Name: in vivo sirna transfection and gene knockdown in spinal cord via rapid noninvasive lumbar intrathecal injections in mice
Uploaded: 2014-03-22T14:00:00.000+00:00
Duration: 5 min 24 s
Description: Watch this Scientific Journal Video about In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice at JoVE.com

Alle Tiernutzung Verfahren waren nach ethischen Leitlinien, die von der lokalen Verwaltungskörper (Regierungspräsidium Karlsruhe, Karlsruhe, Deutschland) festgelegt. 1. Herstellung von siRNA / PEI-Komplex Die siRNA / PEI-Komplex-Lösung wird mit Herstellers wie folgt hergestellt: <ol><li> Lösung A: Man verdünnt die gewünschte Menge der siRNA mit sterilem Wasser (falls erforderlich) bis zu einem Viertel des Endvolumens und verdünnte diese mit weiteren 10% igen Glucoselösung bis zur Hälfte des Endvolumens. Vortex sanft oder mischen durch Pipettieren von oben und unten. Die optimale Menge an siRNA muss empirisch ermittelt werden, aber 1 pg siRNA in 10 ul-Komplex-Lösung pro Tier ist ein guter Ausgangspunkt für die Optimierung. </li><li> Lösung B: Man verdünnt das benötigte Volumen an Reagens PEI mit sterilem Wasser bis zu einem Viertel des Endvolumens und verdünnte diese mit weiteren 10% igen Glucoselösung bis zur Hälfte des Endvolumens. Vortex gently oder mischen durch Pipettieren von oben und unten. Anmerkung: Die Menge an PEI-Reagenz bestimmt den ionischen Gleichgewicht des Komplexes, der die Effizienz der Transfektion beeinflusst. Ebenso kann die optimale Menge an PEI-Lösung muss empirisch ermittelt werden. In unseren Händen ist die optimale Menge 0,12 ul der PEI-Lösung pro 1 ug siRNA. </li><li> Mischen Sie die Lösung A mit Lösung B auf einmal, Wirbel sanft. </li><li> Inkubieren der gemischten Lösung für 15 min bei RT vor der Verwendung. Dieser Komplex ist stabil für 2 h bei RT und 24 h bei 4 ° C. </li></ol> 2. Intrathekale Injektion <ol><li> Anesthetize die Maus mit 3% Isofluran, bis es zeigt keine Anzeichen des Stellreflexes. Überprüfen Sie außerdem, für Schwanz und / oder Pfote Prise Reflex, den Zustand der Anästhesie weiter zu gewährleisten. </li><li> Rasur etwa 2 cm 2 Pelz am hinteren Ende des Tieres in der Nähe der Basis des Schwanzes, um eine bessere Visualisierung während Nadeleinführung zu erleichtern. </li><li> Zeigen Maus inein Nasenkonus für eine weiterhin Isofluran Verwaltung während des Verfahrens, reduzieren Sie die Isofluran auf 1,5%, und decken die Augen der Maus mit Augen Gleitmittel. </li><li> Bereiten Sie die bereit sind, siRNA Mischlösung verwenden mit einem 25 ul Hamilton Spritze zu einer 30 G in 0,5 Nadel. </li><li> Suchen Sie den Dornfortsatz des L6, die das prominenteste und fixieren die Wirbel Spalte in dieser Gegend durch leichten Druck sollte. </li><li> Die Nadel zwischen der Nut der L5 und L6 Wirbel vorsichtig und beachten Sie für einen Tail-flick, wie dieses Zeichen weist auf eine erfolgreiche Eintritt der Nadel in der Intraduralraum. Tipp: Mit dem Fingernagel, sollte man in der Lage, die Nut als auch lokalisieren. </li><li> Sobald Tail-flick beobachtet wird, sofort, aber vorsichtig, sichern Sie die Nadelposition mit einer Hand und injizieren das gewünschte Volumen der Substanz mit der anderen Hand langsam. Tipp: ein Volumen zwischen 5-10 ul optimal als Volumen weniger als 5 &amp;# 181; l ist unzuverlässig und ein Volumen größer als 10 ul führt zu viel Druck. </li><li> Nach Injektion durchgeführt wird, bewegen Sie die Maus zurück in den Käfig, um aus der Narkose zu erholen. </li><li> Wiederholen Sie diese Injektion mindestens 2 mal je 24 h zur optimalen Herunterregulation des Zielgens zu erreichen. </li></ol>

<ol>
	<li>Hylden, J. L., Wilcox, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intrathecal+morphine+in+mice:+a+new+technique.">Intrathecal morphine in mice: a new technique.</a> Eur. J. Pharmacol. 67, 313-316 (1980).</li><li>Stokes, J. A., Corr, M., Yaksh, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transient+tactile+allodynia+following+intrathecal+puncture+in+mouse:+contributions+of+Toll-like+receptor+signaling.">Transient tactile allodynia following intrathecal puncture in mouse: contributions of Toll-like receptor signaling.</a> Neurosci. Lett. 504, 215-218 (2011).</li><li>Goula, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyethylenimine-based+intravenous+delivery+of+transgenes+to+mouse+lung.">Polyethylenimine-based intravenous delivery of transgenes to mouse lung.</a> Gene Ther. , 1291-1295 (1998).</li><li>Fairbanks, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spinal+delivery+of+analgesics+in+experimental+models+of+pain+and+analgesia.">Spinal delivery of analgesics in experimental models of pain and analgesia.</a> Adv. Drug. Deliv. Rev. 55, 1007-1041 (2003).</li><li>Hohmann, A. G., Tsou, K., Walker, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cannabinoid+modulation+of+wide+dynamic+range+neurons+in+the+lumbar+dorsal+horn+of+the+rat+by+spinally+administered+WIN55,212-2.">Cannabinoid modulation of wide dynamic range neurons in the lumbar dorsal horn of the rat by spinally administered WIN55,212-2.</a> Neurosci. Lett. 257, 119-122 (1998).</li><li>Song, Z. H., Takemori, A. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Involvement+of+spinal+kappa+opioid+receptors+in+the+antinociception+produced+by+intrathecally+administered+corticotropin-releasing+factor+in+mice.">Involvement of spinal kappa opioid receptors in the antinociception produced by intrathecally administered corticotropin-releasing factor in mice.</a> J. Pharmacol. Exp. Ther. 254, 363-368 (1990).</li><li>Trang, T., Sutak, M., Jhamandas, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Involvement+of+cannabinoid+(CB1)-receptors+in+the+development+and+maintenance+of+opioid+tolerance.">Involvement of cannabinoid (CB1)-receptors in the development and maintenance of opioid tolerance.</a> Neuroscience. , 1275-1288 (2007).</li><li>Yaksh, T. L., Rudy, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chronic+catheterization+of+the+spinal+subarachnoid+space.">Chronic catheterization of the spinal subarachnoid space.</a> Physiol. Behav. 17, 1031-1036 (1976).</li><li>Tappe, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synaptic+scaffolding+protein+Homer1a+protects+against+chronic+inflammatory+pain.">Synaptic scaffolding protein Homer1a protects against chronic inflammatory pain.</a> Nat. Med. , 677-681 (2006).</li><li>Bourinet, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silencing+of+the+Cav3.2+T-type+calcium+channel+gene+in+sensory+neurons+demonstrates+its+major+role+in+nociception.">Silencing of the Cav3.2 T-type calcium channel gene in sensory neurons demonstrates its major role in nociception.</a> EMBO J. 24, 315-324 (2005).</li><li>Wang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+transfer+to+dorsal+root+ganglia+by+intrathecal+injection:+effects+on+regeneration+of+peripheral+nerves.">Gene transfer to dorsal root ganglia by intrathecal injection: effects on regeneration of peripheral nerves.</a> Mol. Ther. 12, 314-320 (2005).</li><li>Wigdor, S., Wilcox, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Central+and+systemic+morphine-induced+antinociception+in+mice:+contribution+of+descending+serotonergic+and+noradrenergic+pathways.">Central and systemic morphine-induced antinociception in mice: contribution of descending serotonergic and noradrenergic pathways.</a> J. Pharmacol. Exp. Ther. 242, 90-95 (1987).</li></ol>

Die Autoren erklären, keine finanziellen Interessen konkurrieren.

Somit ist die oben beschriebene Technik der Nadel intrathekale Injektionen wirksam, schnell, spezifisch lokalisiert und zerstörungsfrei. Technisch gesehen ist der wichtigste Aspekt des Verfahrens der Punkt der Nadeleinführung in die Nut. Es ist entscheidend, dass dieses Verfahren mit einer sehr ruhigen Hand und Geduld getan. Wie viele chirurgische Verfahren, Schulung verbessert die Rate der erfolgreichen Injektion. Dies ist auch deshalb wichtig, weil bei einem tatsächlichen Experiment erfordert diese Technik keine of...

Das Rückenmark ist ein sehr wichtiges Zentrum in einer Vielzahl von wichtigen biologischen Prozessen und physiologischen Funktionen, einschließlich der Verarbeitung und Übertragung von schmerzhaften (nozizeptiven) Eingängen 4-7. Verschiedene experimentelle Techniken entwickelt, um pharmakologische Modulation des Rückenmarks, wie chronische Implantation intrathekalen Katheter 8, Rückenmark-Mikroinjektion und intrathekale Injektion Nadel 9 zu ermöglichen. Jedes Verfahren hat seine eigenen Vorteile und Nachteile, je nach dem Experiment Paradigma eine Technik vielleicht besser geeignet als die anderen. Während chronische Implantation von intrathekalen Katheter ist ohne weiteres möglich in Ratte, ist diese Methode sehr schwierig in der Maus, da Größenbeschränkungen. Erfolgsquote ist sehr niedrig und motorische Defizite auftreten, oft aufgrund der sperrigen Anwesenheit eines Katheters in der stark beschränkt Subduralraum in der Maus. Darüber hinaus wird langfristig Abgabe von Medikamenten durch häufige Gerinnungs gemachtchronisch implantierten Katheter. Schließlich sind Immunreaktionen häufig. Diese Probleme können unter Verwendung des Verfahrens von akuten intrathekale Injektion durch eine Nadel in der Abwesenheit eines vorimplantiert Katheter, der einen schnellen und anatomisch begrenzte Anwendung von Medikamenten und Reagenzien zu dem Rückenmark von Mäusen können umgangen werden. Dieses Verfahren die Vorteile der intrathekale Abgabe über andere systemische Lieferwege (z. B. oral, intravenös, intraperitoneal, etc.), wie Spezifität Rücken Modulation, die Dosierungen verringert und Grenze Nebenwirkungen erlaubt, sowie die Fähigkeit zu liefern Stoffe nicht vollständig beibehält normalerweise nicht die Blut-Hirn-Schranke zu überwinden, da während intrathekale Injektion wird die Nadel zwischen der Dura und dem Rückenmark eingesetzt. Wichtig ist jedoch im Vergleich zu anderen Methoden der intrathekalen Lieferung, ist die intrathekale Nadelinjektion die am wenigsten invasive Verfahren, so dass eine Vielzahl von Anwendungen in derelbe Tier, ohne dass eine erhebliche Gewebeschädigung oder Immunreaktion hervorzurufen durch Implantation von Fremdmaterial. Technische Fähigkeiten erfordert jedoch eine sehr genaue Ausrichtung der Nadel, um die Wirksamkeit zu ermöglichen. Hier haben wir visuell demonstrieren das Verfahren zum Erreichen einer optimalen Erfolgsquote für die speziell auf die Lendenrückenmark. Die Injektionsstelle, die in diesem Experiment gewählt wird, ist die Nut zwischen L5 und L6 wirbel Spalte, in der Nähe, wo das Rückenmark endet, um die Möglichkeit der Beschädigung der Wirbelsäule zu minimieren. Darüber hinaus zeigen wir die Verwendung dieser Technik, um Gene im Rückenmark mit siRNAs niederschlagen.

<table><tbody><tr><td>&lt;em&gt;In Vivo&lt;/em&gt;-jetPEI</td><td>Polyplus</td><td>201-10G</td><td>&amp;nbsp;</td></tr><tr><td>WAVE1 siRNA</td><td>Santa Cruz</td><td>sc-36832</td><td>&amp;nbsp;</td></tr><tr><td>Control siRNA-A</td><td>Santa Cruz</td><td>sc-37007</td><td>&amp;nbsp;</td></tr><tr><td>Anti-&amp;szlig;-Tubulin III antibody</td><td>Sigma</td><td>T2200</td><td>&amp;nbsp;</td></tr><tr><td>Anti-WAVE1 antibody</td><td>R&amp;amp;D Systems</td><td>AF5514</td><td>&amp;nbsp;</td></tr><tr><td>Fast green dye</td><td>Sigma</td><td>F-7252</td><td>&amp;nbsp;</td></tr><tr><td>Isoflurane</td><td>Baxter</td><td></td><td>&amp;nbsp;</td></tr><tr><td>Isoflurane setup</td><td>Dr&amp;auml;ger L&amp;uuml;beck</td><td></td><td>&amp;nbsp;</td></tr><tr><td>Shaver</td><td>Wella</td><td></td><td>&amp;nbsp;</td></tr><tr><td>Hamilton syringe Gastight 1702</td><td>Hamilton</td><td></td><td>&amp;nbsp;</td></tr><tr><td>30 G 1/2 in 13 mm Needle</td><td>BD Microlance</td><td>304000</td><td>&amp;nbsp;</td></tr><tr><td>Microscope Leica MS5</td><td>Leica</td><td></td><td>&amp;nbsp;</td></tr><tr><td>WAVE1 forward primer for qRT-PCR</td><td>Sigma</td><td></td><td>cacagagcctcaggacagg</td></tr><tr><td>WAVE1 reversed primer for qRT-PCR</td><td>Sigma</td><td></td><td>cttttcaccaacggcatctt</td></tr><tr><td>FastStart Essential DNA Green Master</td><td>Roche</td><td>6402712001</td><td>&amp;nbsp;</td></tr></tbody></table>

in vivo sirna transfection and gene knockdown in spinal cord via rapid noninvasive lumbar intrathecal injections in mice

Dieser Bericht beschreibt eine Schritt-für-Schritt-Anleitung für die Technik der akuten intrathekalen Nadel-Injektionen in einer nicht-invasive Weise, dh unabhängig von der Katheter-Implantation. Der technische Nachteil dieser Operationstechnik liegt in der Feinheit der Hände. Die Einspritzung schnell, vor allem für einen geschulten Experimentator, und da Gewebezerstörung mit dieser Technik minimal ist, sind wiederholte Injektionen möglich, außerdem Immunreaktion auf Fremdwerkzeugen (. Z. B. Katheter) tritt nicht auf, wodurch eine bessere und spezifischere ausgelesen Rückenmarks Modulation. Da die Anwendung der Substanz im Wesentlichen auf die Zielregion des Rückenmarks beschränkt sind, Arzneimittel, nicht in großen Dosierungen angewendet werden müssen, und vor allem unerwünschte Wirkungen auf andere Gewebe, wie bei einer systemischen Verabreichung beobachtet dann umgangen werden, 1, 2. Darüber hinaus kombinieren wir diese Technik mit in-vivo-Transfektion von Nukleinsäure mit Hilfe polyethylenimine (PEI)-Reagens 3, die enorme Vielseitigkeit für die Untersuchung der Wirbelsäule Funktionen über Lieferung von pharmakologischen Wirkstoffen sowie Gen-, RNA-und Protein-Modulatoren zur Verfügung stellt.

Um eine erfolgreiche Injektion zu veranschaulichen, diese Technik durchgeführt, die wir mit Fast Green FCF Farbstoff in der Erwachsenen C57Bl6 Mäuse (8-10 Wochen alt). Das Tier wurde für ein paar Minuten nach der Injektion zu erholen, um genügend Zeit für den Farbstoff verteilt und dann mit einer Überdosis von CO 2 getötet werden. Anschließend wurde das Wirbeltier Spalte seziert und das Rückenmark wurde freigelegt. Die blaue puncta entsprechend der Farbstoff diffundiert, markiert die Injektionsstelle...

Watch this Scientific Journal Video about In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice at JoVE.com

In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

Dieser Bericht beschreibt eine einfache und schnelle Technik der intrathekalen Punktion für eine lokalisierte Transfektion von siRNA in der Lenden-Wirbelsäule in der Maus unter Kurznarkose dauerhafte Licht.

In vivo siRNA-Transfektion und Gene Knockdown im Rückenmark über Rapid-Nichtinvasive Lendenwirbel intrathekale Injektionen in Mäuse

This report describes a step-by-step guide to the technique of acute intrathecal needle injections in a noninvasive manner, i.e. independent of catheter ...

in-vivo-sirna-transfection-gene-knockdown-spinal-cord-via-rapid

Universidad de Cartagena UDEC

Research

JoVE Journal

Biology

In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

46.5K Aufrufe.  University of Heidelberg.  Dieser Bericht beschreibt eine einfache und schnelle Technik der intrathekalen Punktion für eine lokalisierte Transfektion von siRNA in der Lenden-Wirbelsäule in der Maus unter Kurznarkose dauerhafte Licht. 

Serie: In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

In vivo Imaging of the Mouse Spinal Cord Using Two-photon Microscopy

In vivo imaging using two-photon microscopy 1 in mice that have been genetically engineered to express fluorescent proteins in specific cell types 2-3 has significantly broadened our knowledge of physiological and pathological processes in numerous tissues in vivo 4-7. In studies of the central nervous system (CNS), there has been a broad application of in vivo imaging in the brain, which has produced a plethora of novel and often unexpected findings about the behavior of cells such as neurons, astrocytes, microglia, under physiological or pathological conditions 8-17. However, mostly technical complications have limited the implementation of in vivo imaging in studies of the living mouse spinal cord. In particular, the anatomical proximity of the spinal cord to the lungs and heart generates significant movement artifact that makes imaging the living spinal cord a challenging task.
We developed a novel method that overcomes the inherent limitations of spinal cord imaging by stabilizing the spinal column, reducing respiratory-induced movements and thereby facilitating the use of two-photon microscopy to image the mouse spinal cord in vivo. This is achieved by combining a customized spinal stabilization device with a method of deep anesthesia, resulting in a significant reduction of respiratory-induced movements. This video protocol shows how to expose a small area of the living spinal cord that can be maintained under stable physiological conditions over extended periods of time by keeping tissue injury and bleeding to a minimum. Representative raw images acquired in vivo detail in high resolution the close relationship between microglia and the vasculature. A timelapse sequence shows the dynamic behavior of microglial processes in the living mouse spinal cord. Moreover, a continuous scan of the same z-frame demonstrates the outstanding stability that this method can achieve to generate stacks of images and/or timelapse movies that do not require image alignment post-acquisition. Finally, we show how this method can be used to revisit and reimage the same area of the spinal cord at later timepoints, allowing for longitudinal studies of ongoing physiological or pathological processes in vivo.

In vivo Imaging of the Mouse Spinal Cord Using Two-photon Microscopy

A minimally invasive protocol to stabilize the mouse spinal column and perform repetitive in vivo spinal cord imaging using two-photon microscopy is described. This method combines a spinal stabilization device and an anesthetic regimen to minimize respiratory-induced movements and produce raw imaging data that require no alignment or other post-processing.

In-vivo-Imaging von der Maus Spinal Cord mit Zwei-Photonen-Mikroskopie

In vivo imaging using two-photon microscopy 1 in mice that have been genetically engineered to express fluorescent proteins in specific cell types 2-3 has ...

Forschung

Neurowissenschaften

Stereotaxic Injection of a Viral Vector for Conditional Gene Manipulation in the Mouse Spinal Cord

Intraparenchymal injection of a viral vector enables conditional gene manipulation in distinct populations of neurons or particular regions of the central nervous system. We demonstrate a stereotaxic injection technique that allows targeted gene expression or silencing in the dorsal horn of the mouse spinal cord. The surgical procedure is brief. It requires laminectomy of a single vertebra, providing for quick recovery of the animal and unimpaired motility of the spine. Controlled injection of a small vector suspension volume at low speed and use of a microsyringe with beveled glass cannula minimize the tissue lesion. The local immune response to the vector depends on the intrinsic properties of the virus employed; in our experience, it is minor and short-lived when a recombinant adeno-associated virus is used. A reporter gene such as enhanced green fluorescent protein facilitates monitoring spatial distribution of the vector, and the efficacy and cellular specificity of the transfection.

Viral vectors allow for targeted gene manipulation. We demonstrate a method for conditional gene expression or ablation in the mouse spinal cord, using stereotaxic injection of a viral vector into the dorsal horn, a prominent site of synaptic contact between primary somatosensory afferents and neurons of the central nervous system.

Stereotaktische Injektion eines viralen Vektors für Conditional Gene Manipulation im Maus-Rückenmark

Intraparenchymal injection of a viral vector enables conditional gene manipulation in distinct populations of neurons or particular regions of the central ...

<meta charset="utf8"></head><body>Entwicklung eines effizienten und präzisen Mausmodells für Rückenmarksgliome

Surgical Transplantation of Tumor Cells into the Spinal Cord of Mice

Spinal cord gliomas are commonly malignant tumors of the spinal cord, leading to a high rate of disability. However, uniform treatment guidelines and comprehensive data on spinal cord gliomas remain limited due to the lack of suitable preclinical animal models. Developing a simple and reproducible animal model has become essential for advancing basic and translational research. A murine model is ideal, as the murine spinal cord shares structural similarities with the human spinal cord. This protocol describes the generation of a reproducible murine model of spinal cord glioma by directly injecting tumor cells into the intervertebral space using the spinous process of the seventh cervical vertebra as a guide. Compared to other methods, this approach is more effective and convenient, involving a smaller incision, reduced invasiveness and blood loss, faster recovery, and more stable tumor formation. This model is expected to advance the understanding of disease mechanisms, optimize surgical strategies, and support the development of therapeutic drugs for spinal cord gliomas.

<meta charset="utf8"></head><body>Chirurgische Transplantation von Tumorzellen in das Rückenmark von Mäusen

The present protocol describes the development of a reproducible murine model of spinal cord glioma by injecting tumor cells into the intervertebral space, offering a more effective and less invasive approach for research and therapeutic development.

Chirurgische Transplantation von Tumorzellen in das Rückenmark von Mäusen

Spinal cord gliomas are commonly malignant tumors of the spinal cord, leading to a high rate of disability. However, uniform treatment guidelines and ...

Krebsforschung

In Vivo Gene Transfer to Schwann Cells in the Rodent Sciatic Nerve by Electroporation

The formation of the myelin sheath by Schwann cells (SCs) is essential for rapid conduction of nerve impulses along axons in the peripheral nervous system. SC-selective genetic manipulation in living animals is a powerful technique for studying the molecular and cellular mechanisms of SC myelination and demyelination in vivo. While knockout/knockin and transgenic mice are powerful tools for studying SC biology, these methods are costly and time consuming. Viral vector-mediated transgene introduction into the sciatic nerve is a simpler and less laborious method. However, viral methods have limitations, such as toxicity, transgene size constraints, and infectivity restricted to certain developmental stages. Here, we describe a new method that allows selective transfection of myelinating SCs in the rodent sciatic nerve using electroporation. By applying electric pulses to the sciatic nerve at the site of plasmid DNA injection, genes of interest can be easily silenced or overexpressed in SCs in both neonatal and more mature animals. Furthermore, this in vivo electroporation method allows for highly efficient simultaneous expression of multiple transgenes. Our novel technique should enable researchers to efficiently manipulate SC gene expression, and facilitate studies on SC development and function.

In Vivo Gene Transfer to Schwann Cells in the Rodent Sciatic Nerve by Electroporation

Here, we present an in vivo technique for gene transfer to Schwann cells (SCs) in the rodent sciatic nerve. This simple technique is useful for investigating signaling mechanisms involved in the development and maintenance of myelinating SCs.

In vivo - Gentransfer auf Schwann - Zellen in der Nagerischiasnerv durch Elektroporation

The formation of the myelin sheath by Schwann cells (SCs) is essential for rapid conduction of nerve impulses along axons in the peripheral nervous ...

Subpial Adeno-associated Virus 9 (AAV9) Vector Delivery in Adult Mice

The successful development of a subpial adeno-associated virus 9 (AAV9) vector delivery technique in adult rats and pigs has been reported on previously. Using subpially-placed polyethylene catheters (PE-10 or PE-5) for AAV9 delivery, potent transgene expression through the spinal parenchyma (white and gray matter) in subpially-injected spinal segments has been demonstrated. Because of the wide range of transgenic mouse models of neurodegenerative diseases, there is a strong desire for the development of a potent central nervous system (CNS)-targeted vector delivery technique in adult mice. Accordingly, the present study describes the development of a spinal subpial vector delivery device and technique to permit safe and effective spinal AAV9 delivery in adult C57BL/6J mice. In spinally immobilized and anesthetized mice, the pia mater (cervical 1 and lumbar 1-2 spinal segmental level) was incised with a sharp 34 G needle using an XYZ manipulator. A second XYZ manipulator was then used to advance a blunt 36G needle into the lumbar and/or cervical subpial space. The AAV9 vector (3-5 &#181;L; 1.2 x 1013 genome copies (gc)) encoding green fluorescent protein (GFP) was then injected subpially. After injections, neurological function (motor and sensory) was assessed periodically, and animals were perfusion-fixed 14 days after AAV9 delivery with 4% paraformaldehyde. Analysis of horizontal or transverse spinal cord sections showed transgene expression throughout the entire spinal cord, in both gray and white matter. In addition, intense retrogradely-mediated GFP expression was seen in the descending motor axons and neurons in the motor cortex, nucleus ruber, and formatio reticularis. No neurological dysfunction was noted in any animals. These data show that the subpial vector delivery technique can successfully be used in adult mice, without causing procedure-related spinal cord injury, and is associated with highly potent transgene expression throughout the spinal neuraxis.

Subpial Adeno-associated Virus 9 AAV9 Vector Delivery in Adult Mice

The goal of the present study was to develop and validate the potency and safety of spinal adeno-associated virus 9 (AAV9)-mediated gene delivery by using a novel subpial gene delivery technique in adult mice.

Subpial Adeno-assoziiertes Virus 9 (AAV9) Vektorlieferung in erwachsenen Mäusen

The successful development of a subpial adeno-associated virus 9 (AAV9) vector delivery technique in adult rats and pigs has been reported on previously. ...

Adeno-associated Virus-mediated Transgene Expression in Genetically Defined Neurons of the Spinal Cord

Selective manipulation of spinal neuronal subpopulations has mainly been achieved by two different methods: 1) Intersectional genetics, whereby double or triple transgenic mice are generated in order to achieve selective expression of a reporter or effector gene (e.g., from the Rosa26 locus) in the desired spinal population. 2) Intraspinal injection of Cre-dependent recombinant adeno-associated virus (rAAV); here Cre-dependent AAV vectors coding for the reporter or effector gene of choice are injected into the spinal cord of mice expressing Cre recombinase in the desired neuronal subpopulation. This protocol describes how to generate Cre-dependent rAAV vectors and how to transduce neurons in the dorsal horn of the lumbar spinal cord segments L3-L5 with rAAVs. As the lumbar spinal segments L3-L5 are innervated by those peripheral sensory neurons that transmit sensory information from the hindlimbs, spontaneous behavior and responses to sensory tests applied to the hindlimb ipsilateral to the injection side can be analyzed in order to interrogate the function of the manipulated neurons in sensory processing. We provide examples of how this technique can be used to analyze genetically defined subsets of spinal neurons. The main advantages of virus-mediated transgene expression in Cre transgenic mice compared to classical reporter mouse-induced transgene expression are the following: 1) Different Cre-dependent rAAVs encoding various reporter or effector proteins can be injected into a single Cre transgenic line, thus overcoming the need to create several multiple transgenic mouse lines. 2) Intraspinal injection limits manipulation of Cre-expressing cells to the injection site and to the time after injection. The main disadvantages are: 1) Reporter gene expression from rAAVs is more variable. 2) Surgery is required to transduce the spinal neurons of interest. Which of the two methods is more appropriate depends on the neuron population and research question to be addressed.

Intraspinal injection of recombinase dependent recombinant adeno-associated virus (rAAV) can be used to manipulate any genetically labelled cell type in the spinal cord. Here we describe how to transduce neurons in the dorsal horn of the lumbar spinal cord. This technique enables functional interrogation of the manipulated neuron subtype.

Adeno-assoziierten Virus-vermittelten Transgene Ausdruck in genetisch definierten Nervenzellen des Rückenmarks

Selective manipulation of spinal neuronal subpopulations has mainly been achieved by two different methods: 1) Intersectional genetics, whereby double or ...

Direct Intrathecal Injection of Recombinant Adeno-associated Viruses in Adult Mice

Intrathecal (IT) injection of adeno-associated virus (AAV) has drawn considerable interest in CNS gene therapy by virtue of its safety, noninvasiveness, and excellent transduction efficacy in the CNS.&#160;Previous studies have demonstrated the therapeutic potency of AAV-delivered gene therapy in neurodegenerative disorders by IT administration. However, high rates of unpredictable failure due to the technical limitation of IT administration in small animals have been reported. Here, we established a scoring system to indicate the success extent of lumbar puncture in small animals by adding 1% lidocaine hydrochloride into the injection solution. We further show that the extent of transient weakness following injection can predict the transduction efficiency of AAV. Thus, this IT injection method can be used to optimize therapeutic trials in mouse models of CNS diseases that afflict wide regions of the CNS.

Here we present a direct intrathecal injection technique using 1% lidocaine hydrochloride in a viral solution to ensure efficient adeno-associated virus delivery to small animals and establish a scoring system to predict transduction efficiency in the central nervous system according to the degree of transient weakness induced by lidocaine.

Direkte intrathekale Injektion von Recombinant Adeno-assoziierten Viren bei Erwachsenen Mäusen

Intrathecal (IT) injection of adeno-associated virus (AAV) has drawn considerable interest in CNS gene therapy by virtue of its safety, noninvasiveness, ...

Direct Injection of a Lentiviral Vector Highlights Multiple Motor Pathways in the Rat Spinal Cord

Introducing proteins of interest into cells in the nervous system is challenging due to innate biological barriers that limit access to most molecules. Injection directly into spinal cord tissue bypasses these barriers, providing access to cell bodies or synapses where molecules can be incorporated. Combining viral vector technology with this method allows for introduction of target genes into nervous tissue for the purpose of gene therapy or tract tracing. Here a virus engineered for highly efficient retrograde transport (HiRet) is introduced at the synapses of propriospinal interneurons (PNs) to encourage specific transport to neurons in the spinal cord and brainstem nuclei. Targeting PNs takes advantage of the numerous connections they receive from motor pathways such as the rubrospinal and reticulospinal tracts, as well as their interconnection with each other throughout spinal cord segments. Representative tracing using the HiRet vector with constitutively active green fluorescent protein (GFP) shows high fidelity details of cell bodies, axons and dendritic arbors in thoracic PNs and in reticulospinal neurons in the pontine reticular formation. HiRet incorporates well into brainstem pathways and PNs but shows age dependent integration into corticospinal tract neurons. In summary, spinal cord injection using viral vectors is a suitable method for introduction of proteins of interest into neurons of targeted tracts.

This protocol demonstrates injection of a retrogradely transportable viral vector into rat spinal cord tissue. The vector is taken up at the synapse and transported to the cell body of target neurons. This model is suitable for retrograde tracing of important spinal pathways or targeting cells for gene therapy applications.

Direkter Einspritzung von Lentivirale Vektor zeigt mehrere motorische Bahnen im Rückenmark Ratte

Introducing proteins of interest into cells in the nervous system is challenging due to innate biological barriers that limit access to most molecules. ...

In vivo siRNA-Transfektion und Gene Knockdown im Rückenmark über Rapid-Nichtinvasive Lendenwirbel intrathekale Injektionen in Mäuse

Zusammenfassung

Weitere Videos entdecken

Kapitel in diesem Video

In-vivo-Imaging von der Maus Spinal Cord mit Zwei-Photonen-Mikroskopie

Stereotaktische Injektion eines viralen Vektors für Conditional Gene Manipulation im Maus-Rückenmark

Chirurgische Transplantation von Tumorzellen in das Rückenmark von Mäusen

Chirurgische Transplantation von Tumorzellen in das Rückenmark von Mäusen

Chirurgische Transplantation von Tumorzellen in das Rückenmark von Mäusen

In vivo - Gentransfer auf Schwann - Zellen in der Nagerischiasnerv durch Elektroporation

Subpial Adeno-assoziiertes Virus 9 (AAV9) Vektorlieferung in erwachsenen Mäusen

Adeno-assoziierten Virus-vermittelten Transgene Ausdruck in genetisch definierten Nervenzellen des Rückenmarks

Direkte intrathekale Injektion von Recombinant Adeno-assoziierten Viren bei Erwachsenen Mäusen

Direkter Einspritzung von Lentivirale Vektor zeigt mehrere motorische Bahnen im Rückenmark Ratte