing brain, which may induce severe neurological damage, including deafness and mental retardation. Despite the potential severity of the symptoms, the therapeutic options are limited by the unavailability of a vaccine and the absence of a specific antiviral therapy. Furthermore, a precise description of the molecular events occurring during infection of the central nervous system (CNS) is still lacking since observations mostly derive from the autopsy of infected children. Several animal models, such as rhesus macaque CMV, have been developed and provided important insights into CMV pathogenesis in the CNS. However, despite its evolutionary proximity with humans, this model was limited by the intracranial inoculation procedure used to infect the animals and consistently induce CNS infection. Furthermore, ethical considerations have promoted the development of alternative models, among which neonatal infection of newborn mice with mouse cytomegalovirus (MCMV) has recently led to significant advances. For instance, it was reported that intraperitoneal injection of MCMV to Balb/c neonates leads to infection of neurons and glial cells in specific areas of the brain. These findings suggested that experimental inoculation of mice might recapitulate the deficits induced by HCMV infection in children. Nevertheless, a dynamic analysis of MCMV infection of neonates is difficult to perform because classical methodology requires the sacrifice of a significant number of animals at different time points to analyze the viral burden and/or immune-related parameters. To circumvent this bottleneck and to enable future investigations of rare mutant animals, we applied in vivo imaging technology to perform a time-course analysis of the viral dissemination in the brain upon peripheral injection of a recombinant MCMV expressing luciferase to C57Bl/6 neonates.

Use of In vivo Imaging to Monitor the Progression of Experimental Mouse Cytomegalovirus Infection in Neonates

Human Cytomegalovirus (HCMV) infection of neonates represents an important cause of mental retardation, yet the molecular events leading to virus-induced pathogenesis are still poorly understood. To investigate the dynamics of brain infection, we adapted whole-animal in vivo imaging to perform time-course analysis of neonates infected with a luciferase-recombinant virus.

Verwenden Sie von<em&gt; In vivo</em&gt; Imaging zur Überwachung der Progression of Experimental Maus Cytomegalovirus-Infektion bei Neugeborenen

Human Cytomegalovirus (HCMV or HHV-5) is a life-threatening  pathogen in immune-compromised individuals. Upon congenital or neonatal  infection, the virus ...

Immunologie und Infektion

Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production

In response to a viral infection, the host innate immune response is activated to up-regulate gene expression and production of antiviral cytokines. Conversely, viruses have evolved intricate strategies to evade and exploit host immune signaling for survival and propagation. Viral immune evasion, entailing host defense and viral evasion, provides one of the most fascinating and dynamic interfaces to discern the host-virus interaction. These studies advance our understanding in innate immune regulation and pave our way to develop novel antiviral therapies.
Murine &#947;HV68 is a natural pathogen of murine rodents. &#947;HV68 infection of mice provides a tractable small animal model to examine the antiviral response to human KSHV and EBV of which perturbation of in vivo virus-host interactions is not applicable. Here we describe a protocol to determine the antiviral cytokine production. This protocol can be adapted to other viruses and signaling pathways.
Recently, we have discovered that &#947;HV68 hijacks MAVS and IKK&#946;, key innate immune signaling components downstream of the cytosolic RIG-I and MDA5, to abrogate NF&#922;B activation and antiviral cytokine production. Specifically, &#947;HV68 infection activates IKK&#946; and that activated IKK&#946; phosphorylates RelA to accelerate RelA degradation. As such, &#947;HV68 efficiently uncouples NF&#922;B activation from its upstream activated IKK&#946;, negating antiviral cytokine gene expression. This study elucidates an intricate strategy whereby the upstream innate immune activation is intercepted by a viral pathogen to nullify the immediate downstream transcriptional activation and evade antiviral cytokine production.

We describe a protocol to measure the antiviral cytokine production in mice infected with a model herpesvirus, murine gamma herpesvirus 68 (&#947;HV68) that is closely-related to human Kaposi&#8217;s sarcoma-associated herpesvirus (KSHV) and Epstein-Barr virus (EBV). Utilizing genetically modified mouse strains and mouse embryonic fibroblasts (MEFs), we assessed the antiviral cytokine production both in vivo and ex vivo. &#8220;Reconstituting&#8221; the expression of innate immune components in knockout embryonic fibroblasts by lentiviral transduction, we further pinpoint specific innate immune molecules and dissect the key signaling events that differentially regulate the antiviral cytokine production.

Zergliedern Angeborene Immunsystem Signaling in Viral Evasion von Zytokin-Produktion

In response to a viral infection, the host innate immune response is activated to up-regulate gene expression and production of antiviral cytokines. ...

Mouse In Vivo Placental Targeted CRISPR Manipulation

The placenta is an essential organ that regulates and maintains mammalian development in utero. The placenta is responsible for the transfer of nutrients and waste between the mother and fetus and the production and delivery of growth factors and hormones. Placental genetic manipulations in mice are critical for understanding the placenta's specific role in prenatal development. Placental-specific Cre-expressing transgenic mice have varying effectiveness, and other methods for placental gene manipulation can be useful alternatives. This paper describes a technique to directly alter placental gene expression using CRISPR gene manipulation, which can be used to modify the expression of targeted genes. Using a relatively advanced surgical approach, pregnant dams undergo a laparotomy on embryonic day 12.5 (E12.5), and a CRISPR plasmid is delivered by a glass micropipette into the individual placentas. The plasmid is immediately electroporated after each injection. After dam recovery, the placentas and embryos can continue development until assessment at a later time point. The evaluation of the placenta and offspring after the use of this technique can determine the role of time-specific placental function in development. This type of manipulation will allow for a better understanding of how placental genetics and function impact fetal growth and development in multiple disease contexts.

Mouse In Vivo Placental Targeted CRISPR Manipulation

Here we describe a time-specific method to effectively manipulate critical developmental pathways in the mouse placenta in vivo. This is performed through the injection and electroporation of CRISPR plasmids into the placentas of pregnant dams on embryonic day 12.5.

Maus-In-vivo-Plazenta-gezielte CRISPR-Manipulation

The placenta is an essential organ that regulates and maintains mammalian development in utero. The placenta is responsible for the transfer of nutrients ...

Genetik

Isolation of Leukocytes from the Murine Tissues at the Maternal-Fetal Interface

Immune tolerance in pregnancy requires that the immune system of the mother undergoes distinctive changes in order to accept and nurture the developing fetus. This tolerance is initiated during coitus, established during fecundation and implantation, and maintained throughout pregnancy. Active cellular and molecular mediators of maternal-fetal tolerance are enriched at the site of contact between fetal and maternal tissues, known as the maternal-fetal interface, which includes the placenta and the uterine and decidual tissues. This interface is comprised of stromal cells and infiltrating leukocytes, and their abundance and phenotypic characteristics change over the course of pregnancy. Infiltrating leukocytes at the maternal-fetal interface include neutrophils, macrophages, dendritic cells, mast cells, T cells, B cells, NK cells, and NKT cells that together create the local micro-environment that sustains pregnancy. An imbalance among these cells or any inappropriate alteration in their phenotypes is considered a mechanism of disease in pregnancy. Therefore, the study of leukocytes that infiltrate the maternal-fetal interface is essential in order to elucidate the immune mechanisms that lead to pregnancy-related complications. Described herein is a protocol that uses a combination of gentle mechanical dissociation followed by a robust enzymatic disaggregation with a proteolytic and collagenolytic enzymatic cocktail to isolate the infiltrating leukocytes from the murine tissues at the maternal-fetal interface. This protocol allows for the isolation of high numbers of viable leukocytes (&#62;70%) with sufficiently conserved antigenic and functional properties. Isolated leukocytes can then be analyzed by several techniques, including immunophenotyping, cell sorting, imaging, immunoblotting, mRNA expression, cell culture, and in vitro functional assays such as mixed leukocyte reactions, proliferation, or cytotoxicity assays.

Described herein is a protocol to isolate and analyze the infiltrating leukocytes of tissues at the maternal-fetal interface (uterus, decidua, and placenta) of mice. This protocol maintains the integrity of most cell surface markers and yields enough viable cells for downstream applications including flow cytometry analysis.

Isolierung von Leukozyten aus dem Mausgeweben an der Maternal-Fetal-Schnittstelle

Immune tolerance in pregnancy requires that the immune system of the mother undergoes distinctive changes in order to accept and nurture the developing ...

Intracerebroventricular and Intravascular Injection of Viral Particles and Fluorescent Microbeads into the Neonatal Brain

In the study on the pathogenesis of viral encephalitis, the infection method is critical. The first of the two main infectious routes to the brain is the hematogenous route, which involves infection of the endothelial cells and pericytes of the brain. The second is the intracerebroventricular (ICV) route. Once within the central nervous system (CNS), viruses may spread to the subarachnoid space, meninges, and choroid plexus via the cerebrospinal fluid. In experimental models, the earliest stages of CNS viral distribution are not well characterized, and it is unclear whether only certain cells are initially infected. Here, we have analyzed the distribution of cytomegalovirus (CMV) particles during the acute phase of infection, termed primary viremia, following ICV or intravascular (IV) injection into the neonatal mouse brain. In the ICV injection model, 5 &#181;l of murine CMV (MCMV) or fluorescent microbeads were injected into the lateral ventricle at the midpoint between the ear and eye using a 10-&#181;l syringe with a 27 G needle. In the IV injection model, a 1-ml syringe with a 35 G needle was used. A transilluminator was used to visualize the superficial temporal (facial) vein of the neonatal mouse. We infused 50 &#181;l of MCMV or fluorescent microbeads into the superficial temporal vein. Brains were harvested at different time points post-injection. MCMV genomes were detected using the in situ hybridization method. Fluorescent microbeads or green fluorescent protein expressing recombinant MCMV particles were observed by fluorescent microscopy. These techniques can be applied to many other pathogens to investigate the pathogenesis of encephalitis.

Here, we describe a simple method of intracerebroventricular and intravascular injection of viral particles or fluorescent microbeads into the neonatal mouse brain. The localization pattern of the virus and nanoparticles could be detected by microscopic evaluation or by in situ hybridization.

Intracerebroventricular und intravaskuläre Injektion von Viruspartikeln und Fluorescent Microbeads in die neonatale Gehirn

In the study on the pathogenesis of viral encephalitis, the infection method is critical. The first of the two main infectious routes to the brain is the ...

Neurowissenschaften

C-section of Preclinical Animal Model of Chorioamnionitis Triggered by Group B Streptococcus (GBS)

Group B Streptococcus (GBS) is one of the most common bacteria isolated during human pregnancy. It is a leading cause of placental infection/inflammation, termed chorioamnionitis. Chorioamnionitis exposes the developing fetus to a high risk of organ injuries, perinatal morbidity, and mortality, as well as life-long neurobehavioral impairments and other non-neurological developmental issues. The two most frequent subtypes of GBS isolates from maternal and fetal tissues are serotypes Ia (13%-23%) and III (25%-53%). Our lab has developed and characterized a rat model of GBS-induced chorioamnionitis to study subsequent impacts on the central nervous system of the developing fetus and to understand underlying mechanistic aspects. This article presents the design as well as uses of the preclinical rat model, which closely reproduces the hallmark of GBS-induced chorioamnionitis in humans. This article aims to help scientists reproduce the experimental design as well as to provide support through examples of troubleshooting. The present model may also contribute to potential discoveries through uncovering causes, mechanisms, and novel therapeutic avenues, which remain unsettled in many developmental impairments arising from chorioamnionitis. Furthermore, the use of this model may be extended to the studies of perinatal non-neurological common and severe morbidities affecting, for instance, the retina, bowel, lung, and kidney. The main interest of this research is in the field of GBS-induced fetal neurodevelopmental impairments such as cerebral palsy (CP), attention deficit hyperactivity disorder (ADHD), and autism spectrum disorder (ASD). The rationale supporting this model is presented in this article, followed by procedures and results.

<meta charset="utf8"></head><body>Kaiserschnitt eines präklinischen Tiermodells der Chorioamnionitis, ausgelöst durch Streptokokken GBS der Gruppe B

The goal of this protocol is to describe a preclinical animal model of Group B Streptococcus (GBS)-induced chorioamnionitis. The study is designed to investigate mechanistic processes, potential causal links with developmental impairments, and finally to develop translational anti-inflammatory placento- and neuro-protective treatments.

Kaiserschnitt eines präklinischen Tiermodells der Chorioamnionitis, ausgelöst durch Streptokokken der Gruppe B (GBS)

Group B Streptococcus (GBS) is one of the most common bacteria isolated during human pregnancy. It is a leading cause of placental infection/inflammation, ...

A Murine Model of Fetal Exposure to Maternal Inflammation to Study the Effects of Acute Chorioamnionitis on Newborn Intestinal Development

Chorioamnionitis is a common precipitant of preterm birth and is associated with many of the morbidities of prematurity, including necrotizing enterocolitis (NEC). However, a mechanistic link between these two conditions remains yet to be discovered. We have adopted a murine model of chorioamnionitis involving lipopolysaccharide (LPS)-induced fetal exposure to maternal inflammation (FEMI). This model of FEMI induces a sterile maternal, placental, and fetal inflammatory cascade, which is also present in many cases of clinical chorioamnionitis. Although models exist that utilize live bacteria and more accurately mimic the pathophysiology of an ascending infection resulting in chorioamnionitis, these methods may cause indirect effects on development of the immature intestinal tract and the associated developing microbiome. Using this protocol, we have demonstrated that LPS-induced FEMI results in a dose-dependent increase in pregnancy loss and preterm birth, as well as disruption of normal intestinal development in offspring. Further, we have demonstrated that FEMI significantly increases intestinal injury and serum cytokines in offspring, while simultaneously decreasing goblet and Paneth cells, both of which provide a first line of innate immunity against intestinal inflammation. Although a similar model of LPS-induced FEMI has been used to model the association between chorioamnionitis and subsequent abnormalities of the central nervous system, to our knowledge, this protocol is the first to attempt to elucidate a mechanistic link between chorioamnionitis and later perturbations in intestinal development as a potential link between chorioamnionitis and NEC.

We developed a model of chorioamnionitis to simulate fetal exposure to maternal inflammation (FEMI) without complications of live organisms to examine the effects of FEMI on development of the offspring&#8217;s intestinal tract. This allows for study of mechanistic causes for development of intestinal injury following chorioamnionitis.

Ein murines Modell der fetalen Exposition gegenüber mütterlicher Entzündung, um die Auswirkungen der akuten Chorioamnionitis auf die Darmentwicklung von Neugeborenen zu untersuchen

Die Induktion der mütterliche Immunaktivierung bei Mäusen in der Mitte der Schwangerschaft Bühne mit Viral Mimic Poly (I: C)

Zusammenfassung

Weitere Videos entdecken

Kapitel in diesem Video

Einem Mausmodell der In Utero Transplantation

Beurteilung der Maternal Vascular Remodeling während der Schwangerschaft in der Gebärmutter Maus

Verwenden Sie von

Zergliedern Angeborene Immunsystem Signaling in Viral Evasion von Zytokin-Produktion

Maus-In-vivo-Plazenta-gezielte CRISPR-Manipulation

Isolierung von Leukozyten aus dem Mausgeweben an der Maternal-Fetal-Schnittstelle

Intracerebroventricular und intravaskuläre Injektion von Viruspartikeln und Fluorescent Microbeads in die neonatale Gehirn

Kaiserschnitt eines präklinischen Tiermodells der Chorioamnionitis, ausgelöst durch Streptokokken der Gruppe B (GBS)

Kaiserschnitt eines präklinischen Tiermodells der Chorioamnionitis, ausgelöst durch Streptokokken der Gruppe B (GBS)

Ein murines Modell der fetalen Exposition gegenüber mütterlicher Entzündung, um die Auswirkungen der akuten Chorioamnionitis auf die Darmentwicklung von Neugeborenen zu untersuchen