Marcella Birtele has been funded by European Union Horizon 2020 Program (H2020-MSCA-ITN-2015) under the Marie Sk&#322;odowska-Curie Innovative Training Networks and Grant Agreement No. 676408. Daniella Rylander Ottosson has been funded by Swedish Research Council (2017-01234).

<ol>
	<li>Barker, R. A., Parmar, M., Studer, L., Takahashi, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+Trials+of+Stem+Cell-Derived+Dopamine+Neurons+for+Parkinson&#39;s+Disease:+Dawn+of+a+New+Era.">Human Trials of Stem Cell-Derived Dopamine Neurons for Parkinson&#39;s Disease: Dawn of a New Era.</a> Cell Stem Cell. 21 (5), 569-573 (2017).</li><li>Southwell, D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interneurons+from+embryonic+development+to+cell-based+therapy.">Interneurons from embryonic development to cell-based therapy.</a> Science. 344 (6180), 1240622 (2014).</li><li>Parmar, M., Torper, O., Drouin-Ouellet, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-based+therapy+for+Parkinson&#39;s+disease:+A+journey+through+decades+toward+the+light+side+of+the+Force.">Cell-based therapy for Parkinson&#39;s disease: A journey through decades toward the light side of the Force.</a> European Journal of Neuroscience. , (2018).</li><li>Torper, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+Vivo+Reprogramming+of+Striatal+NG2+Glia+into+Functional+Neurons+that+Integrate+into+Local+Host+Circuitry.">In Vivo Reprogramming of Striatal NG2 Glia into Functional Neurons that Integrate into Local Host Circuitry.</a> Cell Reports. 12 (3), 474-481 (2015).</li><li>Su, Z., Niu, W., Liu, M. L., Zou, Y., Zhang, C. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+conversion+of+astrocytes+to+neurons+in+the+injured+adult+spinal+cord.">In vivo conversion of astrocytes to neurons in the injured adult spinal cord.</a> Nature Communication. 5, 3338 (2014).</li><li>Liu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ascl1+Converts+Dorsal+Midbrain+Astrocytes+into+Functional+Neurons+In+Vivo.">Ascl1 Converts Dorsal Midbrain Astrocytes into Functional Neurons In Vivo.</a> Journal of Neuroscience. 35 (25), 9336-9355 (2015).</li><li>Guo, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+direct+reprogramming+of+reactive+glial+cells+into+functional+neurons+after+brain+injury+and+in+an+Alzheimer&#39;s+disease+model.">In vivo direct reprogramming of reactive glial cells into functional neurons after brain injury and in an Alzheimer&#39;s disease model.</a> Cell Stem Cell. 14 (2), 188-202 (2014).</li><li>Grande, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Environmental+impact+on+direct+neuronal+reprogramming+in+vivo+in+the+adult+brain.">Environmental impact on direct neuronal reprogramming in vivo in the adult brain.</a> Nature Communication. 4, 2373 (2013).</li><li>Niu, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+reprogramming+of+astrocytes+to+neuroblasts+in+the+adult+brain.">In vivo reprogramming of astrocytes to neuroblasts in the adult brain.</a> Nature Cell Biology. 15 (10), 1164-1175 (2013).</li><li>Weinberg, M. S., Criswell, H. E., Powell, S. K., Bhatt, A. P., McCown, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+Vector+Reprogramming+of+Adult+Resident+Striatal+Oligodendrocytes+into+Functional+Neurons.">Viral Vector Reprogramming of Adult Resident Striatal Oligodendrocytes into Functional Neurons.</a> Molecular Therapy. 25 (4), 928-934 (2017).</li><li>Pereira, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+Reprogramming+of+Resident+NG2+Glia+into+Neurons+with+Properties+of+Fast-Spiking+Parvalbumin-Containing+Interneurons.">Direct Reprogramming of Resident NG2 Glia into Neurons with Properties of Fast-Spiking Parvalbumin-Containing Interneurons.</a> Stem Cell Reports. 9 (3), 742-751 (2017).</li><li>Rivetti di Val Cervo, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+functional+dopamine+neurons+from+human+astrocytes+in+vitro+and+mouse+astrocytes+in+a+Parkinson&#39;s+disease+model.">Induction of functional dopamine neurons from human astrocytes in vitro and mouse astrocytes in a Parkinson&#39;s disease model.</a> Nature Biotechnology. 35 (5), 444-452 (2017).</li><li>Crosson, S. M., Dib, P., Smith, J. K., Zolotukhin, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Helper-free+Production+of+Laboratory+Grade+AAV+and+Purification+by+Iodixanol+Density+Gradient+Centrifugation.">Helper-free Production of Laboratory Grade AAV and Purification by Iodixanol Density Gradient Centrifugation.</a> Molecular Therapy Methods &#38; Clinial Development. 10, 1-7 (2018).</li><li>Torper, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+induced+neurons+via+direct+conversion+in+vivo.">Generation of induced neurons via direct conversion in vivo.</a> Proceedings of the National Academy of Sciences of the United States of America. 110 (17), 7038-7043 (2013).</li><li>Kawaguchi, Y., Kubota, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Correlation+of+physiological+subgroupings+of+nonpyramidal+cells+with+parvalbumin-+and+calbindinD28k-immunoreactive+neurons+in+layer+V+of+rat+frontal+cortex.">Correlation of physiological subgroupings of nonpyramidal cells with parvalbumin- and calbindinD28k-immunoreactive neurons in layer V of rat frontal cortex.</a> Journal of Neurophysiology. 70 (1), 387-396 (1993).</li><li>Grealish, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+A9+dopamine+neuron+component+in+grafts+of+ventral+mesencephalon+is+an+important+determinant+for+recovery+of+motor+function+in+a+rat+model+of+Parkinson&#39;s+disease.">The A9 dopamine neuron component in grafts of ventral mesencephalon is an important determinant for recovery of motor function in a rat model of Parkinson&#39;s disease.</a> Brain. 133 (Pt 2), 482-495 (2010).</li><li>Thompson, L., Barraud, P., Andersson, E., Kirik, D., Bjorklund, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+dopaminergic+neurons+of+nigral+and+ventral+tegmental+area+subtypes+in+grafts+of+fetal+ventral+mesencephalon+based+on+cell+morphology,+protein+expression,+and+efferent+projections.">Identification of dopaminergic neurons of nigral and ventral tegmental area subtypes in grafts of fetal ventral mesencephalon based on cell morphology, protein expression, and efferent projections.</a> Journal of Neuroscience. 25 (27), 6467-6477 (2005).</li></ol>

The authors have nothing to disclose.

In vivo direct reprogramming can be achieved using AAV FLEX vectors in Cre-expressing mouse strains. It is important to note that differences between mouse strains with regards to reprogramming efficacy have been observed. For in vivo reprogramming in the striatum, the NG2-Cre mouse line has proved to be the more efficient when compared with other strains. Prior to starting to use a new animal strain, it is important to check the mouse provider guidelines regarding Cre expression over time, as the age of animals often impacts the specificity of this protein expression. In our studies, animals older than 12 weeks were not used for in vivo reprogramming as there was a risk for Cre expression in cells other than NG2 glia. The constant presence and monitoring of control animals injected only with Synapsin-FLEX-GFP construct is advised. This allows monitoring of the animals for GFP-positive cells that should not be present if no reprogramming genes (ALN) are used.
To identify the newly reprogrammed neurons, a neuron-specific identification method such as the one described in this protocol is of utmost importance. This allows for a proper identification and distinction of the reprogrammed neurons from the endogenous surrounding cells that is of particular relevance when the reprogramming in a homotopic region.
It is also important to target the correct structure for viral injection. Therefore, the stereotaxic surgery for viral injection is important and needs to be approached with accuracy, especially when targeting smaller structures of the brain.
We have previously shown11 that it is not reliable to predict the outcome of in vivo reprogramming based on in vitro reprogramming experiments using the same reprogramming factors. All factors of interest therefore need to be tested in vivo. In our hands, many different factor combinations give the same subtype of neurons (i.e., interneurons11 in vivo) despite the fact that these genes have been implicated in the development of other neurons.
Whole-cell patch clamp for reprogrammed neurons is a delicate technique and tissue processing is important for a good outcome. Perfusion with ice-cold Krebs&#160;solution improves tissue quality. Also, patched neurons need to be treated carefully. Even if maturation and phenotypic identity of reprogrammed neurons can be somewhat assessed using whole-cell patch clamp, these cells are not fully comparable to their endogenous counterparts. Additional types of analysis, such as genome sequencing (e.g., RNA sequencing) should be used to further confirm reprogrammed cell identity.
The technique described herein is could be considered for the development of future therapies where neuronal replacement is needed in the brain. Although in vivo reprogramming is still at its early stages and the translation into humans is not yet foreseen, this technique could provide a method to assess exogenous gene function in the brain and study cell maturation in vivo.

The overall goal of this method is to efficiently convert brain resident glia in vivo into functional and subtype-specific neurons such as parvalbumin-expressing interneurons. This provides a step forward towards the development of an alternative cell replacement therapy for brain diseases without the need for an exogenous cell source. It also creates a tool to study cell fate switches in situ.&#160;
The brain has only a limited capacity for generating new neurons. Therefore, in neurological diseases, there is a need of exogenous cell sources for brain repair. For this, different sources of cells have been subjected to intense research over the years, including cells from primary tissue, stem cell-derived cells and reprogrammed cells1,2,3. Direct reprogramming of resident brain cells into neurons is a recent approach that could provide an attractive method for brain repair as it uses the patient&#8217;s own cells for generating novel neurons inside the brain. To date, several reports have shown in vivo reprogramming through viral vector delivery in the brain4,5,6,78,9 in different brain regions such as the cortex, spinal cord, striatum and the midbrain5,10,11, as well as in intact and lesioned brain5,8,11,12. Both inhibitory and excitatory neurons have been obtained4,8, but the precise phenotype or functionality of these cells has not yet been analyzed in detail.&#160;
In this protocol, we describe a more efficient reprogramming and cell-specific identification of in vivo reprogrammed neurons. We provide a protocol for functional assessment of the neuronal maturation and phenotype&#160;characterization based on functionality and immunohistochemical traits.&#160;
We used a Cre-inducible AAV vector and a GFP reporter to identify the in vivo reprogrammed neurons. This choice of viral vectors has the advantage of infecting both dividing and non-dividing cells of the brain, increasing the number of targeted cells, as an alternative to the use of retrovirus7,8. A neuron-specific synapsin-driven FLEX reporter (GFP), enabled us to specifically detect the newly generated neurons. Previous studies have used subtype-specific promoters for in vivo reprogramming7,9, that also allow the expression of reprogramming genes and reporters in specific cell types. However, that method requires further identification of reprogrammed neurons by postmortem analysis of the co-expression of reporter and neuronal markers. The use of a neuron-specific reporter, such as the one described herein, allows for a direct identification. This provides a direct proof of a successful conversion and allows a live cell identification that is required for patch-clamp electrophysiology.

<table><tbody><tr><td>&lt;strong&gt;REAGENTS FOR AAV5 CLONING AND VIRAL VECTOR PREPARATION&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>pAAV-CA-FLEX</td><td>AddGene</td><td>38042</td><td></td></tr><tr><td>Ascl1</td><td>AddGene</td><td>67291</td><td>NM_008553.4</td></tr><tr><td>Lmx1a</td><td>AddGene</td><td>33013</td><td>NM_0033652.5</td></tr><tr><td>Nurr1</td><td>AddGene</td><td>35000</td><td>NM_013613.2</td></tr><tr><td>GFP-syn</td><td>AddGene</td><td>30456</td><td></td></tr><tr><td>LoxP (FLEX) sequence 1</td><td></td><td></td><td>GATCTccataacttcgtataaagtatcctatac&lt;br/&gt;gaagttatatcaaaataggaagaccaatgcttc&lt;br/&gt;accatcgacccgaattgccaagcatcaccatcg&lt;br/&gt;acccataacttcgtataatgtatgctatacgaa&lt;br/&gt;gttatactagtcccgggaaggcgaagacgcgga&lt;br/&gt;agaggctctaga</td></tr><tr><td>LoxP (FLEX) sequences 2</td><td></td><td></td><td>tactagtataacttcgtataggatactttatac&lt;br/&gt;gaagttatcattgggattcttcctattttgatc&lt;br/&gt;caagcatcaccatcgaccctctagtccacatct&lt;br/&gt;caccatcgacccataacttcgtatagcatacat&lt;br/&gt;tatacgaagttatgtccctcgaagaggttcgaa&lt;br/&gt;ttcgtttaaacGGTACCCTCGAC</td></tr><tr><td>pDP5</td><td>Plasmid Factory</td><td>PF435</td><td></td></tr><tr><td>pDP6</td><td>Plasmid Factory</td><td>PF436</td><td></td></tr><tr><td>Phosphate-Buffered Saline (PBS)</td><td>Thermo Fisher Scientific</td><td>10010023</td><td></td></tr><tr><td>FBS (Fetal bovine serum)</td><td>Thermo Fisher Scientific</td><td>10500064</td><td></td></tr><tr><td>Penicillin streptomycin</td><td>Thermo Fisher Scientific</td><td>15140122</td><td></td></tr><tr><td>DMEM (Dulbecco&#039;s Modified Eagle Medium)+ Glutamax</td><td>Thermo Fisher Scientific</td><td>61965026</td><td></td></tr><tr><td>DPBS (Dulbecco&#039;s Phosphate Buffer Saline)</td><td>Thermo Fisher Scientific</td><td>14190094</td><td></td></tr><tr><td>HEK293 cells</td><td>Thermo Fisher Scientific</td><td>85120602-1VL</td><td></td></tr><tr><td>Flasks</td><td>BD Falcon</td><td>10078780</td><td>175 cm2</td></tr><tr><td>Tris H-CL</td><td>Sigma Aldrich</td><td>10812846001</td><td> For TE buffer use 10 mM, pH 8.0; for lysis buffer use 50mM, pH 8.5; for IE buffer use 20 mM, pH 8.0; for elution buffer use 20 mM, pH 8.0 </td></tr><tr><td>EDTA</td><td>EDTA: Invitrogen</td><td>EDTA: AM9260G</td><td> For TE buffer use 1 mM EDTA </td></tr><tr><td>Ultrapure water</td><td></td><td></td><td> see Ultrapure water system </td></tr><tr><td>CaCl2</td><td>SigmaAldrich</td><td>C5080</td><td>2.5 M</td></tr><tr><td>Dulbecco&amp;acute;s phosphate-buffered saline (DPBS)</td><td>Thermo Fisher Scientific</td><td>14190136</td><td></td></tr><tr><td>NaCl</td><td>Sigma-Aldrich</td><td>S3014</td><td> FOR HBS use 140 mM; for Lysis Buffer use 150 mM; for IE buffer use 15 mM; for elution buffer use 250 mM </td></tr><tr><td>MgCl2</td><td>Sigma-Aldrich</td><td>M8266-100G</td><td> For lysis Buffer: 1 mM </td></tr><tr><td>Ultracentrifuge sealing tubes</td><td>Beckman Coulter</td><td>Quick-Seal&amp;reg;&amp;nbsp;Polypropylene Tube</td><td></td></tr><tr><td>OptiPrep&amp;trade;&amp;nbsp;Density Gradient Medium</td><td>Sigma Aldrich</td><td>D1556-250ML</td><td></td></tr><tr><td>10-mL syringe-18G needle</td><td>BD</td><td>305064</td><td></td></tr><tr><td>Laboratory glass bottles</td><td>VWR</td><td>?</td><td></td></tr><tr><td>Anion exchange filter</td><td>PALL laboratory</td><td>MSTG25Q6</td><td> Acrodisc unit with Mustang Q membrane </td></tr><tr><td>Centrifugal filter unit</td><td>Merck</td><td>Z740210-24EA</td><td> Amicon Ultra-4 device </td></tr><tr><td>Endotoxin-Free Plasmid DNA Isolation Kits</td><td>Thermo Fisher Scientific</td><td>A33073</td><td></td></tr><tr><td>Na2PO4</td><td>Sigma-Aldrich</td><td>S7907</td><td></td></tr><tr><td>HEPES</td><td>Sigma-Aldrich</td><td>H7523</td><td>15 mL</td></tr><tr><td>Falcon tube</td><td>Thermo Fisher Scientific</td><td>Corning 352196</td><td></td></tr><tr><td>Falcon tube</td><td>Thermo Fisher Scientific</td><td>Corning 352070</td><td></td></tr><tr><td>Glass Vials</td><td>Novatech</td><td>30209-1232</td><td> CGGCCTCAGFGAGCGA </td></tr><tr><td>Forward Primer for Inverted Terminal Repeat (ITR) sequence</td><td></td><td></td><td> GGAACCCCTAGTGATGGAGTT </td></tr><tr><td>Reverse Primer for Inverted Terminal Repeat (ITR) sequence</td><td></td><td></td><td> CACTCCCTCTCTGCGCGCTCG </td></tr><tr><td>5&amp;acute;FAM / 3&amp;acute;BHQ1 probe</td><td>Jena Bioscience</td><td></td><td></td></tr><tr><td>0.22 mm filter</td><td>Merck</td><td>SLGV004SL</td><td>Millex-GV filter</td></tr><tr><td>&lt;strong&gt;EQUIPMENT AAV5 VIRAL VECTOR PREPARATION&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Freezer -20 &amp;deg;C</td><td></td><td></td><td></td></tr><tr><td>Freezer -80 &amp;deg;C</td><td></td><td></td><td></td></tr><tr><td>Fridge +4 &amp;deg;C</td><td></td><td></td><td></td></tr><tr><td>AAV viral room</td><td></td><td></td><td></td></tr><tr><td>Ultrapure Water system</td><td>Merck</td><td>Milli-Q&amp;reg; IQ 7000</td><td></td></tr><tr><td>Vortex mixer</td><td>VWR</td><td>444-0004</td><td></td></tr><tr><td>Ultracentrifuge</td><td>Beckman Coulter</td><td>Beckman Optima LE-80K Ultracentrifuge</td><td></td></tr><tr><td>Autoclave</td><td>Tuttnauer</td><td>2540 EL</td><td></td></tr><tr><td>Polymerase Chain Reaction (PCR)</td><td>BioRad</td><td>C1000 Touch Thermal Cycler</td><td></td></tr><tr><td>Quantitative PCR (qPCR)</td><td>Roche</td><td>LightCycler&amp;reg; 480 System</td><td></td></tr><tr><td>Centrifuge</td><td>Thermo Fisher Scientific</td><td>Sorvall ST16</td><td></td></tr><tr><td>Water Bath</td><td>Thermo Fisher Scientific</td><td>TSGP02</td><td></td></tr><tr><td>&lt;strong&gt;ANIMAL MODEL&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>NG2-Cre mice</td><td>Jackson</td><td>NG2-CrexB6129, Stock #008533</td><td></td></tr><tr><td>&lt;strong&gt;REAGENTS FOR INJECTION OF REPROGRAMMING FACTORS INTO THE BRAIN&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Water</td><td></td><td></td><td></td></tr><tr><td>Saline</td><td>Apoteket AB</td><td></td><td>70%</td></tr><tr><td>Ethanol</td><td>Solveco</td><td></td><td></td></tr><tr><td>Isolfurane</td><td>Apoteket AB</td><td></td><td> Dilute to 1% solution with warm water. </td></tr><tr><td>Virkon</td><td>Viroderm</td><td>7511&amp;nbsp;</td><td></td></tr><tr><td>Pentobarbital</td><td>Apoteket AB</td><td>P0500000</td><td> i.p. for terminal procedure at the dose of 60 mg/ml. </td></tr><tr><td>Sucrose</td><td>Merck</td><td>S0389-500G</td><td></td></tr><tr><td>Trypan Blu</td><td>Thermo Fisher Scientific</td><td>15250061</td><td></td></tr><tr><td>Retrobeads</td><td>Lumafluor</td><td>R170</td><td></td></tr><tr><td>Buprenorphine</td><td>Apoteket AB</td><td></td><td></td></tr><tr><td>&lt;strong&gt;EQUIPMENT FOR INJECTION OF REPROGRAMMING FACTORS INTO THE BRAIN&lt;/strong&gt;</td><td></td><td></td><td> From RSG Solingen. </td></tr><tr><td>Scissors</td><td>VWR</td><td>233-1552</td><td>From Biochem.</td></tr><tr><td>Tweezers</td><td>VWR</td><td>232-0007</td><td></td></tr><tr><td>Forcep</td><td>VWR</td><td>232-0120</td><td></td></tr><tr><td>Scalpel holder</td><td>VWR</td><td>RSGA106.621</td><td>Number 20.</td></tr><tr><td>Scalpel</td><td>VWR</td><td>RSGA106.200</td><td></td></tr><tr><td>Stereotaxic frame</td><td>Stoelting Europe</td><td>51500D</td><td></td></tr><tr><td>Mouse ear bars</td><td>Stoelting Europe</td><td>51648</td><td>5 ul</td></tr><tr><td>Syringe with Removable needle</td><td>Hamilton Company</td><td>65</td><td> 0,75 inner diameter and 1.5 outer diameter. </td></tr><tr><td>Glass capilaries</td><td>Stoelting</td><td>50811</td><td></td></tr><tr><td>Glass capillary puller</td><td>Sutter company</td><td>P-1000</td><td></td></tr><tr><td>Dental drill</td><td>Agnthos AB</td><td>1464</td><td></td></tr><tr><td>Shaver</td><td>Agnthos AB</td><td>GT420</td><td></td></tr><tr><td>Isoflurane Chamber and pump</td><td>Agnthos AB</td><td>8323101</td><td>2 mL</td></tr><tr><td>Syringes</td><td>Merck</td><td>Z118400-30EA</td><td>25G</td></tr><tr><td>Needles</td><td>Merck</td><td>Z192414&amp;nbsp;Aldrich</td><td></td></tr><tr><td>Mouse and neonatal rat adaptor for stereotaxic fram</td><td>Stoelting</td><td>51625</td><td></td></tr><tr><td>Heating pad</td><td>Braintree scientific, inc</td><td>53800M</td><td> From Covidien 2187. </td></tr><tr><td>Cotton gauze</td><td>Fisher Scientific</td><td>22-037-902</td><td></td></tr><tr><td>Rubber tube</td><td>Elfa Distrelec</td><td>HFT-A-9.5/4.8 PO-X BK 150</td><td></td></tr><tr><td>Cotton swabs</td><td>Fisher Scientific</td><td>18-366-473</td><td></td></tr><tr><td>&lt;strong&gt;REAGENTS FOR WHOLE-CELL PATCH CLAMP RECORDINGS&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>NaCl</td><td>Sigma-Aldrich</td><td>S3014</td><td></td></tr><tr><td>KCl</td><td>Sigma-Aldrich</td><td>P9333</td><td></td></tr><tr><td>NaH&lt;sub&gt;2&lt;/sub&gt;PO&lt;sub&gt;4&lt;/sub&gt;-H&lt;sub&gt;2&lt;/sub&gt;O</td><td>Sigma-Aldrich</td><td>S9638</td><td></td></tr><tr><td>MgCl&lt;sub&gt;2&lt;/sub&gt;-6 H&lt;sub&gt;2&lt;/sub&gt;O</td><td>Sigma-Aldrich</td><td>M2670</td><td></td></tr><tr><td>CaCl&lt;sub&gt;2&lt;/sub&gt;-6 H&lt;sub&gt;2&lt;/sub&gt;O</td><td>Sigma-Aldrich</td><td>C8106</td><td></td></tr><tr><td>MgSO4-7 H&lt;sub&gt;2&lt;/sub&gt;O</td><td>Sigma-Aldrich</td><td>230391</td><td></td></tr><tr><td>NaHCO&lt;sub&gt;3&lt;/sub&gt;</td><td>Sigma-Aldrich</td><td>S5761</td><td></td></tr><tr><td>Glucose</td><td>Sigma-Aldrich</td><td>G7021</td><td> see Ultrapure Water system </td></tr><tr><td>Ultrapure Water</td><td></td><td></td><td>Prepare 1 or 2M.</td></tr><tr><td>KOH</td><td>Sigma-Aldrich</td><td>P5958-500G</td><td></td></tr><tr><td>K-D-gluconate</td><td>Sigma-Aldrich</td><td>G4500&amp;nbsp;Sigma</td><td></td></tr><tr><td>KCl</td><td>Sigma-Aldrich</td><td>P9541</td><td></td></tr><tr><td>KOH-EGTA (Etilene glycol-bis-N-tetracetic acid)</td><td>Sigma-Aldrich</td><td>E3889&amp;nbsp;Sigma</td><td></td></tr><tr><td>KOH- Hepes acid (N-2-hydroxyethylpiperazine-N&amp;rsquo;-2-ethanesulfonic acid)</td><td>Sigma-Aldrich</td><td>H7523</td><td></td></tr><tr><td>NaCl</td><td>Sigma-Aldrich</td><td>S3014</td><td></td></tr><tr><td>Mg2ATP</td><td>Sigma-Aldrich</td><td>A9187</td><td></td></tr><tr><td>Na3GTP</td><td>Sigma-Aldrich</td><td>G8877</td><td></td></tr><tr><td>Biocytin</td><td>Sigma-Aldrich</td><td>B4261</td><td></td></tr><tr><td>Picrotoxin</td><td>Merck</td><td>P1675&amp;nbsp;Sigma</td><td></td></tr><tr><td>CNQX</td><td>Merck</td><td>C239&amp;nbsp;Sigma</td><td></td></tr><tr><td>Ice</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;EQUIPMENT FOR WHOLE-CELL PATCH CLAMP RECORDINGS&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Borosilicate glass pipette</td><td>Sutter Company</td><td>B150-86-10</td><td></td></tr><tr><td>Glass capillary puller</td><td>Sutter company</td><td>P-1000</td><td></td></tr><tr><td>Vibratome</td><td>Leica</td><td>Leica VT1000 S</td><td></td></tr><tr><td>WaterBath</td><td>Thermo Fisher Scientific</td><td>TSGP02</td><td></td></tr><tr><td>Clampfit software</td><td>Molecular Devices</td><td></td><td></td></tr><tr><td>Multiclamp software</td><td>Molecular Devices</td><td></td><td></td></tr><tr><td>&lt;strong&gt;REAGENTS FOR IMMUNOHISTOCHEMISTRY&lt;/strong&gt;</td><td></td><td></td><td> Use at a concentration of 4%.&amp;nbsp;CAUTION:&amp;nbsp;PFA is a potent fixative. Avoid ingestion and contact with skin. </td></tr><tr><td>Paraformaldehyde (PFA)</td><td>Merck Millipore</td><td>1040051000</td><td> Use at a concentration of 0.1%. </td></tr><tr><td>Triton X-100</td><td>Fisher Scientific</td><td>10254640</td><td> Donkey.Use at a concentration of 1 : 400. </td></tr><tr><td>Serum</td><td>Merck Millipore</td><td>S30-100ML</td><td> Reconstitute the powder in Milli-Q water to 1 mg/mL. Aliquot and store at -20&amp;deg;C,&amp;nbsp;light sensitive. Use at a concentration of 1 : 500. </td></tr><tr><td>4&amp;prime;,6-Diamidino-2&amp;prime;-phenylindole dihydrochloride (DAPI)</td><td>Sigma Aldrich</td><td>D9542</td><td> 1: 600 in KPBS-T. </td></tr><tr><td>streptavidin- Cy3</td><td>Thermo Fisher Scientific</td><td>434315</td><td>1:5000, rabbit.</td></tr><tr><td>Anti-GAD65/67</td><td>Abcam</td><td></td><td>1:2000, mouse.</td></tr><tr><td>Anti-PV</td><td>Sigma</td><td>P3088</td><td>1:200, goat.</td></tr><tr><td>Anti-Chat</td><td>Merk</td><td>AB143</td><td>1:5000, rabbit.</td></tr><tr><td>Anti-NPY</td><td>Immunostar</td><td>22940</td><td></td></tr><tr><td>K&lt;sub&gt;2&lt;/sub&gt;HPO&lt;sub&gt;4&lt;/sub&gt;</td><td>Sigma-Aldrich</td><td>P3786</td><td></td></tr><tr><td>NaCl</td><td>Sigma-Aldrich</td><td>S3014</td><td></td></tr><tr><td>KH&lt;sub&gt;2&lt;/sub&gt;PO&lt;sub&gt;4&lt;/sub&gt;</td><td>Sigma-Aldrich</td><td>NIST200B</td><td>1:1000, chicken.</td></tr><tr><td>Anti-GFP</td><td>Abcam</td><td>ab13970</td><td></td></tr><tr><td>Mounting solution</td><td>Merck</td><td>10981</td><td> Polyvinyl alcohol mounting medium with DABCO&amp;reg;, antifading </td></tr><tr><td>OCT</td><td>Agar Scientific</td><td></td><td></td></tr><tr><td>Glycerol</td><td>Sigma-Aldrich</td><td>G9012-100ML</td><td></td></tr><tr><td>Distilled water</td><td></td><td></td><td></td></tr><tr><td>Anti-freeze solution</td><td>Tissue Pro Technology</td><td>AFS05-1000N, 1000 mL/ea.</td><td></td></tr><tr><td>&lt;strong&gt;EQUIPMENT FOR IMMUNOHISTOCHEMISTRY&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Inverted fluorescence microscope</td><td>Leica</td><td>DMI6000 B</td><td></td></tr><tr><td>Confocal microscope</td><td>Leica</td><td>TCS SP8 laser scanning confocal microscope.</td><td></td></tr><tr><td>Prism</td><td>GraphPad</td><td></td><td></td></tr><tr><td>Microtome</td><td>Leica</td><td>SM2010R</td><td></td></tr></tbody></table>

in vivo direct reprogramming of resident glial cells into interneurons by intracerebral injection of viral vectors

Converting resident glia in the brain into functional and subtype-specific neurons in vivo provides a step forward towards the development of alternative cell replacement therapies while also creating tools to study cell fate in situ. To date, it has been possible to obtain neurons via in vivo reprogramming, but the precise phenotype of these neurons or how they mature has not been analyzed in detail. In this protocol, we describe a more efficient conversion and cell-specific identification of the in vivo reprogrammed neurons, using an AAV-based viral vector system. We also provide a protocol for functional assessment of the reprogrammed cells&#8217; neuronal maturation. By injecting flip-excision (FLEX) vectors, containing the reprogramming and synapsin-driven reporter genes&#160;to specific cell types in the brain that serve as the target for cell reprogramming. This technique allows for the easy identification of newly reprogrammed neurons. Results show that the obtained reprogrammed neurons functionally mature over time, receive synaptic contacts and show electrophysiological properties of different types of interneurons. Using the transcription factors Ascl1, Lmx1a and Nurr1, the majority of the reprogrammed cells have properties of fast-spiking, parvalbumin-containing interneurons.

The injection of AAV vectors is used to successfully reprogram resident NG2 glia cells into neurons in the NG2-Cre mouse striatum (Figure 1A). To specifically target NG2 glia, FLEX vectors with reprogramming/reporter genes, are inserted in an antisense direction and flanked by two pairs of antiparallel, heterotypic loxP sites (Figure 1B). Each of the three reprogramming genes (Ascl1, Lmx1a and Nurr1) is placed under the control of the ubiquitous cba promoter on individual vectors. In order to make sure GFP expression is restricted to reprogrammed neurons originating from a Cre-expressing cell, GFP is placed under the control of the neuron-specific synapsin promoter, (also in a FLEX vector).
The use of the combination of reprogramming and reporter constructs allows for the generation of GFP-positive neurons in the mouse striatum (Figure 1C,C&#8217;). The use of the reporter construct without the presence of reprogramming genes does not yield GFP-positive neurons (Figure 1D).
The reprogrammed neurons that are biocytin-filled are visible after post-mortem immuno-staining (Figure 2A). If conversion is successful, there should be extensive neuronal morphology. The electrophysiological recordings of reprogrammed neurons show presence of postsynaptic functional connections with spontaneous activity measures (Figure 2B,C). This can be blocked with either ionotropic GABAergic or glutamatergic blocker (Picrotoxin or CNQX), suggesting both excitatory and inhibitory synaptic input to the reprogrammed neurons. The occurrence of spontaneous activity increases with time post viral injection (Figure 2D), indicating a gradual maturation.
Current-induced action potentials are present in functional neurons. The action potentials increase in number over time after conversion (Figure 2E). This further indicates maturation in neuronal function. In an immature neuron, current will induce either none or very few action potentials (Figure 2F).
The firing patterns of a neuron is cell type specific as it depends&#160;on factors such as the morphology of the cells and channel expression15. The recorded patterns in the in vivo reprogrammed neurons can be distinguished into groups and compared to that of endogenous neuronal subtypes, e.g.&#160;fast-spiking interneurons (Cell Type B, Figure 3B) or other cell types (Figure 3A,C,D). The observed electrophysiological differences can be confirmed by the presence of specific subtype markers and co-expression with GFP (Figure 3E-H). Altogether, this data indicates that the reprogrammed neurons present in the striatum have properties of different types of interneurons, such as Parvalbumin-, ChAt- and NPY- expressing interneurons, as well as striatal medium spiny neuron identity (DARPP32+) (Figure 3E-H).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/59465/59465fig1.jpg" /> 
Figure 1: In vivo reprogramming of resident NG2 glia into neurons. (A) Schematic representation of AAV virus-mediated in vivo reprogramming of striatal NG2 glia. (B) Schematic representation of AAV5 FLEX constructs used for in vivo reprogramming, in which gene expression is regulated by Cre expression in the targeted cells. (C and C&#8217;) In vivo reprogrammed neurons, resulting from Syn-GFP + ALN injection into the Striatum. (D) Absence of reprogrammed neurons when no reprogramming factors are added into the viral cocktail, and only reporter construct is injected in vivo. Scale bars = 100 &#956;m (C),25 &#956;m (C&#39;), 25 &#956;m (D). <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/59465/59465fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/59465/59465fig2.jpg" /> 
Figure 2: In vivo reprogrammed neurons are functional and show maturation over time. (A)&#160;Biocytin-filled reprogrammed neuron, shows mature neuronal morphology, including dendritic spines. Traces shows (B) inhibitory (GABAergic) activity that is blocked with picrotoxin, a GABAA receptor antagonist and (C) excitatory activity that is blocked with CNQX, an AMPA receptor antagonist. (D) The number of neurons with postsynaptic activity increases over time. (E) Patched neurons show repetitive firing already at 5 weeks post-injection (w.p.i.) and continue to show that at 8 and 12 w.p.i. (F)&#160;Current-induced action potential and postsynaptic activity of an immature neuron, showing few synaptic events and few action potentials compared to B and D. Scale bar = 25 &#956;m <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/59465/59465fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/59465/59465fig3v2.jpg" /> 
Figure 3: In vivo reprogrammed neurons show immunohistochemical and electrophysiological properties of striatal interneurons. (A-D) The firing patterns of&#160;in vivo reprogrammed neurons can be of distinct types: (A) Type A is similar to endogenous medium spiny neuron (DARPP32+); (B) similar to fast-spiking (PV+) interneurons; (C) similar to low-threshold spiking neurons with prominent sag (NPY+); (D) neurons firing with large after-hyperpolarization (Chat+). (E-H) Confocal images showing co-localization of GFP and the interneuron markers PV (E), ChAT (F), NPY (G), and projection neuron marker DARPP32 (H). All scale bars = 50 &#956;m. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/59465/59465fig3v2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about In Vivo Direct Reprogramming of Resident Glial Cells into Interneurons by Intracerebral Injection of Viral Vectors at JoVE.com

In Vivo Direct Reprogramming of Resident Glial Cells into Interneurons by Intracerebral Injection of Viral Vectors

This protocol aims at generating directly reprogrammed interneurons in vivo, using an AAV-based viral system in the brain and a FLEX synapsin-driven GFP reporter, which allows for cell identification and further analysis in vivo.

Converting resident glia in the brain into functional and subtype-specific neurons in vivo provides a step forward towards the development of alternative ...

in-vivo-direct-reprogramming-resident-glial-cells-into-interneurons

Research

JoVE Journal

Neuroscience

9.3K Views.  Lund University. This protocol aims at generating directly reprogrammed interneurons in vivo, using an AAV-based viral system in the brain and a FLEX synapsin-driven GFP reporter, which allows for cell identification and further analysis in vivo.

Video: In Vivo Direct Reprogramming of Resident Glial Cells into Interneurons by Intracerebral Injection of Viral Vectors

Viral-mediated Labeling and Transplantation of Medial Ganglionic Eminence (MGE) Cells for In Vivo Studies

GABAergic cortical interneurons, derived from the embryonic medial and caudal ganglionic eminences (MGE and CGE), are functionally and morphologically diverse. Inroads have been made in understanding the roles of distinct cortical interneuron subgroups, however, there are still many mechanisms to be worked out that may contribute to the development and maturation of different types of GABAergic cells. Moreover, altered GABAergic signaling may contribute to phenotypes of autism, schizophrenia and epilepsy. Specific Cre-driver lines have begun to parcel out the functions of unique interneuron subgroups. Despite the advances in mouse models, it is often difficult to efficiently study GABAergic cortical interneuron progenitors with molecular approaches in vivo. One important technique used to study the cell autonomous programming of these cells is transplantation of MGE cells into host cortices. These transplanted cells migrate extensively, differentiate, and functionally integrate. In addition, MGE cells can be efficiently transduced with lentivirus immediately prior to transplantation, allowing for a multitude of molecular approaches. Here we detail a protocol to efficiently transduce MGE cells before transplantation for in vivo analysis, using available Cre-driver lines and Cre-dependent expression vectors. This approach is advantageous because it combines precise genetic manipulation with the ability of these cells to disperse after transplantation, permitting greater cell-type specific resolution in vivo.

Viral-mediated Labeling and Transplantation of Medial Ganglionic Eminence MGE Cells for In Vivo Studies

GABAergic cortical interneuron progenitors disperse, develop and synaptically integrate into a host cortex after transplantation. These cells can be easily transduced before transplantation for in vivo studies of genetically modified GABAergic precursors. Here, we show viral labeling techniques to target specific interneuron subgroups using existing Cre lines and Cre-dependent reporters.

GABAergic cortical interneurons, derived from the embryonic medial and caudal ganglionic eminences (MGE and CGE), are functionally and morphologically ...

Developmental Biology

Intraventricular Transplantation of Engineered Neuronal Precursors for In Vivo Neuroarchitecture Studies

Gene control of neuronal cytoarchitecture is currently the subject of intensive investigation. Described here is a simple method developed to study in vivo gene control of neocortical projection neuron morphology. This method is based on (1) in vitro lentiviral engineering of neuronal precursors as "test" and "control" cells, (2) their co-transplantation into wild-type brains, and (3) paired morphometric evaluation of their neuronal derivatives. Specifically, E12.5 pallial precursors from panneuronal, genetically labeled donors, are employed for this purpose. They are engineered to take advantage of selected promoters and tetON/OFF technology, and they are free-hand transplanted into neonatal lateral ventricles. Later, upon immunofluorescence profiling of recipient brains, silhouettes of transplanted neurons are fed into NeurphologyJ open source software, their morphometric parameters are extracted, and average length and branching index are calculated. Compared to other methods, this one offers three main advantages: it permits achieving of fine control of transgene expression at affordable costs, it only requires basic surgical skills, and it provides statistically reliable results upon analysis of a limited number of animals. Because of its design, however, it is not adequate to address non cell-autonomous control of neuroarchitecture. Moreover, it should be preferably used to investigate neurite morphology control after completion of neuronal migration. In its present formulation, this method is exquisitely tuned to investigate gene control of glutamatergic neocortical neuron architecture. Taking advantage of transgenic lines expressing EGFP in other specific neural cell types, it can be re-purposed to address gene control of their architecture.

Based on in vitro lentiviral engineering of neuronal precursors, their co-transplantation into wild-type brains and paired morphometric evaluation of "test" and "control" derivatives, this method allows accurate modeling of in vivo gene control of neocortical neuron morphology in a simple and affordable way.

Gene control of neuronal cytoarchitecture is currently the subject of intensive investigation. Described here is a simple method developed to study in ...

Genetics

Expansion of Embryonic and Adult Neural Stem Cells by In Utero Electroporation or Viral Stereotaxic Injection

Somatic stem cells can divide to generate additional stem cells (expansion) or more differentiated cell types (differentiation), which is fundamental for tissue formation during embryonic development and tissue homeostasis during adulthood 1. Currently, great efforts are invested towards controlling the switch of somatic stem cells from expansion to differentiation because this is thought to be fundamental for developing novel strategies for regenerative medicine 1,2. However, a major challenge in the study and use of somatic stem cell is that their expansion has been proven very difficult to control.
Here we describe a system that allows the control of neural stem/progenitor cell (altogether referred to as NSC) expansion in the mouse embryonic cortex or the adult hippocampus by manipulating the expression of the cdk4/cyclinD1 complex, a major regulator of the G1 phase of the cell cycle and somatic stem cell differentiation 3,4. Specifically, two different approaches are described by which the cdk4/cyclinD1 complex is overexpressed in NSC in vivo. By the first approach, overexpression of the cell cycle regulators is obtained by injecting plasmids encoding for cdk4/cyclinD1 in the lumen of the mouse telencephalon followed by in utero electroporation to deliver them to NSC of the lateral cortex, thus, triggering episomal expression of the transgenes 5-8. By the second approach, highly concentrated HIV-derived viruses are stereotaxically injected in the dentate gyrus of the adult mouse hippocampus, thus, triggering constitutive expression of the cell cycle regulators after integration of the viral construct in the genome of infected cells 9. Both approaches, whose basic principles were already described by other video protocols 10-14, were here optimized to i) reduce tissue damage, ii) target wide portions of very specific brain regions, iii) obtain high numbers of manipulated cells within each region, and iv) trigger high expression levels of the transgenes within each cell. Transient overexpression of the transgenes using the two approaches is obtained by different means i.e. by natural dilution of the electroporated plasmids due to cell division or tamoxifen administration in Cre-expressing NSC infected with viruses carrying cdk4/cyclinD1 flanked by loxP sites, respectively 9,15.
These methods provide a very powerful platform to acutely and tissue-specifically manipulate the expression of any gene in the mouse brain. In particular, by manipulating the expression of the cdk4/cyclinD1 complex, our system allows the temporal control of NSC expansion and their switch to differentiation, thus, ultimately increasing the number of neurons generated in the mammalian brain. Our approach may be critically important for basic research and using somatic stem cells for therapy of the mammalian central nervous system while providing a better understanding of i) stem cell contribution to tissue formation during development, ii) tissue homeostasis during adulthood, iii) the role of adult neurogenesis in cognitive functions, and perhaps, iv) better using somatic stem cells in models of neurodegenerative diseases.

Expansion of Embryonic and Adult Neural Stem Cells by In Utero Electroporation or Viral Stereotaxic Injection

Controlling the expansion of somatic stem cells is a major factor hampering their study and use in therapy. Here we describe a system to temporally control neural stem cells expansion during development and adulthood, which can be used to increase the number of neurons generated in the mouse brain.

Somatic stem cells can divide to generate additional stem cells (expansion) or more differentiated cell types (differentiation), which is fundamental for ...

Lineage-reprogramming of Pericyte-derived Cells of the Adult Human Brain into Induced Neurons

Direct lineage-reprogramming of non-neuronal cells into induced neurons (iNs) may provide insights into the molecular mechanisms underlying neurogenesis and enable new strategies for in vitro modeling or repairing the diseased brain. Identifying brain-resident non-neuronal cell types amenable to direct conversion into iNs might allow for launching such an approach in situ, i.e. within the damaged brain tissue. Here we describe a protocol developed in the attempt of identifying cells derived from the adult human brain that fulfill this premise. This protocol involves: (1) the culturing of human cells from the cerebral cortex obtained from adult human brain biopsies; (2) the in vitro expansion (approximately requiring 2-4 weeks) and characterization of the culture by immunocytochemistry and flow cytometry; (3) the enrichment by fluorescence-activated cell sorting (FACS) using anti-PDGF receptor-&#946; and anti-CD146 antibodies; (4) the retrovirus-mediated transduction with the neurogenic transcription factors sox2 and ascl1; (5) and finally the characterization of the resultant pericyte-derived induced neurons (PdiNs) by immunocytochemistry (14 days to 8 weeks following retroviral transduction). At this stage, iNs can be probed for their electrical properties by patch-clamp recording. This protocol provides a highly reproducible procedure for the in vitro lineage conversion of brain-resident pericytes into functional human iNs.

Targeting brain-resident cells for direct lineage-reprogramming offers new perspectives for brain repair. Here we describe a protocol of how to prepare cultures enriched for brain-resident pericytes from the adult human cerebral cortex and convert these into induced neurons by retrovirus-mediated expression of the transcription factors Sox2 and Ascl1.

Direct lineage-reprogramming of non-neuronal cells into induced neurons (iNs) may provide insights into the molecular mechanisms underlying neurogenesis ...

Intracerebroventricular Viral Injection of the Neonatal Mouse Brain for Persistent and Widespread Neuronal Transduction

With the pace of scientific advancement accelerating rapidly, new methods are needed for experimental neuroscience to quickly and easily manipulate gene expression in the mouse brain. Here we describe a technique first introduced by Passini and Wolfe for direct intracranial delivery of virally-encoded transgenes into the neonatal mouse brain. In its most basic form, the procedure requires only an ice bucket and a microliter syringe. However, the protocol can also be adapted for use with stereotaxic frames to improve consistency for researchers new to the technique. The method relies on the ability of adeno-associated virus (AAV) to move freely from the cerebral ventricles into the brain parenchyma while the ependymal lining is still immature during the first 12-24 hr after birth. Intraventricular injection of AAV at this age results in widespread transduction of neurons throughout the brain. Expression begins within days of injection and persists for the lifetime of the animal. Viral titer can be adjusted to control the density of transduced neurons, while co-expression of a fluorescent protein provides a vital label of transduced cells. With the rising availability of viral core facilities to provide both off-the-shelf, pre-packaged reagents and custom viral preparation, this approach offers a timely method for manipulating gene expression in the mouse brain that is fast, easy, and far less expensive than traditional germline engineering.

Here we demonstrate a technique for widespread neuronal transduction by intraventricular injection of adeno-associated virus into the neonatal mouse brain. This method provides a rapid and easy way to attain lifelong expression of virally-delivered transgenes.

With the pace of scientific advancement accelerating rapidly, new methods are needed for experimental neuroscience to quickly and easily manipulate gene ...

Transplantation of Chemogenetically Engineered Cortical Interneuron Progenitors into Early Postnatal Mouse Brains

Neuronal development is regulated by a complex combination of environmental and genetic factors. Assessing the relative contribution of each component is a complicated task, which is particularly difficult in regards to the development of &#947;-aminobutyric acid (GABA)ergic cortical interneurons (CIs). CIs are the main inhibitory neurons in the cerebral cortex, and they play key roles in neuronal networks, by regulating both the activity of individual pyramidal neurons, as well as the oscillatory behavior of neuronal ensembles. They are generated in transient embryonic structures (medial and caudal ganglionic eminences -&#160;MGE and CGE) that are very difficult to efficiently target using in utero electroporation approaches. Interneuron progenitors migrate long distances during normal embryonic development, before they integrate in the cortical circuit. This remarkable ability to disperse and integrate into a developing network can be hijacked by transplanting embryonic interneuron precursors into early post-natal host cortices. Here, we present a protocol that allows genetic modification of embryonic interneuron progenitors using focal ex vivo electroporation. These engineered interneuron precursors are then transplanted into early post-natal host cortices, where they will mature into easily identifiable CIs. This protocol allows the use of multiple genetically encoded tools, or the ability to regulate the expression of specific genes in interneuron progenitors, in order to investigate the impact of either genetic or environmental variables on the maturation and integration of CIs.

Here we present a protocol, designed to use chemogenetic tools to manipulate the activity of cortical interneuron progenitors transplanted into the cortex of early postnatal mice.

Neuronal development is regulated by a complex combination of environmental and genetic factors. Assessing the relative contribution of each component is ...

In vivo Reprogramming of Adult Somatic Cells to Pluripotency by Overexpression of Yamanaka Factors

Induced pluripotent stem (iPS) cells that result from the reprogramming of somatic cells to a pluripotent state by forced expression of defined factors are offering new opportunities for regenerative medicine. Such clinical applications of iPS cells have been limited so far, mainly due to the poor efficiency of the existing reprogramming methodologies and the risk of the generated iPS cells to form tumors upon implantation.
We hypothesized that the reprogramming of somatic cells towards pluripotency could be achieved in vivo by gene transfer of reprogramming factors. In order to efficiently reprogram cells in vivo, high levels of the Yamanaka (OKSM) transcription factors need to be expressed at the target tissue. This can be achieved by using different viral or nonviral gene vectors depending on the target tissue. In this particular study, hydrodynamic tail-vein (HTV) injection of plasmid DNA was used to deliver the OKSM factors to mouse hepatocytes. This provided proof-of-evidence of in vivo reprogramming of adult, somatic cells towards a pluripotent state with high efficiency and fast kinetics. Furthermore no tumor or teratoma formation was observed in situ.
It can be concluded that reprogramming somatic cells in vivo may offer a potential approach to induce enhanced pluripotency rapidly, efficiently, and safely compared to in vitro performed protocols and can be applied to different tissue types in the future.

In vivo Reprogramming of Adult Somatic Cells to Pluripotency by Overexpression of Yamanaka Factors

This study demonstrates the reprogramming of somatic cells towards pluripotency in vivo without the generation of teratomas. We used hydrodynamic tail vein injection of plasmid DNA encoding the Yamanka factors to induce the in vivo reprogramming of adult hepatocytes into cells of enhanced pluripotency.

Induced pluripotent stem (iPS) cells that result from the reprogramming of somatic cells to a pluripotent state by forced expression of defined factors ...

Biology

In vitro Modeling for Neurological Diseases using Direct Conversion from Fibroblasts to Neuronal Progenitor Cells and Differentiation into Astrocytes

Research on neurological disorders focuses primarily on the impact of neurons on disease mechanisms. Limited availability of animal models severely impacts the study of cell type specific contributions to disease. Moreover, animal models usually do not reflect variability in mutations and disease courses seen in human patients. Reprogramming methods for generation of induced pluripotent stem cells (iPSCs) have revolutionized patient specific research and created valuable tools for studying disease mechanisms. However, iPSC technology has disadvantages such as time, labor commitment, clonal selectivity and loss of epigenetic markers. Recent modifications of these methods allow more direct generation of cell lineages or specific cell types, bypassing clonal isolation or a pluripotent stem cell state. We have developed a rapid direct conversion method to generate induced Neuronal Progenitor Cells (iNPCs) from skin fibroblasts utilizing retroviral vectors in combination with neuralizing media. The iNPCs can be differentiated into neurons (iNs) oligodendrocytes (iOs) and astrocytes (iAs). iAs production facilitates rapid drug and disease mechanism testing as differentiation from iNPCs only takes 5 days. Moreover, iAs are easy to work with and are generated in pure populations at large numbers. We developed a highly reproducible co-culture assay using mouse GFP+ neurons and patient derived iAs to evaluate potential therapeutic strategies for numerous neurological and neurodegenerative disorders. Importantly, the iA assays are scalable to 384-well format facilitating the evaluation of multiple small molecules in one plate. This approach allows simultaneous therapeutic evaluation of multiple patient cell lines with diverse genetic background. Easy production and storage of iAs and capacity to screen multiple compounds in one assay renders this methodology adaptable for personalized medicine.

We describe a protocol to reprogram human skin-derived fibroblasts into induced Neuronal Progenitor Cells (iNPCs), and their subsequent differentiation into induced Astrocytes (iAs). This method leads to fast and reproducible generation of iNPCs and iAs in large quantities.

Research on neurological disorders focuses primarily on the impact of neurons on disease mechanisms. Limited availability of animal models severely ...

Isolation and Direct Neuronal Reprogramming of Mouse Astrocytes

Direct neuronal reprogramming is a powerful approach to generate functional neurons from different starter cell populations without passing through multipotent intermediates. This technique not only holds great promises in the field of disease modeling, as it allows to convert, for example, fibroblasts for patients suffering neurodegenerative diseases into neurons, but also represents a promising alternative for cell-based replacement therapies. In this context, a major scientific breakthrough was the demonstration that differentiated non-neural cells within the central nervous system, such as astrocytes, could be converted into functional neurons in vitro. Since then, in vitro direct reprogramming of astrocytes into neurons has provided substantial insights into the molecular mechanisms underlying forced identity conversion and the hurdles that prevent efficient reprogramming. However, results from in vitro&#160;experiments performed in different labs are difficult to compare due to differences in the methods used to isolate, culture, and reprogram astrocytes. Here, we describe a detailed protocol to reliably isolate and culture astrocytes with high purity from different regions of the central nervous system of mice at postnatal ages via magnetic cell sorting. Furthermore, we provide protocols to reprogram cultured astrocytes into neurons via viral transduction or DNA transfection. This streamlined and standardized protocol can be used to investigate the molecular mechanisms underlying cell identity maintenance, the establishment of a new neuronal identity, as well as the generation of specific neuronal subtypes and their functional properties.

Here we describe a detailed protocol to generate highly enriched cultures of astrocytes derived from different regions of the central nervous system of postnatal mice and their direct conversion into functional neurons by the forced expression of transcription factors.

Direct neuronal reprogramming is a powerful approach to generate functional neurons from different starter cell populations without passing through ...

Viral-Mediated Labeling and Transplantation of Medial Ganglionic Eminence Cells for In Vivo Studies

Source: Vogt, D. et al., <a href="https://appjove.unicartagenaproxy.elogim.com/v/52740">Viral-mediated Labeling and Transplantation of Medial Ganglionic Eminence (MGE) Cells for In Vivo Studies.</a>&#160;J. Vis. Exp.&#160;(2015).
This video demonstrates the viral labeling and transplantation of medial ganglionic eminence (MGE) cells for in vivo studies. It outlines the steps involved in transducing MGE cells with a viral reporter, transplanting these transduced cells into the cortex of a mouse pup, and enabling reporter expression in specific interneuron subtypes.

In Vivo Direct Reprogramming of Resident Glial Cells into Interneurons by Intracerebral Injection of Viral Vectors

Summary

Explore More Videos

Chapters in this video

Viral-mediated Labeling and Transplantation of Medial Ganglionic Eminence (MGE) Cells for In Vivo Studies

Intraventricular Transplantation of Engineered Neuronal Precursors for In Vivo Neuroarchitecture Studies

Expansion of Embryonic and Adult Neural Stem Cells by In Utero Electroporation or Viral Stereotaxic Injection

Lineage-reprogramming of Pericyte-derived Cells of the Adult Human Brain into Induced Neurons

Intracerebroventricular Viral Injection of the Neonatal Mouse Brain for Persistent and Widespread Neuronal Transduction

Transplantation of Chemogenetically Engineered Cortical Interneuron Progenitors into Early Postnatal Mouse Brains

In vivo Reprogramming of Adult Somatic Cells to Pluripotency by Overexpression of Yamanaka Factors

In vitro Modeling for Neurological Diseases using Direct Conversion from Fibroblasts to Neuronal Progenitor Cells and Differentiation into Astrocytes

Isolation and Direct Neuronal Reprogramming of Mouse Astrocytes

Viral-Mediated Labeling and Transplantation of Medial Ganglionic Eminence Cells for In Vivo Studies