This work was supported by research grants from the United Arab Emirates University (UAEU), grant # 31R170 (Zayed Center for Health Sciences) and # 12R010 (UAEU-AUA grant). We thank Prof Randall Morse (Wadsworth Center, Albany, NY) for helping us to edit the manuscript for style and grammar.
All data are available upon request.

1. Transfection of HEK293T cells using either PEI or Lipofectamine 3000 reagent
<ol>
	<li>Culture HEK293T cells in DMEM + 10% FBS + 1x penicillin/streptomycin at 37 &#176;C in a humidified incubator with an atmosphere of 5% CO2 and 21% O2 until they are 90% confluent before seeding for transfection. Use a relatively low passage number of cells for high titer virus production (ideally less than P30).</li>
	<li>Seed 4 x 106 cells in 10 mL of complete growth medium in a 100 mm tissue culture plate and grow overnight in a humidified tissue culture incubator with an atmosphere of 5% CO2 and 21% O2.</li>
	<li>For each transfection, dilute plasmid DNA (1 mg/mL stocks) in 1 mL of serum free DMEM media in 1.5 mL centrifuge tubes using the following ratio of entry and packaging plasmids: 
	Entry vector = 10 &#181;g 
	psPAX2.0 = 7.5 &#181;g 
	pMD2.G = 5 &#181;g</li>
	<li>Vortex for 10 s and spin the tube at 10,000 x g for 30 s at room temperature to collect.</li>
	<li>Add 70 &#181;L of (1 mg/mL stock solution) PEI to the tube, and vortex and spin briefly as described above to collect. The volume of PEI used is based on a 1:3 ratio of total DNA (&#181;g):PEI (&#181;g).</li>
	<li>For lipofectamine-based transfection, dilute the above vectors in 500 &#181;L of serum-free DMEM media containing 45 &#181;L of reagent P supplied in the kit and incubate at room temperature for 5 min.</li>
	<li>Dilute 70 &#181;L of reagent L supplied in the kit using 500 &#181;L of serum-free DMEM media and incubate at room temperature for 5 min.</li>
	<li>Combine the contents of both tubes and incubate the tubes at room temperature for 20 min to allow complex formation.</li>
	<li>Add dropwise 1 mL of DNA/PEI or 1 mL of DNA/lipofectamine complexes to the plate containing cells and incubate for 6 h at 37 &#176;C in a humidified incubator with an atmosphere of 5% CO2 and 21% O2.</li>
	<li>After 6 h, change to fresh complete growth media (10 mL) and return the cells back to the humidified incubator with an atmosphere of 5% CO2 and 21% O2.</li>
</ol>
2. LVS collection and ultracentrifugation
<ol>
	<li>After 2 days of transfection, collect the virus-containing media and overlay the cells again with 10 mL of fresh complete growth media.</li>
	<li>After 3 days of transfection, collect the virus-containing media and combine it with the virus-containing media collected at the 2 day time point.</li>
	<li>Centrifuge the viral supernatant at 2,000 x g for 10 min at 4 &#176;C to pellet cellular debris.</li>
	<li>Filter the supernatant using a 0.45 &#181;m pore size low protein binding filter (either PES or SFCA) and store at 4 &#176;C until ready for ultracentrifugation. The filtered supernatant containing lentiviral particles can be stored at 4 &#176;C for 5 days without a significant loss in viral titers.</li>
	<li>Sterilize the ultracentrifuge tubes holding cups by washing them with 70% ethanol for 10 min, air dry, close, and keep at 4 &#176;C.</li>
	<li>Add 36 mL of filtered media containing lentiviral particles to a sterile ultracentrifuge tube.</li>
	<li>Fill 5 mL of a sterile stripette with 4 mL of sterile 20% sucrose solution (prepared in PBS) and dispense it right to the bottom of the ultracentrifuge tube (UC) containing LVS. It is important that the sucrose solution is not mixed with the media and makes a gradient at the bottom of the tube.</li>
	<li>Balance all the ultracentrifuge tubes using serum-free DMEM media, place in the cold ultracentrifuge tube holding cups, and close the lids.</li>
	<li>Spin the tubes at 125,000 x g for 2 h at 4 &#176;C.</li>
	<li>After the spin, carefully discard the supernatant by inverting the contents of the tube in a container containing bleach without disturbing the pellet. Mark the pellet if visible.</li>
	<li>Place the ultracentrifuge tube in a 50 mL sterile tube and add 200 &#181;L of sterile DPBS exactly at the top of the pellet. Keep at 4 &#176;C overnight undisturbed.</li>
	<li>The following day, gently mix by pipetting up and down 40x.</li>
	<li>Briefly spin at 13,000 x g in a tabletop centrifuge to pellet any debris.</li>
	<li>Transfer the supernatant to a new tube and aliquot the virus preparation as 20 &#181;L aliquots. Store at &#8722;80 &#176;C.</li>
	<li>Set aside 5 &#181;L of the preparation for viral titer measurements.</li>
</ol>
3. LVS titer measurement for pLKO.1-based vectors
<ol>
	<li>Determine the titer of lentiviral particles by using a qPCR following the manufacturer&#39;s recommendations.</li>
	<li>For a standard curve, prepare five 10-fold serial dilutions of Standard Control DNA (provided in the kit) by diluting 5 &#181;L of DNA into 45 &#181;L of nuclease-free H2O in each step. Use dilutions of 1:100 to 1:100,000 to generate a standard curve.</li>
	<li>Set up reactions on ice in duplicates in the following manner: 
	2x qPCR master mix&#160; &#160; &#160; &#160; 10 &#181;L 
	Primer mix&#160; &#160; &#160; &#160; &#160; &#160; &#160; &#160; &#160; &#160; &#160; &#160; &#160; 2 &#181;L 
	Sample or standard DNA&#160; &#160;2 &#181;L 
	Nuclease-free H2O&#160; &#160; &#160; &#160; &#160; &#160; 6 &#181;L</li>
	<li>Perform qPCR using the cycling conditions mentioned in the manual of the kit for a total of 35 cycles.</li>
	<li>Plot cycle threshold (Ct) values on the Y-axis vs. virus titer on the X-axis.</li>
	<li>Generate a logarithmic regression using four standard control DNA dilutions (1:100 to 1:100,000) to determine the unknown virus sample titer using a trendline equation.</li>
</ol>
4. LVS titer measurement for pll3.7-based vectors
<ol>
	<li>Seed 1 x 105 HEK293T cells in each well of a P12-well plate in 1 mL of complete growth media 24 h before infections.</li>
	<li>Supplement the media with 8 &#181;g/mL polybrene and add 1 mL into each sterile 1.5 mL tube.</li>
	<li>Dilute the viral particles by using 4 &#181;L, 2 &#181;L, 1 &#181;L, 0.5 &#181;L, and 0.1 &#181;L of concentrated lentiviral particles in each of the 1 mL of polybrene-containing media.</li>
	<li>Replace the media from HEK293T cells with the media containing indicated amounts of lentiviral particles along with 8 &#181;g/mL polybrene and incubate for 24 h at 37 &#176;C in a humidified incubator with an atmosphere of 5% CO2 and 21% O2.</li>
	<li>The next day, change to fresh media and continue the culture for 72 h at 37 &#176;C in a humidified incubator with an atmosphere of 5% CO2 and 21% O2.</li>
	<li>After 72 h, wash the cells with PBS, trypsinize at 37 &#176;C according to the manufacturer&#39;s protocol, and resuspend in 1 mL of PBS.</li>
	<li>Perform FACS cell sorting using a cell sorter, following the manufacturer&#39;s recommendations. Set the gate to 0% GFP positive cells using non-infected HEK293T cells and count 50,000 events for each sample to determine the percentage of positive cells for each viral dilution.</li>
	<li>Use only the volumes of lentiviral particles that give %GFP positive cells in the range of 2%-20% to calculate the titer of lentiviral particles.</li>
</ol>
5. Infection of hESCs and stable selection
<ol>
	<li>Wash the cells with 2 mL of PBS growing in each well of a 6-well cell culture multiwell plate.</li>
	<li>Detach the cells from the cell culture plate using 1 mL of 1x cell dissociation reagent by incubation at 37&#160;&#176;C for 5 min.</li>
	<li>Collect the cells in DMEM/F12 media and centrifuge at 1,500 x g for 5 min at room temperature to collect the cell pellet.</li>
	<li>Aspirate, resuspend the cells in 1 mL, and count using a hemocytometer.</li>
	<li>Make a cell suspension with 2 x 105 cells/mL of complete growth media containing mTeSR1 supplemented with 10 ng/mL basic fibroblast growth factor (bFGF), penicillin/streptomycin (P/S), and 10 &#181;M ROCK Inhibitor (RI).</li>
	<li>Seed 1 x 105 cells on 50x diluted complete basement membrane matrix-coated P24-well plates in 500 &#181;L of complete growth media and culture the cells at 37 &#176;C in a humidified incubator with an atmosphere of 5% CO2 and 21% O2.</li>
	<li>The following day, infect hESCs at a multiplicity of infection (MOI) of 10 with 8 &#181;g/mL polybrene and incubate at 37 &#176;C for 8 h.</li>
	<li>After 8 h, replace the virus-containing media with fresh growth media (-RI) and continue the culture until the cells are 90% confluent.</li>
	<li>Start puromycin selection (0.8 &#181;g/mL) when the cells reach 90% confluency, which is usually 48-72 h post infection.</li>
	<li>After selection is complete (usually 4-6 days), split the stable cells (1:4) and expand the cells for cryopreservation and further analysis.</li>
</ol>
6. Transduction of H9-derived neural progenitor cells (NPCs)
NOTE: NPCs were derived from H9 cells using a dual-Smad inhibition protocol, as described previously19.
<ol>
	<li>Briefly, treat H9 cells with cell dissociation reagent at 37 &#176;C for 5 min to generate single cells and resuspend in complete growth media containing mTeSR1 supplemented with 10 ng/mL basic fibroblast growth factor (bFGF), penicillin/streptomycin (P/S), and 10 &#181;M ROCK Inhibitor (RI). Seed on 1:50 diluted Matrigel-coated 6-well cell culture dishes at a density of 60,000 cells/cm2 (day 0).</li>
	<li>Initiate differentiation when the cells reach 95%-100% confluency by changing to 100% KSR media containing LDN193189 (200 nM), and SB431542 (10 &#181;M) (day1).</li>
	<li>On day 2, change the media again with 100% KSR supplemented with LDN193189 (200 nM), SB431542 (10 &#181;M), and XAV939 (5 &#181;M).</li>
	<li>On day 4 of differentiation, switch to a mixture of KSR medium (75%) and N2 medium (25%) with LDN193189 (200 nM), SB431542 (10 &#181;M), and XAV939 (5 &#181;M).</li>
	<li>From day 6 to day 12, gradually switch the media to 100% N2 supplemented with LDN193189 (200 nM), SB431542 (10 &#181;M), and XAV939 (5 &#181;M) by increasing the N2 media 25% each day and changing the media after every 2 days.</li>
	<li>Culture day 12 NPCs in N2:B27 media supplemented with 20 ng/mL bFGF.</li>
	<li>Seed 2 x 105 cells in each well of a 1:50 diluted complete basement membrane matrix-coated P6-plate in 2 mL of NPCs culture media and incubate to allow the cells to attach.</li>
	<li>The next day, infect the cells with lentiviral particles at an MOI 6 in the presence of 8 &#181;g/mL polybrene.</li>
	<li>After 8 h, replace the virus-containing media with fresh NPC growth media.</li>
	<li>The next day, repeat the infections and change the media at 8 h.</li>
	<li>Keep the cells in culture for 72 h before harvesting for further analysis.</li>
</ol>

<ol>
	<li>Thomson, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Embryonic+stem+cell+lines+derived+from+human+blastocysts.">Embryonic stem cell lines derived from human blastocysts.</a> Science. 282 (5391), 1145-1147 (1998).</li><li>Reubinoff, B. E., Pera, M. F., Fong, C. Y., Trounson, A., Bongso, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Embryonic+stem+cell+lines+from+human+blastocysts:+Somatic+differentiation+in+vitro.">Embryonic stem cell lines from human blastocysts: Somatic differentiation in vitro.</a> Nature Biotechnology. 18 (4), 399-404 (2000).</li><li>Strulovici, Y., Leopold, P. L., O'Connor, T. P., Pergolizzi, R. G., Crystal, R. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+embryonic+stem+cells+and+gene+therapy.">Human embryonic stem cells and gene therapy.</a> Molecular Therapy. 15 (5), 850-866 (2007).</li><li>Kane, N., McRae, S., Denning, C., Baker, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+and+nonviral+gene+delivery+and+its+role+in+pluripotent+stem+cell+engineering.">Viral and nonviral gene delivery and its role in pluripotent stem cell engineering.</a> Drug Discovery Today. Technologies. 5 (4), 105 (2008).</li><li>Li, S. D., Huang, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonviral+is+superior+to+viral+gene+delivery.">Nonviral is superior to viral gene delivery.</a> Journal of Controlled Release. 123 (3), 181-183 (2007).</li><li>Mastrobattista, E., Bravo, S. A., vander Aa, M., Crommelin, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonviral+gene+delivery+systems:+From+simple+transfection+agents+to+artificial+viruses.">Nonviral gene delivery systems: From simple transfection agents to artificial viruses.</a> Drug Discovery Today. Technologies. 2 (1), 103-109 (2005).</li><li>Cao, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+gene-transfer+efficiency+in+human+embryonic+stem+cells.">Comparison of gene-transfer efficiency in human embryonic stem cells.</a> Molecular Imaging and Biology. 12 (1), 15-24 (2010).</li><li>Mohr, J. C., de Pablo, J. J., Palecek, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electroporation+of+human+embryonic+stem+cells:+Small+and+macromolecule+loading+and+DNA+transfection.">Electroporation of human embryonic stem cells: Small and macromolecule loading and DNA transfection.</a> Biotechnology Progress. 22 (3), 825-834 (2006).</li><li>Sukhorukov, V. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Surviving+high-intensity+field+pulses:+Strategies+for+improving+robustness+and+performance+of+electrotransfection+and+electrofusion.">Surviving high-intensity field pulses: Strategies for improving robustness and performance of electrotransfection and electrofusion.</a> The Journal of Membrane Biology. 206 (3), 187-201 (2005).</li><li>Floch, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cationic+phosphonolipids+as+non+viral+vectors+for+DNA+transfection+in+hematopoietic+cell+lines+and+CD34++cells.">Cationic phosphonolipids as non viral vectors for DNA transfection in hematopoietic cell lines and CD34+ cells.</a> Blood Cells, Molecules and Diseases. 23 (1), 69-87 (1997).</li><li>Lakshmipathy, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+transfection+of+embryonic+and+adult+stem+cells.">Efficient transfection of embryonic and adult stem cells.</a> Stem Cells. 22 (4), 531-543 (2004).</li><li>Siemen, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nucleofection+of+human+embryonic+stem+cells.">Nucleofection of human embryonic stem cells.</a> Stem Cells and Development. 14 (4), 378-383 (2005).</li><li>Zhang, X., Godbey, W. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+vectors+for+gene+delivery+in+tissue+engineering.">Viral vectors for gene delivery in tissue engineering.</a> Advanced Drug Delivery Reviews. 58 (4), 515-534 (2006).</li><li>Ma, Y., Ramezani, A., Lewis, R., Hawley, R. G., Thomson, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-level+sustained+transgene+expression+in+human+embryonic+stem+cells+using+lentiviral+vectors.">High-level sustained transgene expression in human embryonic stem cells using lentiviral vectors.</a> Stem Cells. 21 (1), 111-117 (2003).</li><li>Gropp, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stable+genetic+modification+of+human+embryonic+stem+cells+by+lentiviral+vectors.">Stable genetic modification of human embryonic stem cells by lentiviral vectors.</a> Molecular Therapy. 7 (2), 281-287 (2003).</li><li>Tan, E., Chin, C. S. H., Lim, Z. F. S., Ng, S. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HEK293+cell+line+as+a+platform+to+produce+recombinant+proteins+and+viral+vectors.">HEK293 cell line as a platform to produce recombinant proteins and viral vectors.</a> Frontiers in Bioengineering and Biotechnology. 9, 796991 (2021).</li><li>Merten, O. W., Hebben, M., Bovolenta, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+lentiviral+vectors.">Production of lentiviral vectors.</a> Molecular Therapy: Methods &amp; Clinical Development. 3, 16017 (2016).</li><li>Lungwitz, U., Breunig, M., Blunk, T., G&#246;pferich, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyethylenimine-based+nonviral+gene+delivery+systems.">Polyethylenimine-based nonviral gene delivery systems.</a> European Journal of Pharmaceutics and Biopharmaceutics. 60 (2), 247-266 (2005).</li><li>Parween, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Higher+O-GlcNAc+levels+are+associated+with+defects+in+progenitor+proliferation+and+premature+neuronal+differentiation+during+in-vitro+human+embryonic+cortical+neurogenesis.">Higher O-GlcNAc levels are associated with defects in progenitor proliferation and premature neuronal differentiation during in-vitro human embryonic cortical neurogenesis.</a> Frontiers in Cellular Neuroscience. 11, 415 (2017).</li><li>Weissinger, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+transfer+in+purified+human+hematopoietic+peripheral-blood+stem+cells+by+means+of+electroporation+without+prestimulation.">Gene transfer in purified human hematopoietic peripheral-blood stem cells by means of electroporation without prestimulation.</a> Journal of Laboratory and Clinical Medicine. 141 (2), 138-149 (2003).</li><li>Cui, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeting+transgene+expression+to+antigen-presenting+cells+derived+from+lentivirus-transduced+engrafting+human+hematopoietic+stem/progenitor+cells.">Targeting transgene expression to antigen-presenting cells derived from lentivirus-transduced engrafting human hematopoietic stem/progenitor cells.</a> Blood. 99 (2), 399-408 (2002).</li><li>Yu, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lentiviral+vectors+with+two+independent+internal+promoters+transfer+high-level+expression+of+multiple+transgenes+to+human+hematopoietic+stem-progenitor+cells.">Lentiviral vectors with two independent internal promoters transfer high-level expression of multiple transgenes to human hematopoietic stem-progenitor cells.</a> Molecular Therapy. 7 (6), 827-838 (2003).</li><li>Sweeney, N. P., Vink, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+impact+of+lentiviral+vector+genome+size+and+producer+cell+genomic+to+gag-pol+mRNA+ratios+on+packaging+efficiency+and+titre.">The impact of lentiviral vector genome size and producer cell genomic to gag-pol mRNA ratios on packaging efficiency and titre.</a> Molecular Therapy - Methods &amp; Clinical Development. 21, 574-584 (2021).</li></ol>

The authors declare that there is no conflict of interest.

The ability to genetically modify stem cells for study or clinical purposes is limited both by technology and the basic understanding of the biology of hESCs. Techniques that have shown significant potential in mouse ESCs, like lipofection and electroporation, are not highly efficient for hESCs, which are notoriously difficult for gene delivery by conventional methods20. This notion has led to not only the optimization of existing techniques but also the development of novel methods for increased ...

Human embryonic stem cells (hESCs) derived from the blastocyst inner cell mass are pluripotent and can be differentiated into different cell types depending upon external factors under in vitro conditions1,2. In order to fully harness the potential of hESCs, it is imperative to have rapid and reliable gene delivery methods for these cells. Conventionally, the techniques used can be broadly classified into two types: nonviral and viral gene delivery systems3,4. The more frequently used nonviral gene delivery systems are lipofection, electroporation, and nucleofection. Nonviral delivery systems are advantageous because of fewer insertion mutations and an overall decrease in immunogenicity5,6. However, these methods result in low transfection efficiency and a short duration of transient gene expression, which is a major limitation for long-term differentiation studies7. Electroporation results in better transfection efficiencies compared to lipofection; however, it results in more than 50% cell death8,9,10. Using nucleofection, the cell survival and transfection efficiency can be improved by combining lipofection and electroporation, but the approach needs cell-specific buffers and specialized equipment and, thus, becomes quite costly for scaled-up applications11,12.
In contrast, viral vectors have shown improved transfection efficiencies, as well as overall low cytotoxicity, following transduction. In addition, the genes delivered are stably expressed and, hence, make this method ideal for long-term studies13. Among the most commonly used viral vectors for gene delivery into hESCs are lentiviral vectors (LVS), which can give more than 80% transduction efficiency using high titer viral particles14,15. Lipofection and CaPO4 precipitation are amongst the most commonly used methods to transiently transfect HEK293T cells or its derivatives with gene transfer vectors along with packaging plasmids to yield lentiviral particles16. Although lipofection results in good transfection efficiency and low cytotoxicity, the technique is hampered by its cost, and scaling up to get high titer lentiviral particles would be very costly. CaPO4 precipitation results in relatively similar transfection efficiencies to those obtained using lipofection. Although cost-effective, CaPO4 precipitation results in significant cell death following transfections, which makes it difficult to standardize and to avoid batch-to-batch variations17. In this scenario, developing a method that gives high transfection efficiency, low cytotoxicity, and cost-effectiveness is crucial for the production of high titer lentiviral particles to be used in hESCs.
Polyethylenimine (PEI) is a cationic polymer that can transfect HEK293T cells at high efficiency without much cytotoxicity and has a negligible cost compared to lipofection-based methods18. In this situation, PEI can be used for scaled-up applications of high titer LVS production through the concentration of lentiviral particles from culture supernatants using various techniques. The presented article describes the use of PEI to transfect HEK293T cells and lentiviral vector concentration using ultracentrifugation through a sucrose cushion. Using this method, we regularly obtain titers well above 5 x 107 IU/mL with low batch-to-batch variations. The method is simple, straight-forward, and cost-effective for scaled-up applications for gene delivery to hESCs and hESCs-derived cells.

<table><tbody><tr><td>2-Mercaptoethanol</td><td>Invitrogen</td><td>31350010</td><td></td></tr><tr><td>38.5 mL, Sterile + Certified Free Open-Top Thinwall Ultra-Clear Tubes</td><td>Beckman Coulter</td><td>C14292</td><td></td></tr><tr><td>Accutase</td><td>Stem Cell Technologies</td><td>7920</td><td></td></tr><tr><td>bFGF Recombinant human</td><td>Invitrogen</td><td>PHG0261</td><td></td></tr><tr><td>Bovine serum albumin FRAC V</td><td>Invitrogen</td><td>15260037</td><td></td></tr><tr><td>Corning Matrigel Basement Membrane Matrix, LDEV-free</td><td>Corning</td><td>354234</td><td></td></tr><tr><td>Cyclopamine</td><td>Stem Cell Technologies</td><td>72074</td><td></td></tr><tr><td>DMEM media</td><td>Invitrogen</td><td>11995073</td><td></td></tr><tr><td>DMEM Nutrient mix F12&amp;nbsp;</td><td>Invitrogen</td><td>11320033</td><td></td></tr><tr><td>DPBS w/o: Ca and Mg</td><td>PAN Biotech</td><td>P04-36500</td><td></td></tr><tr><td>Fetal bovie serum</td><td>Invitrogen</td><td>10270106</td><td></td></tr><tr><td>GAPDH (14C10) Rabbit mAb Antibody</td><td>CST</td><td>2118S</td><td></td></tr><tr><td>Gentle Cell Dissociation Reagent</td><td>Stem Cell Technologies</td><td>7174</td><td></td></tr><tr><td>HyClone Non Essential Amino Acids (NEAA) 100X Solution</td><td>GE healthcare</td><td>SH30238.01</td><td></td></tr><tr><td>L Glutamine, 100X&amp;nbsp;</td><td>Invitrogen</td><td>2924190090</td><td></td></tr><tr><td>L2HGDH Polyclonal antibody</td><td>Proteintech</td><td>15707-1-AP</td><td></td></tr><tr><td>L2HGDH shRNA</td><td>Macrogen</td><td></td><td>Seq: CGCATTCTTCATGTGAGAAAT</td></tr><tr><td>Lipofectamine 3000 kit</td><td>Thermo Fisher</td><td>L3000001</td><td></td></tr><tr><td>mTesR1 complete media</td><td>Stem Cell Technologies</td><td>85850</td><td></td></tr><tr><td>Neurobasal medium 1X CTS</td><td>Invitrogen</td><td>A1371201</td><td></td></tr><tr><td>Neuropan 2 Supplement 100x</td><td>PAN Biotech</td><td>P07-11050</td><td></td></tr><tr><td>Neuropan 27 Supplement 50x</td><td>PAN Biotech</td><td>P07-07200</td><td></td></tr><tr><td>Penicillin streptomycin SOL</td><td>Invitrogen</td><td>15140122</td><td></td></tr><tr><td>pLKO.1 TRC vector</td><td>Addgene</td><td>10878</td><td></td></tr><tr><td>pLL3.7 vector&amp;nbsp;</td><td>Addgene</td><td>11795</td><td></td></tr><tr><td>pMD2.G</td><td>Addgene</td><td>12259</td><td></td></tr><tr><td>Polybrene infection reagent</td><td>Sigma</td><td>TR1003- G</td><td></td></tr><tr><td>Polyethylenimine, branched</td><td>Sigma</td><td>408727</td><td></td></tr><tr><td>psPAX2.0</td><td>Addgene</td><td>12260</td><td></td></tr><tr><td>Purmorphamine</td><td>Tocris</td><td>4551/10</td><td></td></tr><tr><td>Puromycin</td><td>Invitrogen</td><td>A1113802</td><td></td></tr><tr><td>ROCK inhibitor Y-27632&lt;br/&gt; dihydrochloride&amp;nbsp;</td><td>Tocris</td><td>1254</td><td></td></tr><tr><td>SB 431542</td><td>Tocris</td><td>1614/10</td><td></td></tr><tr><td>Trypsin .05% EDTA&amp;nbsp;</td><td>Invitrogen</td><td>25300062</td><td></td></tr><tr><td>XAV 939</td><td>Tocris</td><td>3748/10</td><td></td></tr></tbody></table>

lentiviral mediated delivery of shrnas to hescs and npcs using low-cost cationic polymer polyethylenimine (pei)

The current protocol describes the use of lentiviral particles for the delivery of short hairpin RNAs (shRNAs) to both human embryonic stem cells (hESCs) as well as neural progenitor cells (NPCs) derived from hESCs at high efficiency. Lentiviral particles were generated by co-transfecting HEK293T cells using entry vectors (carrying shRNAs) along with packaging plasmids (pAX and pMD2.G) using the low-cost cationic polymer polyethylenimine (PEI). Viral particles were concentrated using ultracentrifugation, which resulted in average titers above 5 x 107. Both hESCs and NPCs could be infected at high efficiencies using these lentiviral particles, as shown by puromycin selection and stable expression in hESCs, as well as transient GFP expression in NPCs. Furthermore, western blot analysis showed a significant reduction in the expression of genes targeted by shRNAs. In addition, the cells retained their pluripotency as well as differentiation potential, as evidenced by their subsequent differentiation into different lineages of CNS. The current protocol deals with the delivery of shRNAs; however, the same approach could be used for the ectopic expression of cDNAs for overexpression studies.

Following gene transfer, high viability of hESCs is inevitably required. Despite the efforts and optimization of protocols to reduce cell death following electroporation of hESCs, more than 50% cell death is still observed after electroporation of these cells, along with low transfection efficiency20. Lentiviral mediated gene transfer not only results in high efficiency of gene transfer but also demonstrates high levels of cell viability following transduction. The results below present two approa...

Watch this Scientific Journal Video about Lentiviral Mediated Delivery of shRNAs to hESCs and NPCs Using Low-cost Cationic Polymer Polyethylenimine PEI at JoVE.com

Lentiviral Mediated Delivery of shRNAs to hESCs and NPCs Using Low-cost Cationic Polymer Polyethylenimine PEI

Using the low-cost cationic polymer polyethylenimine (PEI), we produced lentiviral particles for stable expression of shRNAs in H9 human embryonic stem cells (hESCs) and transiently transduced H9-derived neural progenitor cells (NPCs) at high efficiency.

Lentiviral Mediated Delivery of shRNAs to hESCs and NPCs Using Low-cost Cationic Polymer Polyethylenimine (PEI)

The current protocol describes the use of lentiviral particles for the delivery of short hairpin RNAs (shRNAs) to both human embryonic stem cells (hESCs) ...

lentiviral-mediated-delivery-shrnas-to-hescs-npcs-using-low-cost

Universidad de Cartagena UDEC

Research

JoVE Journal

Biology

2.3K Views.  United Arab Emirates University. Using the low-cost cationic polymer polyethylenimine (PEI), we produced lentiviral particles for stable expression of shRNAs in H9 human embryonic stem cells (hESCs) and transiently transduced H9-derived neural progenitor cells (NPCs) at high efficiency. 

Video: Lentiviral Mediated Delivery of shRNAs to hESCs and NPCs Using Low-cost Cationic Polymer Polyethylenimine PEI

High efficiency, Site-specific Transfection of Adherent Cells with siRNA Using Microelectrode Arrays (MEA)

The discovery of RNAi pathway in eukaryotes and the subsequent development of RNAi agents, such as siRNA and shRNA, have achieved a potent method for silencing specific genes1-8 for functional genomics and therapeutics. A major challenge involved in RNAi based studies is the delivery of RNAi agents to targeted cells. Traditional non-viral delivery techniques, such as bulk electroporation and chemical transfection methods often lack the necessary spatial control over delivery and afford poor transfection efficiencies9-12. Recent advances in chemical transfection methods such as cationic lipids, cationic polymers and nanoparticles have resulted in highly enhanced transfection efficiencies13. However, these techniques still fail to offer precise spatial control over delivery that can immensely benefit miniaturized high-throughput technologies, single cell studies and investigation of cell-cell interactions. 
Recent technological advances in gene delivery have enabled high-throughput transfection of adherent cells14-23, a majority of which use microscale electroporation. Microscale electroporation offers precise spatio-temporal control over delivery (up to single cells) and has been shown to achieve high efficiencies19, 24-26. Additionally, electroporation based approaches do not require a prolonged period of incubation (typically 4 hours) with siRNA and DNA complexes as necessary in chemical based transfection methods and lead to direct entry of naked siRNA and DNA molecules into the cell cytoplasm. As a consequence gene expression can be achieved as early as six hours after transfection27. Our lab has previously demonstrated the use of microelectrode arrays (MEA) for site-specific transfection in adherent mammalian cell cultures17-19. In the MEA based approach, delivery of genetic payload is achieved via localized micro-scale electroporation of cells. An application of electric pulse to selected electrodes generates local electric field that leads to electroporation of cells present in the region of the stimulated electrodes. The independent control of the micro-electrodes provides spatial and temporal control over transfection and also enables multiple transfection based experiments to be performed on the same culture increasing the experimental throughput and reducing culture-to-culture variability. 
Here we describe the experimental setup and the protocol for targeted transfection of adherent HeLa cells with a fluorescently tagged scrambled sequence siRNA using electroporation. The same protocol can also be used for transfection of plasmid vectors. Additionally, the protocol described here can be easily extended to a variety of mammalian cell lines with minor modifications. Commercial availability of MEAs with both pre-defined and custom electrode patterns make this technique accessible to most research labs with basic cell culture equipment.

High efficiency, Site-specific Transfection of Adherent Cells with siRNA Using Microelectrode Arrays MEA

The article details the protocol for site-specific transfection of scrambled sequence of siRNA in an adherent mammalian cell culture using a microelectrode array (MEA).

The discovery of RNAi pathway in eukaryotes and the subsequent development of RNAi agents, such as siRNA and shRNA, have achieved a potent method for ...

Bioengineering

Evaluation of Polymeric Gene Delivery Nanoparticles by Nanoparticle Tracking Analysis and High-throughput Flow Cytometry

Non-viral gene delivery using polymeric nanoparticles has emerged as an attractive approach for gene therapy to treat genetic diseases1 and as a technology for regenerative medicine2. Unlike viruses, which have significant safety issues, polymeric nanoparticles can be designed to be non-toxic, non-immunogenic, non-mutagenic, easier to synthesize, chemically versatile, capable of carrying larger nucleic acid cargo and biodegradable and/or environmentally responsive. Cationic polymers self-assemble with negatively charged DNA via electrostatic interaction to form complexes on the order of 100 nm that are commonly termed polymeric nanoparticles. Examples of biomaterials used to form nanoscale polycationic gene delivery nanoparticles include polylysine, polyphosphoesters, poly(amidoamines)s and polyethylenimine (PEI), which is a non-degradable off-the-shelf cationic polymer commonly used for nucleic acid delivery1,3 . Poly(beta-amino ester)s (PBAEs) are a newer class of cationic polymers4 that are hydrolytically degradable5,6 and have been shown to be effective at gene delivery to hard-to-transfect cell types such as human retinal endothelial cells (HRECs)7, mouse mammary epithelial cells8, human brain cancer cells9 and macrovascular (human umbilical vein, HUVECs) endothelial cells10.
A new protocol to characterize polymeric nanoparticles utilizing nanoparticle tracking analysis (NTA) is described. In this approach, both the particle size distribution and the distribution of the number of plasmids per particle are obtained11. In addition, a high-throughput 96-well plate transfection assay for rapid screening of the transfection efficacy of polymeric nanoparticles is presented. In this protocol, poly(beta-amino ester)s (PBAEs) are used as model polymers and human retinal endothelial cells (HRECs) are used as model human cells. This protocol can be easily adapted to evaluate any polymeric nanoparticle and any cell type of interest in a multi-well plate format.

A protocol for nanoparticle tracking analysis (NTA) and high-throughput flow cytometry to evaluate polymeric gene delivery nanoparticles is described. NTA is utilized to characterize the nanoparticle particle size distribution and the plasmid per particle distribution. High-throughput flow cytometry enables quantitative transfection efficacy evaluation for a library of gene delivery biomaterials.

Non-viral gene delivery using polymeric nanoparticles has emerged as an attractive approach for gene therapy to treat genetic diseases1 and as a ...

Lentiviral Vector Platform for the Efficient Delivery of Epigenome-editing Tools into Human Induced Pluripotent Stem Cell-derived Disease Models

The use of hiPSC-derived cells represents a valuable approach to study human neurodegenerative diseases. Here, we describe an optimized protocol for the differentiation of hiPSCs derived from a patient with the triplication of the alpha-synuclein gene (SNCA) locus into Parkinson&#8217;s disease (PD)-relevant dopaminergic neuronal populations. Accumulating evidence has shown that high levels of SNCA are causative for the development of PD. Recognizing the unmet need to establish novel therapeutic approaches for PD, especially those targeting the regulation of SNCA expression, we recently developed a CRISPR/dCas9-DNA-methylation-based system to epigenetically modulate SNCA transcription by enriching methylation levels at the SNCA intron 1 regulatory region. To deliver the system, consisting of a dead (deactivated) version of Cas9 (dCas9) fused with the catalytic domain of the DNA methyltransferase enzyme 3A (DNMT3A), a lentiviral vector is used. This system is applied to cells with the triplication of the SNCA locus and reduces the SNCA-mRNA and protein levels by about 30% through the targeted DNA methylation of SNCA intron 1. The fine-tuned downregulation of the SNCA levels rescues disease-related cellular phenotypes. In the current protocol, we aim to describe a step-by-step procedure for differentiating hiPSCs into neural progenitor cells (NPCs) and the establishment and validation of pyrosequencing assays for the evaluation of the methylation profile in the SNCA intron 1. To outline in more detail the lentivirus-CRISPR/dCas9 system used in these experiments, this protocol describes how to produce, purify, and concentrate lentiviral vectors and to highlight their suitability for epigenome- and genome-editing applications using hiPSCs and NPCs. The protocol is easily adaptable and can be used to produce high titer lentiviruses for in vitro and in vivo applications.

Targeted DNA epigenome editing represents a powerful therapeutic approach. This protocol describes the production, purification, and concentration of all-in-one lentiviral vectors harboring the CRISPR-dCas9-DNMT3A transgene for epigenome-editing applications in human induced pluripotent stem cell (hiPSC)-derived neurons.

The use of hiPSC-derived cells represents a valuable approach to study human neurodegenerative diseases. Here, we describe an optimized protocol for the ...

Genetics

Delivery of Therapeutic siRNA to the CNS Using Cationic and Anionic Liposomes

Prion diseases result from the misfolding of the normal, cellular prion protein (PrPC) to an abnormal protease resistant isomer called PrPRes. The emergence of prion diseases in wildlife populations and their increasing threat to human health has led to increased efforts to find a treatment for these diseases. Recent studies have found numerous anti-prion compounds that can either inhibit the infectious PrPRes isomer or down regulate the normal cellular prion protein. However, most of these compounds do not cross the blood brain barrier to effectively inhibit PrPRes formation in brain tissue, do not specifically target neuronal PrPC, and are often too toxic to use in animal or human subjects. 
We investigated whether siRNA delivered intravascularly and targeted towards neuronal PrPC is a safer and more effective anti-prion compound. This report outlines a protocol to produce two siRNA liposomal delivery vehicles, and to package and deliver PrP siRNA to neuronal cells. The two liposomal delivery vehicles are 1) complexed-siRNA liposome formulation using cationic liposomes (LSPCs), and 2) encapsulated-siRNA liposome formulation using cationic or anionic liposomes (PALETS). For the LSPCs, negatively charged siRNA is electrostatically bound to the cationic liposome. A positively charged peptide (RVG-9r [rabies virus glycoprotein]) is added to the complex, which specifically targets the liposome-siRNA-peptide complexes (LSPCs) across the blood brain barrier (BBB) to acetylcholine expressing neurons in the central nervous system (CNS). For the PALETS (peptide addressed liposome encapsulated therapeutic siRNA), the cationic and anionic lipids were rehydrated by the PrP siRNA. This procedure results in encapsulation of the siRNA within the cationic or anionic liposomes. Again, the RVG-9r neuropeptide was bound to the liposomes to target the siRNA/liposome complexes to the CNS. Using these formulations, we have successfully delivered PrP siRNA to AchR-expressing neurons, and decreased the PrPC expression of neurons in the CNS.

The goal of this protocol is to use cationic/anionic liposomes with a neuro-targeting peptide as a CNS delivery system to enable siRNA to cross the BBB. The optimization of a delivery system for treatments, like siRNA, would allow for more treatment options for prion and other neurodegenerative diseases.

Prion diseases result from the misfolding of the normal, cellular prion protein (PrPC) to an abnormal protease resistant isomer called PrPRes.  The ...

Generation of Cationic Nanoliposomes for the Efficient Delivery of In Vitro Transcribed Messenger RNA

The development of messenger RNA (mRNA)-based therapeutics for the treatment of various diseases becomes more and more important because of the positive properties of in vitro transcribed (IVT) mRNA. With the help of IVT mRNA, the de novo synthesis of a desired protein can be induced without changing the physiological state of the target cell. Moreover, protein biosynthesis can be precisely controlled due to the transient effect of IVT mRNA.
For the efficient transfection of cells, nanoliposomes (NLps) may represent a safe and efficient delivery vehicle for therapeutic mRNA. This study describes a protocol to generate safe and efficient cationic NLps consisting of DC-cholesterol and 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) as a delivery vector for IVT mRNA. NLps having a defined size, a homogeneous distribution, and a high complexation capacity, and can be produced using the dry-film method. Moreover, we present different test systems to analyze their complexation and transfection efficacies using synthetic enhanced green fluorescent protein (eGFP) mRNA, as well as their effect on cell viability. Overall, the presented protocol provides an effective and safe approach for mRNA complexation, which may advance and improve the administration of therapeutic mRNA.

Generation of Cationic Nanoliposomes for the Efficient Delivery of In Vitro Transcribed Messenger RNA

Here we describe a protocol for the generation of cationic nanoliposomes, which is based on the dry-film method and can be used for the safe and efficient delivery of in vitro transcribed messenger RNA.

The development of messenger RNA (mRNA)-based therapeutics for the treatment of various diseases becomes more and more important because of the positive ...

Transduction of Human Cells with Polymer-complexed Ecotropic Lentivirus for Enhanced Biosafety

Stem and tumor cell biology studies often require viral transduction of human cells with known or suspected oncogenes, raising major safety issues for laboratory personnel. Pantropic lentiviruses, such as the commonly used VSV-G pseudotype, are a valuable tool for studying gene function because they can transduce many cell types, including non-dividing cells. However, researchers may wish to avoid production and centrifugation of pantropic viruses encoding oncogenes due to higher biosafety level handling requirements and safety issues. Several potent oncogenes, including c-Myc and SV40 large T antigen, are known to enhance production of induced pluripotent stem cells (iPSC). All other known iPSC-inducing genetic changes (OCT4, SOX2, KLF4, NANOG, LIN28, and p53 loss of function) also have links to cancer, making them of relatively high safety concern as well. 
While these cancer-related viruses are useful in studying cellular reprogramming and pluripotency, they must be used safely. To address these biosafety issues, we demonstrate a method for transduction of human cells with ecotropic lentivirus, with additional emphasis on reduced cost and convenient handling. We have produced ecotropic lentivirus with sufficiently high titer to transduce greater than 90% of receptor-expressing human cells exposed to the virus, validating the efficacy of this approach. 
Lentivirus is often concentrated by ultracentrifugation; however, this process takes several hours and can produce aerosols infectious to human biomedical researchers. As an alternative, viral particles can be more safely sedimented onto cells by complexation with chondroitin sulfate and polybrene (CS/PB). This technique increases the functional viral titer up to 3-fold in cells stably expressing murine retrovirus receptor, with negligible added time and cost. Transduction of human dermal fibroblasts (HDFs) is maximally enhanced using CS/PB concentrations approximately 4-fold lower than the optimal value previously reported for cancer cell lines, suggesting that polymer concentration should be titrated for the target cell type of interest. We therefore describe the use of methylthiazolyldiphenyl-tetrazolium bromide (MTT) to assay for polymer toxicity in a new cell type. We observe equivalent viability of HDFs after viral transduction using either polymer complexation or the standard dose of polybrene (PB, 6 &mu;g/ml), indicating minimal acute toxicity.
In this protocol, we describe the use of ecotropic lentivirus for overexpression of oncogenes in human cells, reducing biosafety risks and increasing the transduction rate. We also demonstrate the use of polymer complexation to enhance transduction while avoiding aerosol-forming centrifugation of viral particles.

Lentiviruses are a valuable research tool for exploring gene function; however, researchers may wish to avoid production of pantropic lentivirus encoding known or suspected oncogenes. As an alternative, we present a safer protocol for use of ecotropic lentivirus on human cells modified to express the ecotropic receptor mSlc7a1.

Stem and tumor cell biology studies often require viral transduction of human cells with known or suspected oncogenes, raising major safety issues for ...

Preparation of Neutrally-charged, pH-responsive Polymeric Nanoparticles for Cytosolic siRNA Delivery

The success of siRNA as a targeted molecular medicine is dependent upon its efficient cytosolic delivery to cells within the tissue of pathology. Clinical success for treating previously &#8216;undruggable&#8217; hepatic disease targets with siRNA has been achieved. However, efficient tumor siRNA delivery necessitates additional pharmacokinetic design considerations, including long circulation time, evasion of clearance organs (e.g., liver and kidneys), and tumor penetration and retention. Here, we describe the preparation and in vitro physicochemical/biological characterization of polymeric nanoparticles designed for efficient siRNA delivery, particularly to non-hepatic tissues such as tumors. The siRNA nanoparticles are prepared by electrostatic complexation of siRNA and the diblock copolymer poly(ethylene glycol-b-[2-(dimethylamino)ethyl methacrylate-co-butyl methacrylate]) (PEG-DB) to form polyion complexes (polyplexes) where siRNA is sequestered within the polyplex core and PEG forms a hydrophilic, neutrally-charged corona. Moreover, the DB block becomes membrane-lytic as vesicles of the endolysosomal pathway acidify (&#60; pH 6.8), triggering endosomal escape and cytosolic delivery of siRNA. Methods to characterize the physicochemical characteristics of siRNA nanoparticles such as size, surface charge, particle morphology, and siRNA loading are described. Bioactivity of siRNA nanoparticles is measured using luciferase as a model gene in a rapid and high-throughput gene silencing assay. Designs which pass these initial tests (such as PEG-DB-based polyplexes) are considered appropriate for translation to preclinical animal studies assessing the delivery of siRNA to tumors or other sites of pathology.

Methods to prepare and characterize the physicochemical properties and bioactivity of neutrally-charged, pH-responsive siRNA nanoparticles are presented. Criteria for successful siRNA nanomedicines such as size, morphology, surface charge, siRNA loading, and gene silencing are discussed.

The success of siRNA as a targeted molecular medicine is dependent upon its efficient cytosolic delivery to cells within the tissue of pathology. Clinical ...

Molecular Modulation by Lentivirus-Delivered Specific shRNAs in Endoplasmic Reticulum Stressed Neurons

The accumulation of unfolded proteins within the endoplasmic reticulum (ER), caused by any stress condition, triggers the unfolded protein response (UPR) through the activation of specialized sensors. UPR attempts first to restore homeostasis; but if damage persists the signaling induces apoptosis.
There is increasing evidence that sustained and unresolved ER stress contributes to many pathological conditions including neurodegenerative diseases. Because the UPR controls cell fate by switching between cytoprotective and apoptotic processes, it is essential to understand the events defining this transition, as well as the elements involved in its modulation.
Recently, we demonstrated that abnormal GM2 ganglioside accumulation causes depletion of ER Ca2+ content, which in turn activates PERK (PKR-like-ER kinase), one of the UPR sensors. Furthermore, PERK signaling participates in the neurite atrophy and apoptosis induced by GM2 accumulation. In this respect, we have established an experimental system that allows us to molecularly modulate the expression of downstream PERK components and thus change vulnerability of neurons to undergo neuritic atrophy.
We performed knockdown of calcineurin (cytoprotective) and CHOP (pro-apoptotic) expression in rat cortical neuronal cultures. Cells were infected with lentivirus-delivered specific shRNA and then treated with GM2 at different times, fixed and immunostained with anti-MAP2 (microtube-associated protein 2) antibody. Later, cell images were recorded using a fluorescence microscope and total neurite outgrowth was evaluated by using the public domain image processing software ImageJ. The inhibition of expression of those PERK signaling components clearly made it possible to either accelerate or delay the neuritic atrophy induced by ER stress.
This approach might be used in cell system models of ER stress to evaluate the vulnerability of neurons to neurite atrophy.

In the present study, the expression is knocked down of two downstream signaling components of the PERK pathway, the cytoprotective calcineurin and the pro-apoptotic CHOP, by using specific shRNAs. In opposite ways, these modulate the susceptibility of primary cortical neurons to neurite atrophy after induction of endoplasmic reticulum stress.

The accumulation of unfolded proteins within the endoplasmic reticulum (ER), caused by any stress condition, triggers the unfolded protein response (UPR) ...

Neuroscience

Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells

One major limitation with current human embryonic stem cell (ESC) differentiation protocols is the generation of heterogeneous cell populations.&#160;These cultures contain the cells of interest, but are also contaminated with undifferentiated ESCs, non-neural derivatives and other neuronal subtypes.&#160; This limits their use in in vitro and in vivo applications, such as in vitro modeling for drug discovery or cell replacement therapy. To help overcome this, reporter cell lines, which offer a means to visualize, track and isolate cells of interest, can be engineered.&#160;However, to achieve this in human embryonic stem cells via conventional homologous recombination is extremely inefficient.&#160;This protocol describes targeting of the Pituitary homeobox 3 (PITX3) locus in human embryonic stem cells using custom designed zinc-finger nucleases, which introduce site-specific double-strand DNA breaks, together with a PITX3-EGFP-specific DNA donor vector. Following the generation of the PITX3 reporter cell line, it can then be differentiated using published protocols for use in studies such as in vitro Parkinson&#8217;s disease modeling or cell replacement therapy.

Reporter cell lines offer a means to visualize, track and isolate cells of interest from heterogeneous populations.&#160;However, gene-targeting using conventional homologous recombination in human embryonic stem cells is extremely inefficient. Herein, we describe targeting CNS midbrain specific transcription factor PITX3 locus with EGFP using zinc-finger nuclease enhanced homologous recombination.

One major limitation with current human embryonic stem cell (ESC) differentiation protocols is the generation of heterogeneous cell ...

CRISPR-Cas9 Mediated Gene Deletion in Human Pluripotent Stem Cells Cultured Under Feeder-Free Conditions

The CRISPR-Cas9 system for genome editing has revolutionized gene function studies in mammalian cells, including stem cells. However, the practical application of this technique, particularly in pluripotent stem cells, presents certain challenges, such as being time- and labor-intensive and having low editing efficiency. Here, we describe the generation of a CRISPR-mediated gene knockout in a human embryonic stem cell (hESC) line stably expressing sgRNAs for the L2HGDH gene, using a highly efficient and stable lentiviral-mediated gene delivery system. The sgRNAs targeting exon 1 of the L2HGDH gene were chemically synthesized and cloned into the lentiCRISPR v2-puro vector, which combines the constitutive expression of sgRNAs with Cas9 in a highly efficient single-vector system to achieve higher lentiviral titers for hESC infection and stable selection using puromycin. Puromycin-selected cells were further expanded, and single-cell clones were obtained using the limited dilution method. The single clones were expanded, and several homozygous knockout clones for the L2HGDH gene were obtained, as confirmed by a 100% reduction in L2HGDH expression using Western blot analysis. Furthermore, using MSBSP-PCR, the CRISPR mutation site was mapped upstream of the PAM recognition sequence of Cas9 in the selected homozygous clones. Sanger sequencing was performed to analyze the exact insertions/deletions, and functional characterization of the clones was conducted. This method produced a significantly higher percentage of homozygous deletions compared to previously reported non-viral gene delivery methods. Although this report focuses on the L2HGDH gene, this robust and cost-effective approach can be used to create homozygous knockouts for other genes in pluripotent stem cells for gene function studies.

The presented method describes the generation of a CRISPR-mediated gene knockout in the human embryonic stem cell (hESC) line H9, which stably expresses sgRNAs targeting the L2HGDH gene using a highly efficient lentiviral-mediated gene delivery system.

The CRISPR-Cas9 system for genome editing has revolutionized gene function studies in mammalian cells, including stem cells. However, the practical ...

Lentiviral Mediated Delivery of shRNAs to hESCs and NPCs Using Low-cost Cationic Polymer Polyethylenimine (PEI)

Summary

Explore More Videos

Chapters in this video

High efficiency, Site-specific Transfection of Adherent Cells with siRNA Using Microelectrode Arrays (MEA)

Evaluation of Polymeric Gene Delivery Nanoparticles by Nanoparticle Tracking Analysis and High-throughput Flow Cytometry

Lentiviral Vector Platform for the Efficient Delivery of Epigenome-editing Tools into Human Induced Pluripotent Stem Cell-derived Disease Models

Delivery of Therapeutic siRNA to the CNS Using Cationic and Anionic Liposomes

Generation of Cationic Nanoliposomes for the Efficient Delivery of In Vitro Transcribed Messenger RNA

Transduction of Human Cells with Polymer-complexed Ecotropic Lentivirus for Enhanced Biosafety

Preparation of Neutrally-charged, pH-responsive Polymeric Nanoparticles for Cytosolic siRNA Delivery

Molecular Modulation by Lentivirus-Delivered Specific shRNAs in Endoplasmic Reticulum Stressed Neurons

Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells

CRISPR-Cas9 Mediated Gene Deletion in Human Pluripotent Stem Cells Cultured Under Feeder-Free Conditions