KitV558&#916;/+ mice were genetically engineered and shared by Dr. Peter Besmer10. This work was supported by NIH grants R01 CA102613 and T32 CA251063.

All mice were housed under pathogen-free conditions at the University of Pennsylvania according to NIH guidelines and with approval of the University of Pennsylvania IACUC. Euthanasia was performed following the University of Pennsylvania Laboratory Animal Resources standard operating procedures.
1. KitV558&#916;/+ mouse breeding
<ol>
	<li>Backcross the KitV558&#916;/+ mice more than 10 times onto a C57BL/6J background using C57BL/6J mice. To do this, breed the male KitV558&#916;/+ mice&#160;with female C57BL/6J mice at a 1:2 ratio. 
	NOTE: The homozygous KitV558&#916;/V558&#916; genotype is lethal in utero. It is possible to breed female KitV558&#916;/+ mice with male C57BL/6J mice, but litter size is about half as that seen from female wildtype C57BL/6J mice. Furthermore, female KitV558&#916;/+ mice&#160;produce limited litters after 4 months of age.</li>
	<li>Genotype the pups at 7-14 days of age by toe clipping to confirm the presence of the KitV558&#916;/+ genotype. Use the forward primer: TCTCCTCCAGAAACCCATGTATGAA; reporter 1: CCTCGACAACCTTCCA; reverse primer: TTGCGTCGGGTCTATGTAAACAT; and reporter 2: TCTCCTCGACCTTCCA for genotyping.</li>
</ol>
2. KitV558&#916;/+ mouse treatment
<ol>
	<li>Age and sex match the KitV558&#916;/+ mice prior to treatment. Use the age- and sex-matched mice in cohorts as tumors from female KitV558&#916;/+ mice are larger than those in male mice. Treat the mice at 8-12 weeks old, at which time tumors are established (Figure 1).</li>
	<li>Give tyrosine kinase inhibitors orally or by intraperitoneal (i.p.) injection; KitV558&#916;/+ tumors are sensitive to tyrosine kinase inhibitors. Provide imatinib in a dose of 600 mg/L in drinking water or i.p. injections of 45 mg/kg twice daily. Measure tumor weight reduction using digital scales after dissection of tumor as shown in step 3, which is approximately 50% at 1 week and 80% at 4 weeks following treatment with imatinib (Figure 2).</li>
</ol>
3. KitV558&#916;/+ mouse organ harvest
<ol>
	<li>Euthanize mice by CO2 narcosis at a flow rate of 60% chamber volume per min. Leave mice in the chamber for at least 2 min after respiration has ceased, then perform cervical dislocation to confirm death.</li>
	<li>Sterilize all instruments, wear gloves throughout the procedure, and maintain a sterile field. Prepare the skin with 70% ethanol. Make a 2 cm midline vertical incision using scissors and enter the abdominal cavity. Sharply lyse any intra-abdominal adhesions.</li>
	<li>To remove the draining mesenteric lymph node, follow the steps described below.
	<ol>
		<li>Identify the cecum and lift its mesentery superiorly. Approximately midway to the base of the colonic mesentery, identify the mesenteric lymph node and sharply dissect it. The lymph node is off-white and about 0.5 cm x 0.5 cm in size.</li>
		<li>Divide lymph node tissue into thirds for protein isolation, histology, and single cell suspension, as needed. For single cell suspensions, place lymph node tissue in 20 mL of serum free media (RPMI) and keep on ice.</li>
	</ol>
	</li>
	<li>For isolation of the GIST and cecum, follow the steps described below.
	<ol>
		<li>The cecum in KitV558&#916;/+ mice is mostly replaced by a GIST. Carefully divide the ileocolic junction from the base of the tumor. To collect the cecum, divide the colon again, 2 cm proximal to the base of the tumor.</li>
		<li>In 50%-60% of KitV558&#916;/+ mice, the head of the tumor contains a cap of cecal tissue, which typically contains serous fluid but may rarely contain pus (Figure 3). Sharply dissect the cap tissue away from the tumor tissue.</li>
		<li>Divide tumor tissue and/or cecum into thirds for protein isolation, histology, and single cell suspension, as needed. For single cell suspensions, place tumor tissue or cecum in HBSS with 2% FCS, enough to cover the sample and keep on ice.</li>
	</ol>
	</li>
</ol>
4. Western blot analysis of GIST tissue
<ol>
	<li>Prepare tissue lysis buffer containing 50 mM TrisHCl (pH 7.5), 150 mM NaCl, 5 mM EDTA, 1% nondenaturing detergent, 2 mM Na3VO4, 1 mM PMSF, 10 mM NaF, and 20 &#956;l/ml proteinase inhibitor mixture.</li>
	<li>Prepare a 1x Tris-buffered saline solution with 1% Tween 20 (TBST) by combining 1800 mL of deionized water, 2 mL of Tween 20, and 200 mL of 10x Tris-buffered saline (TBS).</li>
	<li>Resuspend tissue from step 3.4.3 in a FACS tube in 5mL/g of tissue lysis buffer and homogenize twice with a mechanical homogenizer at 15,000 rpm for 15 s on ice. Incubate lysate for 30 min on ice.</li>
	<li>Transfer lysate to a 1.5 mL microcentrifuge tube. Centrifuge at max speed for 20 min at 4 &#176;C. Transfer supernatant into a new microcentrifuge tube.</li>
	<li>Run lysates on a 4% to 15% gradient gel, then transfer to a nitrocellulose membrane, as described in14.</li>
	<li>Wash membrane once in 1x TBS for 5 min and then block membrane in 5% milk for 1 h. Again, wash membrane once in 1x TBS for 10 min.</li>
	<li>Incubate membrane in primary antibody diluted 1:1000 in 5% BSA at 4 &#176;C overnight. Wash membrane 3x in 1x TBST for 10 min each. Incubate blot with secondary antibody diluted 1:2500 in 2.5% milk for 1 h at room temperature.</li>
	<li>Wash membrane once in 1x TBS for 5 min. Add enough HRP substrate to cover membrane, typically 200-500 &#956;L, and use a digital imager to detect and quantify chemiluminescence.</li>
</ol>
5. Immunohistochemistry of GIST tissue
<ol>
	<li>Fix tissue from step 3.3.2 or 3.4.3 in 4% paraformaldehyde at 4 &#176;C overnight. Store tissue in 70% EtOH until ready for processing. Embed and section blocks at 5 &#956;m thickness onto glass slides, as described15,16.</li>
	<li>Complete immunohistochemical detection using a basic immunodetection kit, as previously described17.</li>
</ol>
6. Single cell suspension of mesenteric lymph node
<ol>
	<li>Pour RPMI media with lymph node specimen from step 3.3.2 over a 100 &#956;m filter. Move filter to new 50 mL conical and mash lymph node with the soft end of a 3 mL plastic syringe. Wash filter with 20 mL of RPMI media.</li>
	<li>Centrifuge the filtrate at 450 x g at 4 &#176;C for 5 min. Aspirate the supernatant.&#160;</li>
	<li>Resuspend pellet in 20 mL of 1% FBS in PBS (bead buffer) and pour over a 40 &#956;m filter. Collect the cell filtrate. Count cells using a hemocytometer.</li>
	<li>Centrifuge the filtrate at 450 x g at 4 &#176;C for 5 min. Aspirate the supernatant. Resuspend in bead buffer at 6 x 107 cells/mL for flow cytometry.</li>
</ol>
7. Single cell suspension of GIST
<ol>
	<li>Prepare collagenase buffer by adding 250 mg of collagenase IV, one tablet of EDTA-free protease inhibitor and 100 &#181;L of DNase I to 50 mL of HBSS. Rotate for 10 min at room temperature until dissolved.</li>
	<li>Place GIST in a sterile dish and add 2.5 mL of collagenase buffer. Mince tumor using a sterile scalpel and scissors until the tumor is in fine fragments. Use a large bore pipette to aspirate the tumor and collagenase into a 50 mL tube.</li>
	<li>Incubate in a shaking incubator at 100 rpm at 37 &#176;C for 30 min. Quench reaction with 2 mL of FBS.</li>
	<li>Pour collagenase with GIST specimen over a 100 &#956;m filter and mash tumor with the soft end of a 3 mL plastic syringe and collect in a 50 mL tube. Wash filter with 20 mL of HBSS. Centrifuge the filtrate at 450 x g, 4 &#176;C for 5 min. Aspirate the supernatant.</li>
	<li>Resuspend the pellet in 20 mL of bead buffer and pour over a 40 &#956;m filter. Collect the filtrate and count cells using a hemocytometer. Centrifuge the filtrate at 450 x g, 4 &#176;C for 5 min. Aspirate the supernatant. Resuspend in bead buffer at 6 x 107 cells/mL for flow cytometry.</li>
</ol>
8. Single cell suspension of cecum
<ol>
	<li>Prepare collagenase buffer as in step 7.1. Using scissors, split the cecum longitudinally to expose the inner mucosa. Cut into 0.5 cm sections and place in a 50 mL tube with 5 mL of HBSS with 2% FBS. Shake vigorously for 30 s, centrifuge at 450 x g for 20 s, then aspirate the supernatant.</li>
	<li>Add 5 mL of HBSS with 2 mM EDTA. Incubate in a shaking incubator at 37 &#176;C at 100 rpm for 15 min. Centrifuge at 450 x g for 20 s. Aspirate the supernatant.</li>
	<li>Add 5 mL of HBSS. Shake vigorously for 30 s, centrifuge at 450 x g for 20 s, then aspirate the supernatant. Repeat once more.</li>
	<li>Add 5 mL of collagenase buffer. Incubate in a shaking incubator at 37 &#176;C for 30 min at 100 rpm. Shake vigorously every 10 min. Quench reaction with 2 mL of FBS.</li>
	<li>Pour collagenase with cecum specimen over a 100 &#956;m filter and mash with the soft end of a 3 mL plastic syringe. Wash filter with 20 mL of HBSS. Collect filtrate.</li>
	<li>Centrifuge the filtrate at 450 x g&#160;for 5 min at 4 &#176;C. Aspirate the supernatant. Resuspend pellet in 20 mL of bead buffer and pour over a 40 &#956;m filter. Collect filtrate and count cells using a hemocytometer.</li>
	<li>Centrifuge the filtrate at 450 x g&#160;for 5 min at 4 &#176;C. Aspirate the supernatant. Resuspend in bead buffer at 6 x 107 cells/mL for flow cytometry.</li>
</ol>

<ol>
	<li>Mastrangelo, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Incidence+of+soft+tissue+sarcoma+and+beyond:+a+population-based+prospective+study+in+3+European+regions.">Incidence of soft tissue sarcoma and beyond: a population-based prospective study in 3 European regions.</a> Cancer. 118 (21), 5339-5348 (2012).</li><li>Joensuu, H., DeMatteo, R. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+management+of+gastrointestinal+stromal+tumors:+a+model+for+targeted+and+multidisciplinary+therapy+of+malignancy.">The management of gastrointestinal stromal tumors: a model for targeted and multidisciplinary therapy of malignancy.</a> Annual Review of Medicine. 63, 247-258 (2012).</li><li>Blanke, C. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+results+from+a+randomized+phase+II+trial+of+standard-+versus+higher-dose+imatinib+mesylate+for+patients+with+unresectable+or+metastatic+gastrointestinal+stromal+tumors+expressing+KIT.">Long-term results from a randomized phase II trial of standard- versus higher-dose imatinib mesylate for patients with unresectable or metastatic gastrointestinal stromal tumors expressing KIT.</a> Journal of Clinical Oncology. 26 (4), 620-625 (2008).</li><li>Demetri, G. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficacy+and+safety+of+regorafenib+for+advanced+gastrointestinal+stromal+tumours+after+failure+of+imatinib+and+sunitinib+(GRID):+an+international,+multicentre,+randomised,+placebo-controlled,+phase+3+trial.">Efficacy and safety of regorafenib for advanced gastrointestinal stromal tumours after failure of imatinib and sunitinib (GRID): an international, multicentre, randomised, placebo-controlled, phase 3 trial.</a> Lancet. 381 (9863), 295-302 (2013).</li><li>Gold, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Outcome+of+metastatic+GIST+in+the+era+before+tyrosine+kinase+inhibitors.">Outcome of metastatic GIST in the era before tyrosine kinase inhibitors.</a> Annals of Surgical Oncology. 14 (1), 134-142 (2007).</li><li>Huynh, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sorafenib+induces+growth+suppression+in+mouse+models+of+gastrointestinal+stromal+tumor.">Sorafenib induces growth suppression in mouse models of gastrointestinal stromal tumor.</a> Molecular Cancer Therapeutics. 8 (1), 152-159 (2009).</li><li>Na, Y. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Establishment+of+patient-derived+xenografts+from+patients+with+gastrointestinal+stromal+tumors:+analysis+of+clinicopathological+characteristics+related+to+engraftment+success.">Establishment of patient-derived xenografts from patients with gastrointestinal stromal tumors: analysis of clinicopathological characteristics related to engraftment success.</a> Scientific Reports. 10 (1), 7996 (2020).</li><li>Balachandran, V. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imatinib+potentiates+antitumor+T+cell+responses+in+gastrointestinal+stromal+tumor+through+the+inhibition+of+Ido.">Imatinib potentiates antitumor T cell responses in gastrointestinal stromal tumor through the inhibition of Ido.</a> Nature Medicine. 17 (9), 1094-1100 (2011).</li><li>Vitiello, G. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+immune+profiles+distinguish+the+mutational+subtypes+of+gastrointestinal+stromal+tumor.">Differential immune profiles distinguish the mutational subtypes of gastrointestinal stromal tumor.</a> Journal of Clinical Investigation. 129 (5), 1863-1877 (2019).</li><li>Sommer, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gastrointestinal+stromal+tumors+in+a+mouse+model+by+targeted+mutation+of+the+Kit+receptor+tyrosine+kinase.">Gastrointestinal stromal tumors in a mouse model by targeted mutation of the Kit receptor tyrosine kinase.</a> Proceedings of the National Academy of Sciences of the United States of America. 100 (11), 6706-6711 (2003).</li><li>Cavnar, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=KIT+oncogene+inhibition+drives+intratumoral+macrophage+M2+polarization.">KIT oncogene inhibition drives intratumoral macrophage M2 polarization.</a> Journal of Experimental Medicine. 210 (13), 2873-2886 (2013).</li><li>Medina, B. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oncogenic+kinase+inhibition+limits+Batf3-dependent+dendritic+cell+development+and+antitumor+immunity.">Oncogenic kinase inhibition limits Batf3-dependent dendritic cell development and antitumor immunity.</a> Journal of Experimental Medicine. 216 (6), 1359-1376 (2019).</li><li>Zhang, J. Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Macrophages+and+CD8(+)+T+cells+mediate+the+antitumor+efficacy+of+combined+CD40+ligation+and+imatinib+therapy+in+gastrointestinal+stromal+tumors.">Macrophages and CD8(+) T cells mediate the antitumor efficacy of combined CD40 ligation and imatinib therapy in gastrointestinal stromal tumors.</a> Cancer Immunology Research. 6 (4), 434-447 (2018).</li><li>. General Protocol for Western Blotting Available from: <a target="_blank" href="https://www.bio-rad.com/webroot/web/pdf/lsr/literature/Buttetin_6376.pdf">https://www.bio-rad.com/webroot/web/pdf/lsr/literature/Buttetin_6376.pdf</a> (2022)</li><li>Sadeghipour, A., Babaheidarian, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Making+formalin-fixed,+paraffin+embedded+blocks.">Making formalin-fixed, paraffin embedded blocks.</a> Biobanking: Methods and Protocols. , 253-268 (2019).</li><li>Sy, J., Ang, L. -. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microtomy:+Cutting+formalin-fixed,+paraffin-embedded+sections.">Microtomy: Cutting formalin-fixed, paraffin-embedded sections.</a> Biobanking: Methods and Protocols. , 269-278 (2019).</li><li>Seifert, A. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PD-1/PD-L1+blockade+enhances+T-cell+activity+and+antitumor+efficacy+of+imatinib+in+gastrointestinal+stromal+tumors.">PD-1/PD-L1 blockade enhances T-cell activity and antitumor efficacy of imatinib in gastrointestinal stromal tumors.</a> Clinical Cancer Research. 23 (2), 454-465 (2017).</li><li>Liu, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oncogenic+KIT+modulates+Type+I+IFN-mediated+antitumor+immunity+in+GIST.">Oncogenic KIT modulates Type I IFN-mediated antitumor immunity in GIST.</a> Cancer Immunology Research. 9 (5), 542-553 (2021).</li><li>Rossi, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oncogenic+Kit+signaling+and+therapeutic+intervention+in+a+mouse+model+of+gastrointestinal+stromal+tumor.">Oncogenic Kit signaling and therapeutic intervention in a mouse model of gastrointestinal stromal tumor.</a> Proceedings of the National Academy of Sciences of the United States of America. 103 (34), 12843-12848 (2006).</li></ol>

The authors have no conflicts of interest to disclose.

The KitV558&#916;/+&#160;mouse model is a powerful research tool in the molecular and immunologic analysis of GIST. Although the breeding strategy requires a single cross, using KitV558&#916;/+ mouse cohorts in experiments analyzing tumor response requires extensive breeding. Mice should be age- and sex-matched to ensure similar tumor weights, and 10% of mice die before 8 weeks of age when tumors are established. Less extensive breeding strategies are possible if using advanced ima...

GIST is the most common sarcoma in humans with an incidence of about 6,000 cases in the United States of America1. GIST appears to originate from the gastrointestinal pacemaker cells named the interstitial cells of Cajal, and is typically driven by a single mutation in the tyrosine kinase KIT or PDGFRA2. Surgery is the mainstay of treatment for GIST and can be curative, but patients with advanced disease may be treated with the tyrosine kinase inhibitor (TKI), imatinib. Since its introduction over 20 years ago, imatinib has transformed the treatment paradigm in GIST, improving the survival in advanced disease from 1 to over 5 years3,4,5. Unfortunately, imatinib is rarely curative due to acquired KIT mutations, so new treatments are needed for this tumor.
Mouse models are an important research tool in the investigation of novel therapies in cancer. Multiple subcutaneous xenograft and patient-derived xenograft models have been developed and investigated in GIST6,7. However, immunodeficient mice do not fully represent human GIST since GISTs harbor differential immune profiles depending on their oncogenic mutation, and altering the gastrointestinal tumor microenvironment improves upon the effects of TKI therapy8,9. The KitV558&#916;/+&#160;mouse has a heterozygous germline deletion in Kit exon 11, which encodes the juxtamembrane domain, the most commonly mutated site in human GIST10. KitV558&#916;/+&#160;mice develop a single cecal GIST with 100% penetrance, and tumors have similar histology, molecular signaling, immune infiltration, and response to therapy as human GIST8,11,12,13. Here, we describe breeding, treatment, and specimen isolation and processing in KitV558&#916;/+&#160;mice for use in molecular and immunologic research in GIST.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>100 micron filter</td>
			<td>EMSCO</td>
			<td>1194-2360</td>
			<td></td>
		</tr>
		<tr>
			<td>1x RBC lysis buffer</td>
			<td>Life Technologies</td>
			<td>00-4333-57</td>
			<td></td>
		</tr>
		<tr>
			<td>3mL syringe</td>
			<td>Thermo Fisher Scientific/BD Biosciences</td>
			<td>14823435</td>
			<td></td>
		</tr>
		<tr>
			<td>4&#8211;15% Mini-PROTEAN TGX Precast Protein Gels, 10-well, 30 &#181;l</td>
			<td>Bio-Rad</td>
			<td>4561083</td>
			<td></td>
		</tr>
		<tr>
			<td>4% Paraformaldehyde Solution</td>
			<td>Thermo Fisher Scientific</td>
			<td>AAJ19943K2</td>
			<td></td>
		</tr>
		<tr>
			<td>40 micron filter</td>
			<td>EMSCO</td>
			<td>1194-2340</td>
			<td></td>
		</tr>
		<tr>
			<td>5M NaCl</td>
			<td>Sigma Aldrich</td>
			<td>S6546</td>
			<td></td>
		</tr>
		<tr>
			<td>70 micron filter</td>
			<td>EMSCO</td>
			<td>1194-2350</td>
			<td></td>
		</tr>
		<tr>
			<td>AKT antibody (C67E7)</td>
			<td>Cell Signaling</td>
			<td>4691</td>
			<td></td>
		</tr>
		<tr>
			<td>C57BL/6J mice</td>
			<td>The Jackson Laboratory</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Collagenase IV</td>
			<td>Sigma Aldrich</td>
			<td>C5138</td>
			<td></td>
		</tr>
		<tr>
			<td>Complete mini edta free protease inhibitor</td>
			<td>Thomas Scientific</td>
			<td>C852A34</td>
			<td></td>
		</tr>
		<tr>
			<td>Countess II Automated Cell Counter</td>
			<td>Thermo Fisher Scientific</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Disposable Scalpels</td>
			<td>Thermo Fisher Scientific/Exel International</td>
			<td>14-840-00</td>
			<td></td>
		</tr>
		<tr>
			<td>Dnase I</td>
			<td>Thomas Scientific</td>
			<td>C756V81</td>
			<td></td>
		</tr>
		<tr>
			<td>Dog1 antibody</td>
			<td>abcam</td>
			<td>ab64085</td>
			<td></td>
		</tr>
		<tr>
			<td>EDTA</td>
			<td>Sigma Aldrich</td>
			<td>E9884</td>
			<td></td>
		</tr>
		<tr>
			<td>ERK antibody (p44/42)</td>
			<td>Cell Signaling</td>
			<td>9102</td>
			<td></td>
		</tr>
		<tr>
			<td>FBS</td>
			<td>Thomas Scientific</td>
			<td>C788U23</td>
			<td></td>
		</tr>
		<tr>
			<td>FIJI software</td>
			<td>FIJI</td>
			<td></td>
			<td>https://imagej.net/software/fiji</td>
		</tr>
		<tr>
			<td>Fisherbrand 850 Homogenizer</td>
			<td>Thermo Fisher Scientific</td>
			<td>15-340-169</td>
			<td></td>
		</tr>
		<tr>
			<td>HBSS</td>
			<td>University of Pennsylvania Cell Center</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Imatinib mesylate</td>
			<td>Selleck Chemicals</td>
			<td>S1026</td>
			<td></td>
		</tr>
		<tr>
			<td>KIT antibody (D13A2)</td>
			<td>Cell Signaling</td>
			<td>3074</td>
			<td></td>
		</tr>
		<tr>
			<td>KitV558&#916;/+ Genotyping</td>
			<td>Transnetyx</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Microcentrifuge tubes (1.5mL)</td>
			<td>Thermo Fisher Scientific</td>
			<td>05-408-129</td>
			<td></td>
		</tr>
		<tr>
			<td>Mouse on Mouse Immunodetection Kit, Basic</td>
			<td>Vector Laboratories</td>
			<td>BMK-2202</td>
			<td></td>
		</tr>
		<tr>
			<td>Nitrocellulose Membrane, Precut, 0.45 &#181;m</td>
			<td>Rio-Rad</td>
			<td>1620145</td>
			<td></td>
		</tr>
		<tr>
			<td>Nonfat Dry Milk</td>
			<td>Thermo Fisher Scientific</td>
			<td>NC9121673</td>
			<td></td>
		</tr>
		<tr>
			<td>Nonidet P 40 Substitute</td>
			<td>Sigma Aldrich</td>
			<td>74385</td>
			<td></td>
		</tr>
		<tr>
			<td>p-AKT antibody (S473)</td>
			<td>Cell Signaling</td>
			<td>4060</td>
			<td></td>
		</tr>
		<tr>
			<td>p-ERK antibody (p44/42)</td>
			<td>Cell Signaling</td>
			<td>9101</td>
			<td></td>
		</tr>
		<tr>
			<td>p-KIT antibody (Y719)</td>
			<td>Cell Signaling</td>
			<td>3391</td>
			<td></td>
		</tr>
		<tr>
			<td>PMSF Protease Inhibitor</td>
			<td>Thermo Fisher Scientific</td>
			<td>36978</td>
			<td></td>
		</tr>
		<tr>
			<td>Proeinase K</td>
			<td>Thermo Fisher Scientific</td>
			<td>BP170050</td>
			<td></td>
		</tr>
		<tr>
			<td>Round-Bottom Polystyrene Test (FACS) Tubes</td>
			<td>Falcon/Thermo Fisher Scientific</td>
			<td>14-959-2A</td>
			<td></td>
		</tr>
		<tr>
			<td>RPMI</td>
			<td>University of Pennsylvania Cell Center</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium fluoride (NaF)</td>
			<td>Sigma Aldrich</td>
			<td>201154</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium orthovanadate (Na3VO4)</td>
			<td>Sigma Aldrich</td>
			<td>S6508</td>
			<td></td>
		</tr>
		<tr>
			<td>SuperSignal West Dura Extended Duration Substrate</td>
			<td>Thermo Fisher Scientific</td>
			<td>34076</td>
			<td></td>
		</tr>
		<tr>
			<td>TBS buffer (10x)</td>
			<td>University of Pennsylvania Cell Center</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Tissue culture dish (100mm2)</td>
			<td>Thermo Fisher Scientific/Falcon</td>
			<td>08-772E</td>
			<td></td>
		</tr>
		<tr>
			<td>TrisHCL</td>
			<td>Thermo Fisher Scientific</td>
			<td>BP1757500</td>
			<td></td>
		</tr>
		<tr>
			<td>Tween 20</td>
			<td>Rio-Rad</td>
			<td>1706531</td>
			<td></td>
		</tr>
		<tr>
			<td>&#160;vivaCT 80 platform</td>
			<td>Scanco medical</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

molecular and immunologic techniques in a genetically engineered mouse model of gastrointestinal stromal tumor

Gastrointestinal stromal tumor (GIST) is the most common human sarcoma and is typically driven by a single mutation in the KIT receptor. Across tumor types, numerous mouse models have been developed in order to investigate the next generation of cancer therapies. However, in GIST, most in vivo studies use xenograft mouse models which have inherent limitations. Here, we describe an immunocompetent, genetically engineered mouse model of gastrointestinal stromal tumor harboring a KitV558&#916;/+ mutation. In this model, mutant KIT, the oncogene responsible for most GISTs, is driven by its endogenous promoter leading to a GIST which mimics the histological appearance and immune infiltrate seen in human GISTs. Furthermore, this model has been used successfully to investigate both targeted molecular and immune therapies. Here, we describe the breeding and maintenance of a KitV558&#916;/+ mouse colony. Additionally, this paper details the treatment and procurement of GIST, draining mesenteric lymph node, and adjacent cecum in KitV558&#916;/+ mice, as well as sample preparation for molecular and immunologic analyses.

The KitV558&#916;/+ mouse model allows for the investigation of therapeutics in an immunocompetent mouse model. KitV558&#916;/+ mice have an average lifespan of 8 months due to progressive bowel obstruction (Figure 4). Tumors from KitV558&#916;/+ mice express canonical markers of GIST including the tyrosine kinase KIT and the transmembrane channel DOG1 (Figure 5...

Watch this Scientific Journal Video about Molecular and Immunologic Techniques in a Genetically Engineered Mouse Model of Gastrointestinal Stromal Tumor at JoVE.com

Molecular and Immunologic Techniques in a Genetically Engineered Mouse Model of Gastrointestinal Stromal Tumor

The goal of this manuscript is to describe the KitV558&#916;/+&#160;mouse model and techniques for successful dissection and processing of mouse specimens.

Gastrointestinal stromal tumor (GIST) is the most common human sarcoma and is typically driven by a single mutation in the KIT receptor. Across tumor ...

molecular-immunologic-techniques-genetically-engineered-mouse-model

Universidad de Cartagena UDEC

Research

JoVE Journal

Cancer Research

2.0K Views.  Hospital of the University of Pennsylvania. The goal of this manuscript is to describe the KitV558Δ/+ mouse model and techniques for successful dissection and processing of mouse specimens.

Video: Molecular and Immunologic Techniques in a Genetically Engineered Mouse Model of Gastrointestinal Stromal Tumor

The Drosophila Imaginal Disc Tumor Model: Visualization and Quantification of Gene Expression and Tumor Invasiveness Using Genetic Mosaics

Drosophila melanogaster has emerged as a powerful experimental system for functional and mechanistic studies of tumor development and progression in the context of a whole organism. Sophisticated techniques to generate genetic mosaics facilitate induction of visually marked, genetically defined clones surrounded by normal tissue. The clones can be analyzed through diverse molecular, cellular and omics approaches. This study describes how to generate fluorescently labeled clonal tumors of varying malignancy in the eye/antennal imaginal discs (EAD) of Drosophila larvae using the Mosaic Analysis with a Repressible Cell Marker (MARCM) technique. It describes procedures how to recover the mosaic EAD and brain from the larvae and how to process them for simultaneous imaging of fluorescent transgenic reporters and antibody staining. To facilitate molecular characterization of the mosaic tissue, we describe a protocol for isolation of total RNA from the EAD. The dissection procedure is suitable to recover EAD and brains from any larval stage. The fixation and staining protocol for imaginal discs works with a number of transgenic reporters and antibodies that recognize Drosophila proteins. The protocol for RNA isolation can be applied to various larval organs, whole larvae, and adult flies. Total RNA can be used for profiling of gene expression changes using candidate or genome-wide approaches. Finally, we detail a method for quantifying invasiveness of the clonal tumors. Although this method has limited use, its underlying concept is broadly applicable to other quantitative studies where cognitive bias must be avoided.

The Drosophila Imaginal Disc Tumor Model: Visualization and Quantification of Gene Expression and Tumor Invasiveness Using Genetic Mosaics

This protocol demonstrates how to generate fluorescently marked, genetically defined clonal tumors in the Drosophila eye/antennal imaginal discs (EAD). It describes how to dissect the EAD and brain from the third instar larvae and how to process them to visualize and quantify gene expression changes and tumor invasiveness.

Drosophila melanogaster has emerged as a powerful experimental system for functional and mechanistic studies of tumor development and progression in the ...

A Murine Orthotopic Bladder Tumor Model and Tumor Detection System

This protocol describes the generation of bladder tumors in female C57BL/6J mice using the murine bladder cancer cell line MB49, which has been modified to secrete human Prostate Specific Antigen (PSA), and the procedure for the confirmation of tumor implantation. In brief, mice are anesthetized using injectable drugs and are made to lay in the dorsal position. Urine is vacated from the bladder and 50 &#181;L of poly-L-lysine (PLL) is slowly instilled at a rate of 10 &#181;L/20 s using a 24 G IV catheter. It is left in the bladder for 20 min by stoppering the catheter. The catheter is removed and PLL is vacated by gentle pressure on the bladder. This is followed by instillation of the murine bladder cancer cell line (1 x 105 cells/50 &#181;L) at a rate of 10 &#181;L/20 s. The catheter is stoppered to prevent premature evacuation. After 1 h, the mice are revived with a reversal drug, and the bladder is vacated. The slow instillation rate is important, as it reduces vesico-ureteral reflux, which can cause tumors to occur in the upper urinary tract and in the kidneys. The cell line should be well re-suspended to reduce clumping of cells, as this can lead to uneven tumor sizes after implantation.
This technique induces tumors with high efficiency. Tumor growth is monitored by urinary PSA secretion. PSA marker monitoring is more reliable than ultrasound or fluorescence imaging for the detection of the presence of tumors in the bladder. Tumors in mice generally reach a maximum size that negatively impacts health by about 3 - 4 weeks if left untreated. By monitoring tumor growth, it is possible to differentiate mice that were cured from those that were not successfully implanted with tumors. With only end-point analysis, the latter may be mistakenly assumed to have been cured by therapy.

This protocol describes the generation of murine orthotopic bladder tumors in female C57BL/6J mice and the monitoring of tumor growth.

This protocol describes the generation of bladder tumors in female C57BL/6J mice using the murine bladder cancer cell line MB49, which has been modified ...

Isolation of Circulating Tumor Cells in an Orthotopic Mouse Model of Colorectal Cancer

Despite the advantages of easy applicability and cost-effectiveness, subcutaneous mouse models have severe limitations and do not accurately simulate tumor biology and tumor cell dissemination. Orthotopic mouse models have been introduced to overcome these limitations; however, such models are technically demanding, especially in hollow organs such as the large bowel. In order to produce uniform tumors which reliably grow and metastasize, standardized techniques of tumor cell preparation and injection are critical. 
We have developed an orthotopic mouse model of colorectal cancer (CRC) which develops highly uniform tumors and can be used for tumor biology studies as well as therapeutic trials. Tumor cells from either primary tumors, 2-dimensional (2D) cell lines or 3-dimensional (3D) organoids are injected into the cecum and, depending on the metastatic potential of the injected tumor cells, form highly metastatic tumors. In addition, CTCs can be found regularly. We here describe the technique of tumor cell preparation from both 2D cell lines and 3D organoids as well as primary tumor tissue, the surgical and injection techniques as well as the isolation of CTCs from the tumor-bearing mice, and present tips for troubleshooting.

We describe the establishment of orthotopic colorectal tumors via injection of tumor cells or organoids into the cecum of mice and the subsequent isolation of circulating tumor cells (CTCs) from this model.

Despite the advantages of easy applicability and cost-effectiveness, subcutaneous mouse models have severe limitations and do not accurately simulate ...

A Genetically Engineered Mouse Model of Sporadic Colorectal Cancer

Despite the advantages of easy applicability and cost-effectiveness, colorectal cancer mouse models based on tumor cell injection have severe limitations and do not accurately simulate tumor biology and tumor cell dissemination. Genetically engineered mouse models have been introduced to overcome these limitations; however, such models are technically demanding, especially in large organs such as the colon in which only a single tumor is desired.
As a result, an immunocompetent, genetically engineered mouse model of colorectal cancer was developed which develops highly uniform tumors and can be used for tumor biology studies as well as therapeutic trials. Tumor development is initiated by surgical, segmental infection of the distal colon with adeno-cre virus in compound conditionally mutant mice. The tumors can be easily detected and monitored via colonoscopy. We here describe the surgical technique of segmental adeno-cre infection of the colon, the surveillance of the tumor via high-resolution colonoscopy and present the resulting colorectal tumors.

A protocol for the establishment of a genetically engineered mouse model of colorectal cancer by segmental adeno-cre infection and its surveillance via high-resolution colonoscopy is presented.

Despite the advantages of easy applicability and cost-effectiveness, colorectal cancer mouse models based on tumor cell injection have severe limitations ...

Tumor Engraftment in a Xenograft Mouse Model of Human Mantle Cell Lymphoma

B lymphocytes are key players in immune cell circulation and they mainly home to and reside in lymphoid organs. While normal B cells only proliferate when stimulated by T lymphocytes, oncogenic B cells survive and expand autonomously in undefined organ niches. Mantle cell lymphoma (MCL) is one such B cell disorder, where the median survival rate of patients is 4 - 5 years. This calls for the need of effective mechanisms by which the homing and engraftment of these cells are blocked in order to increase the survival and longevity of patients. Therefore, the effort to develop a xenograft mouse model to study the efficacy of MCL therapeutics by blocking the homing mechanism in vivo is of utmost importance. Development of animal recipients for human cell xenotransplantation to test early stage drugs have long been pursued, as relevant preclinical mouse models are crucial to screen new therapeutic agents. This animal model is developed to avoid human graft rejection and to establish a model for human diseases, and it may be an extremely useful tool to study disease progression of different lymphoma types and to perform preclinical testing of candidate drugs for hematologic malignancies, like MCL. We established a xenograft mouse model that will serve as an excellent resource to study and develop novel therapeutic approaches for MCL.

Mantle cell lymphoma (MCL) is a difficult to treat B cell disorder and it is equally difficult to establish a xenograft mouse model of primary MCL to study and develop therapeutics. Here, we describe the successful establishment of MCL xenografts in mice to help understand its underlying biology.

B lymphocytes are key players in immune cell circulation and they mainly home to and reside in lymphoid organs. While normal B cells only proliferate when ...

Utilizing High Resolution Ultrasound to Monitor Tumor Onset and Growth in Genetically Engineered Pancreatic Cancer Models

The LSL-KrasG12D/+; LSL-Trp53R172H/+; Pdx-1-Cre (KPC) mouse model represents an established and frequently used transgenic model to evaluate novel therapies in pancreatic cancer. Tumor onset is variable in the KPC model between 8 weeks and several months. Therefore, non-invasive imaging tools are required to screen for tumor onset and monitor for response to treatment. To address this issue, different approaches have emerged over the last years. High resolution ultrasound has major advantages such as non-invasiveness, fast session times and a high image resolution without radiation exposure. However, ultrasound in mice is not trivial and sufficient anatomical knowledge and practical skills are required to successfully perform high resolution ultrasound in preclinical pancreatic cancer models. With the following article, a detailed hands-on guide for abdominal ultrasound in murine models with a particular focus on endogenous pancreatic cancer models is presented. Furthermore, a summary of common mistakes and how to avoid them is provided.

This article describes the utilization of high-resolution ultrasound in genetically engineered pancreatic cancer mice. The primary aim is to provide a detailed instruction for detection and evaluation of endogenous pancreatic tumors.

The LSL-KrasG12D/+; LSL-Trp53R172H/+; Pdx-1-Cre (KPC) mouse model represents an established and frequently used transgenic model to evaluate novel ...

Digital Polymerase Chain Reaction Assay for the Genetic Variation in a Sporadic Familial Adenomatous Polyposis Patient Using the Chip-in-a-tube Format

The quantitative analysis of human genetic variation is crucial for understanding the molecular characteristics of serious medical conditions, such as tumors. Because digital polymerase chain reactions (PCR) enable the precise quantification of DNA copy number variants, they are becoming an essential tool for detecting rare genetic variations, such as drug-resistant mutations. It is expected that molecular diagnoses using digital PCR (dPCR) will be available in clinical practice in the near future; thus, how to efficiently conduct dPCR with human genetic material is a hot topic. Here, we introduce a method to detect Adenomatous polyposis coli (APC) somatic mosaicism using dPCR with the chip-in-a-tube format, which allows eight dPCR reactions to be simultaneously conducted. Care should be taken when filling and sealing the reaction mixture on the chips. This article demonstrates how to avoid the over- and underestimation of positive partitions. Furthermore, we present a simple procedure for collecting the dPCR product from the partitions on the chips, which can then be used to confirm the specific amplification. We hope that this methods report will help promote the dPCR with the chip-in-a-tube method in genetic research.

Digital polymerase chain reaction (PCR) is a useful tool for the high-sensitivity detection of single nucleotide variants and DNA copy number variants. Here, we demonstrate key considerations for measuring rare variants in the human genome using digital PCR with the chip-in-a-tube format.

The quantitative analysis of human genetic variation is crucial for understanding the molecular characteristics of serious medical conditions, such as ...

A Novel Stromal Fibroblast-Modulated 3D Tumor Spheroid Model for Studying Tumor-Stroma Interaction and Drug Discovery

Tumor-stroma interactions play an important role in cancer progression. Three-dimensional (3D) tumor spheroid models are the most widely used in vitro model in the study of cancer stem/initiating cells, preclinical cancer research, and drug screening. The 3D spheroid models are superior to conventional tumor cell culture and reproduce some important characters of real solid tumors. However, conventional 3D tumor spheroids are made up exclusively of tumor cells. They lack the participation of tumor stromal cells and have insufficient extracellular matrix (ECM) deposition, thus only partially mimicking the in vivo conditions of tumor tissues. We established a new multicellular 3D spheroid model composed of tumor cells and stromal fibroblasts that better mimics the in vivo heterogeneous tumor microenvironment and its native desmoplasia. The formation of spheroids is strictly regulated by the tumor stromal fibroblasts and is determined by the activity of certain crucial intracellular signaling pathways (e.g., Notch signaling) in stromal fibroblasts. In this article, we present the techniques for coculture of tumor cells-stromal fibroblasts, time-lapse imaging to visualize cell-cell interactions, and confocal microscopy to display the 3D architectural features of the spheroids. We also show two examples of the practical application of this 3D spheroid model. This novel multicellular 3D spheroid model offers a useful platform for studying tumor-stroma interaction, elucidating how stromal fibroblasts regulate cancer stem/initiating cells, which determine tumor progression and aggressiveness, and exploring involvement of stromal reaction in cancer drug sensitivity and resistance. This platform can also be a pertinent in vitro model for drug discovery.

A novel three-dimensional spheroid model based on the heterotypic interaction of tumor cells and stromal fibroblasts is established. Here, we present coculture of tumor cells and stromal fibroblasts, time-lapse imaging, and confocal microscopy to visualize the formation of spheroids. This three-dimensional model offers a pertinent platform to study tumor-stroma interactions and test cancer therapeutics.

Tumor-stroma interactions play an important role in cancer progression. Three-dimensional (3D) tumor spheroid models are the most widely used in vitro ...

A Mouse Model to Investigate the Role of Cancer-Associated Fibroblasts in Tumor Growth

Cancer-associated fibroblasts (CAFs) can play an important role in tumor growth by creating a tumor-promoting microenvironment. Models to study the role of CAFs in the tumor microenvironment can be helpful for understanding the functional importance of fibroblasts, fibroblasts from different tissues, and specific genetic factors in fibroblasts. Mouse models are essential for understanding the contributors to tumor growth and progression in an in vivo context. Here, a protocol in which cancer cells are mixed with fibroblasts and introduced into mice to develop tumors is provided. Tumor sizes over time and final tumor weights are determined and compared among groups. The protocol described can provide more insight into the functional role of CAFs in tumor growth and progression.

A protocol to co-inject cancer cells and fibroblasts and monitor tumor growth over time is provided. This protocol can be used to understand the molecular basis for the role of fibroblasts as regulators of tumor growth.

Cancer-associated fibroblasts (CAFs) can play an important role in tumor growth by creating a tumor-promoting microenvironment. Models to study the role ...

Analysis of Lymph Node Volume by Ultra-High-Frequency Ultrasound Imaging in the Braf/Pten Genetically Engineered Mouse Model of Melanoma

Tyr::CreER+,BrafCA/+,Ptenlox/lox&#160;genetically engineered mice (Braf/Pten mice) are widely used as an in vivo model of metastatic melanoma. Once a primary tumor has been induced by tamoxifen treatment, an increase in metastatic burden is observed within 4-6 weeks after induction. This paper shows how Ultra-High-Frequency UltraSound (UHFUS) imaging can be exploited to monitor the increase in metastatic involvement of the inguinal lymph nodes by measuring the increase in their volume.
The UHFUS system is used to scan anesthetized mice with a UHFUS linear probe (22-55 MHz, axial resolution 40 &#181;m). B-mode images from the inguinal lymph nodes (both left and right sides) are acquired in a short-axis view, positioning the animals in dorsal recumbency. Ultrasound records are acquired using a 44 &#181;m step size on a motorized mechanical arm. Afterward, two-dimensional (2D) B-mode acquisitions are imported into the software platform for ultrasound image post-processing, and inguinal lymph nodes are identified and segmented semi-automatically in the acquired cross-sectional 2D images. Finally, a total reconstruction of the three-dimensional (3D) volume is automatically obtained along with the rendering of the lymph node volume, which is also expressed as an absolute measurement.
This non-invasive in vivo technique is very well tolerated and allows the scheduling of multiple imaging sessions on the same experimental animal over 2 weeks. It is, therefore, ideal to assess the impact of pharmacological treatment on metastatic disease.

Melanoma is a very aggressive disease that quickly spreads to other organs. This protocol describes the application of ultra-high-frequency ultrasound imaging, coupled with 3D rendering, to monitor the volume of the inguinal lymph nodes in the Braf/Pten mouse model of metastatic melanoma.

Tyr::CreER+,BrafCA/+,Ptenlox/lox&#160;genetically engineered mice (Braf/Pten mice) are widely used as an in vivo model of metastatic melanoma. Once a ...

Molecular and Immunologic Techniques in a Genetically Engineered Mouse Model of Gastrointestinal Stromal Tumor

Summary

Explore More Videos

Chapters in this video

The Drosophila Imaginal Disc Tumor Model: Visualization and Quantification of Gene Expression and Tumor Invasiveness Using Genetic Mosaics

A Murine Orthotopic Bladder Tumor Model and Tumor Detection System

Isolation of Circulating Tumor Cells in an Orthotopic Mouse Model of Colorectal Cancer

A Genetically Engineered Mouse Model of Sporadic Colorectal Cancer

Tumor Engraftment in a Xenograft Mouse Model of Human Mantle Cell Lymphoma

Utilizing High Resolution Ultrasound to Monitor Tumor Onset and Growth in Genetically Engineered Pancreatic Cancer Models

Digital Polymerase Chain Reaction Assay for the Genetic Variation in a Sporadic Familial Adenomatous Polyposis Patient Using the Chip-in-a-tube Format

A Novel Stromal Fibroblast-Modulated 3D Tumor Spheroid Model for Studying Tumor-Stroma Interaction and Drug Discovery

A Mouse Model to Investigate the Role of Cancer-Associated Fibroblasts in Tumor Growth

Analysis of Lymph Node Volume by Ultra-High-Frequency Ultrasound Imaging in the Braf/Pten Genetically Engineered Mouse Model of Melanoma