Diffraction data were collected at Southeast Regional Collaborative Access Team (SER-CAT) 22-ID and 22-BM beamlines at the Advanced Photon Source (APS), Argonne National Laboratory. The SAXS data was collected on the SIBYLS beamline at the Advance Light Source (ALS), Lawrence Berkeley National Laboratory. We would like to thank the staff at the SIBYLS beamline for their help with remote data collection and processing. We are grateful to the National Institute of Environmental Health Sciences (NIEHS) Mass Spectrometry Research and Support Group for help determining the protein domain boundaries. This work was supported by the US National Institute of Health Intramural Research Program; US National Institute of Environmental Health Sciences (NIEHS) (ZIA ES103247 to R. E. S.) and the Canadian Institutes of Health Research (CIHR, 146626 to M.C.P). Use of the APS was supported by the US Department of Energy, Office of Science, Office of Basic Energy Sciences under Contract No. W-31-109-Eng-38. Use of the Advanced Light Source (ALS) was supported by the Director, Office of Science, Office of Basic Energy Sciences, of the U.S. Department of Energy under Contract No. DE-AC02-05CH11231. Additional support for the SIBYLS SAXS beamline comes from the National Institute of Health project MINOS (R01GM105404) and a High-End Instrumentation Grant S10OD018483. We would also like to thank Andrea Moon and Dr. Sara Andres for their critical reading of this manuscript.

The authors have nothing to disclose.

Using this protocol, recombinant Nsa1 from S. cerevisiae was generated for structural studies by both X-ray crystallography and SAXS. Nsa1 was well-behaved in solution and crystallized in multiple crystal forms. During the optimization of these crystals, it was discovered that the C-terminus of Nsa1 was sensitive to protease degradation. The high resolution, orthorhombic crystal form could only be duplicated with C-terminal truncation variants of Nsa1, likely because the flexible C-terminus of Nsa1 prevented cry...

Ribosomes are large ribonucleoprotein machines that carry out the essential role of translating mRNA into proteins in all living cells. Ribosomes are composed of two subunits which are produced in a complex process termed ribosome biogenesis1,2,3,4. Eukaryotic ribosome assembly relies on the aid of hundreds of essential ribosomal assembly factors2,3,5. Nsa1 (Nop7 associated 1) is a eukaryotic ribosome assembly factor that is specifically required for the production of the large ribosomal subunit6, and is known as WD-repeat containing 74 (WDR74) in higher organisms7. WDR74 has been shown to be required for blastocyst formation in mice8and the WDR74 promoter is frequently mutated in cancer cells9. However, the function and precise mechanisms of Nsa1/WDR74 in ribosome assembly are still largely unknown. To begin to uncover the role of Nsa1/WDR74 during eukaryotic ribosome maturation, multiple structural analyses were performed, including X-ray crystallography and small angle X-ray scattering (SAXS)10.
X-ray crystallography, nuclear magnetic resonance (NMR) spectroscopy, electron microscopy, and SAXS are all important techniques for studying macromolecular structure. Size, shape, availability, and stability of macromolecules influences the structural biology method for which a particular macromolecule will be best suited, however combining multiple techniques through a so-called &#34;hybrid&#34; approach is becoming an increasingly beneficial tool11. In particular X-ray crystallography and SAXS are powerful and complementary methods for structural determination of macromolecules12.
Crystallography provides high-resolution atomic structures ranging from small molecules to large cellular machinery such as the ribosome, and has led to numerous breakthroughs in the understanding of the biological functions of proteins and other macromolecules13. Furthermore, structure-based drug design harnesses the power of crystal structures for molecular docking by computational methods, adding a critical dimension to drug discovery and development14. Despite its broad applicability, flexible and disordered systems are challenging to assess by crystallography since crystal packing can be hindered or electron density maps may be incomplete or of poor quality. Conversely, SAXS is a solution-based and low-resolution structural approach capable of describing flexible systems ranging from disordered loops and termini to intrinsically disordered proteins12,15,16. Considering it is compatible with a broad range of particle sizes12, SAXS can work synergistically with crystallography to expand the range of biological questions that can be addressed by structural studies.
Nsa1 is suitable for a hybrid structural approach because it contains a well-structured WD40 domain followed by a functional, but flexible C-terminus which is not amenable to X-ray crystallography methods. Following is a protocol for the cloning, expression, and purification of S. cerevisiae Nsa1 for hybrid structural determination by X-ray crystallography and SAXS. This protocol can be adapted to study the structures of other proteins that are comprised of a combination of ordered and disordered regions.

<table><tbody><tr><td>&lt;strong&gt;Molecular Cloning of Nsa1&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>pMBP2 parallel vector</td><td>Sheffield et al, Protein Expression and Purification 15, 34-39 (1999)</td><td></td><td>We used a modified version of pMBP2 which included an N-terminal His-tag (pHMBP)</td></tr><tr><td>S. cerevisiae genomic DNA</td><td>ATCC</td><td>204508D-5</td><td></td></tr><tr><td>&lt;strong&gt;Primers for cloning Nsa1&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>SC_Nsa1_FLFw</td><td>IDT</td><td></td><td>CGC CAA AGG CCT&lt;br/&gt; ATGAGGTTACTAGTCAGCTGTGT&lt;br/&gt; GGATAG</td></tr><tr><td>SC_Nsa1_FLRv</td><td>IDT</td><td></td><td>AATGCAGCGGCCGCTCAAATTTT&lt;br/&gt; GCTTTTCTTACTGGCTTTAGAAGC&lt;br/&gt; AGC</td></tr><tr><td>SC_Nsa1_DeltaCFw</td><td>IDT</td><td></td><td>GGGCGCCATGGGATCCATGAGG&lt;br/&gt; TTACTAGTCAGCTGTGTGG</td></tr><tr><td>SC_Nsa1_DeltaCRv</td><td>IDT</td><td></td><td>GATTCGAAAGCGGCCGCTTAAAC&lt;br/&gt; CTTCCTTTTTTGCTTCCC</td></tr><tr><td>&lt;strong&gt;Recombinant Protein Production and Purification of Nsa1&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Escherichia coli BL21 (DE3) Star Cells</td><td>Invitrogen</td><td>C601003</td><td></td></tr><tr><td>pMBP- NSA1 and various truncations</td><td>Lo et al., 2017</td><td></td><td></td></tr><tr><td>Selenomethionine</td><td>Molecular Dimensions</td><td>MD12-503B</td><td></td></tr><tr><td>IPTG, Dioxane-Free</td><td>Promega</td><td>V3953</td><td></td></tr><tr><td>EDTA Free Protease Inhibitor Cocktail</td><td>Sigma-Aldrich</td><td>4693159001</td><td></td></tr><tr><td>Sodium Chloride</td><td>Caledon Laboratory Chemicals</td><td>7560-1-80</td><td></td></tr><tr><td>Magnesium Chloride hexahydrate</td><td>Sigma-Aldrich</td><td>M2670</td><td></td></tr><tr><td>Tris Buffer, 1 M pH7.5</td><td>KD Medical</td><td>RGF-3340</td><td></td></tr><tr><td>Glycerol</td><td>Invitrogen</td><td>15514-029</td><td></td></tr><tr><td>beta-mercaptoethanol</td><td>Sigma</td><td>M6250</td><td></td></tr><tr><td>1M Imidazole, pH 8.0</td><td>Teknova</td><td>I6980-06</td><td></td></tr><tr><td>Talon Affinity Resin</td><td>Clonetech</td><td>635503</td><td></td></tr><tr><td>Amicon Ultra 15 mL Centrifugal Filter (MWCO 10K)</td><td>Millipore</td><td>UFC901024</td><td></td></tr><tr><td>HiLoad 16/600 Superdex 200 Prep Grade Gel Filtration Column</td><td>GE-Healthcare</td><td>28989335</td><td></td></tr><tr><td>TEV Protease</td><td>Prepared by NIEHS Protein Expression Core</td><td>Expression plasmid provided by NCI (Tropea et al. Methods Mol Biology, 2009)</td><td></td></tr><tr><td>4-15% Mini-PROTEAN TGX Precast Protein Gels</td><td>BioRad</td><td>456-8056</td><td></td></tr><tr><td>&lt;strong&gt;Crystallization, Proteolytic Screening&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Crystal Screen</td><td>Hampton Research</td><td>HR2-110</td><td></td></tr><tr><td>Crystal Screen 2</td><td>Hampton Research</td><td>HR2-112</td><td></td></tr><tr><td>Salt Rx</td><td>Hampton Research</td><td>HR2-136</td><td></td></tr><tr><td>Index Screen</td><td>Hampton Research</td><td>HR2-144</td><td></td></tr><tr><td>PEG/Ion Screen</td><td>Hampton Research</td><td>HR2-139</td><td></td></tr><tr><td>JCSG+</td><td>Molecular Dimensions</td><td>MD1-37</td><td></td></tr><tr><td>Wizard Precipitant Synergy</td><td>Molecular Dimensions</td><td>MD15-PS-T</td><td></td></tr><tr><td>Swissci 96-well 3-drop UVP sitting drop plates</td><td>TTP Labtech</td><td>4150-05823</td><td></td></tr><tr><td>3inch Wide Crystal Clear Sealing Tape</td><td>Hampton Research</td><td>HR4-506</td><td></td></tr><tr><td>Proti-Ace Kit</td><td>Hampton Research</td><td>HR2-429</td><td></td></tr><tr><td>PEG 1500</td><td>Molecular Dimensions</td><td>MD2-100-6</td><td></td></tr><tr><td>PEG 400</td><td>Molecular Dimensions</td><td>MD2-100-3</td><td></td></tr><tr><td>HEPES/sodium hydroxide pH 7.5</td><td>Molecular Dimensions</td><td>MD2-011-</td><td></td></tr><tr><td>Sodium Citrate tribasic</td><td>Molecular Dimensions</td><td>MD2-100-127</td><td></td></tr><tr><td>22 mm x 0.22 mm Siliconized Coverslides</td><td>Hampton Research</td><td>HR3-231</td><td></td></tr><tr><td>24 Well Plates with sealant (VDX Plate with Sealant)</td><td>Hampton Research</td><td>HR3-172</td><td></td></tr><tr><td>18 mM Mounted Nylon Loops (0.05 mm to 0.5 mM)</td><td>Hampton Research</td><td>HR4-945, HR4-947, HR4-970, HR4-971</td><td></td></tr><tr><td>Seed Bead Kit</td><td>Hampton Research</td><td>HR2-320</td><td></td></tr><tr><td>Magnetic Crystal Caps</td><td>Hampton Research</td><td>HR4-779</td><td></td></tr><tr><td>Magnetic Cryo Wand</td><td>Hampton Research</td><td>HR4-729</td><td></td></tr><tr><td>Cryogenic Foam Dewar</td><td>Hampton Research</td><td>HR4-673</td><td></td></tr><tr><td>Crystal Puck System</td><td>MiTeGen</td><td>M-CP-111-021</td><td></td></tr><tr><td>Full Skirt 96 well Clear Plate</td><td>VWR</td><td>10011-228</td><td></td></tr><tr><td>AxyMat Sealing Mat</td><td>VWR</td><td>10011-130</td><td></td></tr><tr><td>&lt;strong&gt;Equipment&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>UVEX-m</td><td>JAN Scientific, Inc.</td><td></td><td></td></tr><tr><td>Nanodrop Lite Spectrophotometer</td><td>Thermo-Fisher</td><td></td><td></td></tr><tr><td>Mosquito Robot</td><td>TTP Labtech</td><td></td><td></td></tr><tr><td>&lt;strong&gt;Software/Websites&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>HKL2000</td><td>Otwinoski and Minor, 1997</td><td></td><td></td></tr><tr><td>Phenix</td><td>Adams et al., 2010</td><td></td><td></td></tr><tr><td>Coot</td><td>Emsley et al., 2010</td><td></td><td></td></tr><tr><td>ATSAS</td><td>Petoukhov et al., 2012</td><td></td><td>https://www.embl-hamburg.de/biosaxs/atsas-online/</td></tr><tr><td>Scatter</td><td>Rambo and Tainer, 2013</td><td></td><td></td></tr><tr><td>Pymol</td><td>The PyMOL Molecular Graphics System, Version 1.8 Schr&amp;ouml;dinger, LLC.</td><td></td><td></td></tr><tr><td>BUNCH</td><td>Petoukhov and Svergun, 2005</td><td></td><td></td></tr><tr><td>CRYSOL</td><td>Svergun et al, 1995</td><td></td><td></td></tr><tr><td>PRIMUS</td><td>Konarev et al, 2003</td><td></td><td></td></tr><tr><td>EOM</td><td>Tria et al, 2015</td><td></td><td></td></tr></tbody></table>

combining x-ray crystallography with small angle x-ray scattering to model unstructured regions of nsa1 from s. cerevisiae

Determination of the full-length structure of ribosome assembly factor Nsa1 from Saccharomyces cerevisiae (S. cerevisiae) is challenging because of the disordered and protease labile C-terminus of the protein. This manuscript describes the methods to purify recombinant Nsa1 from S. cerevisiae for structural analysis by both X-ray crystallography and SAXS. X-ray crystallography was utilized to solve the structure of the well-ordered N-terminal WD40 domain of Nsa1, and then SAXS was used to resolve the structure of the C-terminus of Nsa1 in solution. Solution scattering data was collected from full-length Nsa1 in solution. The theoretical scattering amplitudes were calculated from the high-resolution crystal structure of the WD40 domain, and then a combination of rigid body and ab initio modeling revealed the C-terminus of Nsa1. Through this hybrid approach the quaternary structure of the entire protein was reconstructed. The methods presented here should be generally applicable for the hybrid structural determination of other proteins composed of a mix of structured and unstructured domains.

Nsa1 was PCR amplified from S. cerevisiae genomic DNA and subcloned into a vector containing an N-terminal 6x-Histidine affinity tag followed by MBP and a TEV protease site. Nsa1 was transformed into E. coli BL21(DE3) cells and high yields of protein expression were obtained following induction with IPTG and growth at 25 &#176;C overnight (Figure 1A). Nsa1 was affinity-purified on immobilized cobalt affinity resin, followed by MBP cleavage w...

Watch this Scientific Journal Video about Combining X-Ray Crystallography with Small Angle X-Ray Scattering to Model Unstructured Regions of Nsa1 from S. Cerevisiae at JoVE.com

Combining X-Ray Crystallography with Small Angle X-Ray Scattering to Model Unstructured Regions of Nsa1 from S. Cerevisiae

This method describes the cloning, expression, and purification of recombinant Nsa1 for structural determination by X-ray crystallography and small-angle X-ray scattering (SAXS), and is applicable for the hybrid structural analysis of other proteins containing both ordered and disordered domains.

Combining X-Ray Crystallography with Small Angle X-Ray Scattering to Model Unstructured Regions of Nsa1 from S. Cerevisiae

Determination of the full-length structure of ribosome assembly factor Nsa1 from Saccharomyces cerevisiae (S. cerevisiae) is challenging because of the ...

combining-x-ray-crystallography-with-small-angle-x-ray-scattering-to

Universidad de Cartagena UDEC

Research

JoVE Journal

Biochemistry

9.8K Views.  National Institutes of Health. This method describes the cloning, expression, and purification of recombinant Nsa1 for structural determination by X-ray crystallography and small-angle X-ray scattering (SAXS), and is applicable for the hybrid structural analysis of other proteins containing both ordered and disordered domains.

Video: Combining X-Ray Crystallography with Small Angle X-Ray Scattering to Model Unstructured Regions of Nsa1 from S. Cerevisiae

Online Size-exclusion and Ion-exchange Chromatography on a SAXS Beamline

Biological small angle X-ray scattering (BioSAXS) is a powerful technique in molecular and structural biology used to determine solution structure, particle size and shape, and surface-to-volume ratio of macromolecules. The technique is applicable to a very wide variety of solution conditions spanning a broad range of concentrations, pH values, ionic strengths, temperatures, additives, etc., but the sample is required to be monodisperse. This caveat led to the implementation of liquid chromatography systems on SAXS beamlines. Here, we describe the upstream integration of size-exclusion (SEC) and ion-exchange chromatography (IEC) on a beamline, different methods for optimal background subtraction, and data reduction. As an example, we describe how we use SEC- and IEC-SAXS on a fragment of the essential vaccinia virus protein D5, consisting of a D5N helicase domain. We determine its overall shape and molecular weight, showing the hexameric structure of the protein.

The determination of the solution structure of a protein by small angle X-ray scattering (SAXS) requires monodisperse samples. Here, we present two possibilities to ensure minimal delays between sample preparation and data acquisition: online size-exclusion chromatography (SEC) and online ion-exchange chromatography (IEC).

Biological small angle X-ray scattering (BioSAXS) is a powerful technique in molecular and structural biology used to determine solution structure, ...

Atomic Scale Structural Studies of Macromolecular Assemblies by Solid-state Nuclear Magnetic Resonance Spectroscopy

Supramolecular protein assemblies play fundamental roles in biological processes ranging from host-pathogen interaction, viral infection to the propagation of neurodegenerative disorders. Such assemblies consist in multiple protein subunits organized in a non-covalent way to form large macromolecular objects that can execute a variety of cellular functions or cause detrimental consequences. Atomic insights into the assembly mechanisms and the functioning of those macromolecular assemblies remain often scarce since their inherent insolubility and non-crystallinity often drastically reduces the quality of the data obtained from most techniques used in structural biology, such as X-ray crystallography and solution Nuclear Magnetic Resonance (NMR). We here present magic-angle spinning solid-state NMR spectroscopy (SSNMR) as a powerful method to investigate structures of macromolecular assemblies at atomic resolution. SSNMR can reveal atomic details on the assembled complex without size and solubility limitations. The protocol presented here describes the essential steps from the production of 13C/15N isotope-labeled macromolecular protein assemblies to the acquisition of standard SSNMR spectra and their analysis and interpretation. As an example, we show the pipeline of a SSNMR structural analysis of a filamentous protein assembly.

Structures of supramolecular protein assemblies at atomic resolution are of high relevance because of their crucial roles in a variety of biological phenomena. Herein, we present a protocol to perform high-resolution structural studies on insoluble and non-crystalline macromolecular protein assemblies by magic-angle spinning solid-state nuclear magnetic resonance spectroscopy (MAS SSNMR).

Supramolecular protein assemblies play fundamental roles in biological processes ranging from host-pathogen interaction, viral infection to the ...

Microcrystallography of Protein Crystals and In Cellulo Diffraction

The advent of high-quality microfocus beamlines at many synchrotron facilities has permitted the routine analysis of crystals smaller than 10 &#181;m in their largest dimension, which used to represent a challenge. We present two alternative workflows for the structure determination of protein microcrystals by X-ray crystallography with a particular focus on crystals grown in vivo. The microcrystals are either extracted from cells by sonication and purified by differential centrifugation, or analyzed in cellulo after cell sorting by flow cytometry of crystal-containing cells. Optionally, purified crystals or crystal-containing cells are soaked in heavy atom solutions for experimental phasing. These samples are then prepared for diffraction experiments in a similar way by application onto a micromesh support and flash cooling in liquid nitrogen. We briefly describe and compare serial diffraction experiments of isolated microcrystals and crystal-containing cells using a microfocus synchrotron beamline to produce datasets suitable for phasing, model building and refinement.
These workflows are exemplified with crystals of the Bombyx mori cypovirus 1 (BmCPV1) polyhedrin produced by infection of insect cells with a recombinant baculovirus. In this case study, in cellulo analysis is more efficient than analysis of purified crystals and yields a structure in ~8 days from expression to refinement.

Microcrystallography of Protein Crystals and In Cellulo Diffraction

A protocol is presented for X-ray crystallography using protein microcrystals. Two examples analyzing in vivo-grown microcrystals after purification or in cellulo are compared.

The advent of high-quality microfocus beamlines at many synchrotron facilities has permitted the routine analysis of crystals smaller than 10 &#181;m in ...

Biochemical and Structural Characterization of the Carbohydrate Transport Substrate-binding-protein SP0092

Development of new antimicrobials and vaccines for Streptococcus pneumoniae (pneumococcus) are necessary to halt the rapid rise in multiple resistant strains. Carbohydrate substrate binding proteins (SBPs) represent viable targets for the development of protein-based vaccines and new antimicrobials because of their extracellular localization and the centrality of carbohydrate import for pneumococcal metabolism, respectively. Described here is a rationalized integrated protocol to carry out a comprehensive characterization of SP0092, which can be extended to other carbohydrate SBPs from the pneumococcus and other bacteria. This procedure can aid the structure-based design of inhibitors for this class of proteins. Presented in the first part of this manuscript are protocols for biochemical analysis by thermal shift assay, multi angle light scattering (MALS), and size exclusion chromatography (SEC), which optimize the stability and homogeneity of the sample directed to crystallization trials and so enhance the probability of success. The second part of this procedure describes the characterization of the SBP crystals using a tunable wavelength anomalous diffraction synchrotron beamline, and data collection protocols for measuring data that can be used to resolve the crystallized protein structure.

A streamlined protocol for performing an extensive biochemical and structural characterization of a carbohydrate substrate binding protein from Streptococcus pneumoniae is presented.

Development of new antimicrobials and vaccines for Streptococcus pneumoniae (pneumococcus) are necessary to halt the rapid rise in multiple resistant ...

Small and Wide Angle X-Ray Scattering Studies of Biological Macromolecules in Solution

In this paper, Small and Wide Angle X-ray Scattering (SWAXS) analysis of macromolecules is demonstrated through experimentation. SWAXS is a technique where X-rays are elastically scattered by an inhomogeneous sample in the nm-range at small angles (typically 0.1 - 5&deg;) and wide angles (typically &gt; 5&deg;). This technique provides information about the shape, size, and distribution of macromolecules, characteristic distances of partially ordered materials, pore sizes, and surface-to-volume ratio. Small Angle X-ray Scattering (SAXS) is capable of delivering structural information of macromolecules between 1 and 200 nm, whereas Wide Angle X-ray Scattering (WAXS) can resolve even smaller Bragg spacing of samples between 0.33 nm and 0.49 nm based on the specific system setup and detector. The spacing is determined from Bragg's law and is dependent on the wavelength and incident angle.
In a SWAXS experiment, the materials can be solid or liquid and may contain solid, liquid or gaseous domains (so-called particles) of the same or another material in any combination. SWAXS applications are very broad and include colloids of all types: metals, composites, cement, oil, polymers, plastics, proteins, foods, and pharmaceuticals. For solid samples, the thickness is limited to approximately 5 mm.
Usage of a lab-based SWAXS instrument is detailed in this paper. With the available software (e.g., GNOM-ATSAS 2.3 package by D. Svergun EMBL-Hamburg and EasySWAXS software) for the SWAXS system, an experiment can be conducted to determine certain parameters of interest for the given sample. One example of a biological macromolecule experiment is the analysis of 2 wt% lysozyme in a water-based aqueous buffer which can be chosen and prepared through numerous methods. The preparation of the sample follows the guidelines below in the Preparation of the Sample section. Through SWAXS experimentation, important structural parameters of lysozyme, e.g. the radius of gyration, can be analyzed.

The demonstration of the small and wide angle X-ray scattering (SWAXS) procedure has become instrumental in the study of biological macromolecules. Through the use of the instrumentation and procedures of specific angle methods and preparation, the experimental data from the SWAXS displays the atomic and nano-scale characterization of macromolecules.

In this paper, Small and Wide Angle X-ray Scattering (SWAXS) analysis of macromolecules is demonstrated through experimentation. SWAXS is a technique ...

Bioengineering

Contrast-Matching Detergent in Small-Angle Neutron Scattering Experiments for Membrane Protein Structural Analysis and Ab Initio Modeling

The biological small-angle neutron scattering instrument at the High-Flux Isotope Reactor of Oak Ridge National Laboratory is dedicated to the investigation of biological materials, biofuel processing, and bio-inspired materials covering nanometer to micrometer length scales. The methods presented here for investigating physical properties (i.e., size and shape) of membrane proteins (here, MmIAP, an intramembrane aspartyl protease from Methanoculleus marisnigri) in solutions of micelle-forming detergents are well-suited for this small-angle neutron scattering instrument, among others. Other biophysical characterization techniques are hindered by their inability to address the detergent contributions in a protein-detergent complex structure. Additionally, access to the Bio-Deuteration Lab provides unique capabilities for preparing large-scale cultivations and expressing deuterium-labeled proteins for enhanced scattering signal from the protein. While this technique does not provide structural details at high-resolution, the structural knowledge gap for membrane proteins contains many addressable areas of research without requiring near-atomic resolution. For example, these areas include determination of oligomeric states, complex formation, conformational changes during perturbation, and folding/unfolding events. These investigations can be readily accomplished through applications of this method.

Contrast-Matching Detergent in Small-Angle Neutron Scattering Experiments for Membrane Protein Structural Analysis and Ab Initio Modeling

This protocol demonstrates how to obtain a low-resolution ab initio model and structural details of a detergent-solubilized membrane protein in solution using small-angle neutron scattering with contrast-matching of the detergent.

The biological small-angle neutron scattering instrument at the High-Flux Isotope Reactor of Oak Ridge National Laboratory is dedicated to the ...

Structural Studies of Macromolecules in Solution using Small Angle X-Ray Scattering

Protein-protein interactions involving proteins with multiple globular domains present technical challenges for determining how such complexes form and how the domains are oriented/positioned. Here, a protocol with the potential for elucidating which specific domains mediate interactions in multicomponent system through ab initio modeling is described. A method for calculating solution structures of macromolecules and their assemblies is provided that involves integrating data from small angle X-ray scattering (SAXS), chromatography, and atomic resolution structures together in a hybrid approach. A specific example is that of the complex of full-length nidogen-1, which assembles extracellular matrix proteins and forms an extended, curved nanostructure. One of its globular domains attaches to laminin &#947;-1, which structures the basement membrane. This provides a basis for determining accurate structures of flexible multidomain protein complexes and is enabled by synchrotron sources coupled with automation robotics and size exclusion chromatography systems. This combination allows rapid analysis in which multiple oligomeric states are separated just prior to SAXS data collection. The analysis yields information on the radius of gyration, particle dimension, molecular shape and interdomain pairing. The protocol for generating 3D models of complexes by fitting high-resolution structures of the component proteins is also given.

Here, we present how Small Angle X-Ray Scattering (SAXS) can be utilized to obtain information on low-resolution envelopes representing the macromolecular structures. When used in conjunction with high-resolution structural techniques such as X-Ray Crystallography and Nuclear Magnetic Resonance, SAXS can provide detailed insights into multidomain proteins and macromolecular complexes in-solution.

Protein-protein interactions involving proteins with multiple globular domains present technical challenges for determining how such complexes form and ...

Structure Solution of the Fluorescent Protein Cerulean Using MeshAndCollect

X-ray crystallography is the major technique used to obtain high resolution information concerning the 3-dimensional structures of biological macromolecules. Until recently, a major requirement has been the availability of relatively large, well diffracting crystals, which are often challenging to obtain. However, the advent of serial crystallography and a renaissance in multi-crystal data collection methods has meant that the availability of large crystals need no longer be a limiting factor. Here, we illustrate the use of the automated MeshAndCollect protocol, which first identifies the positions of many small crystals mounted on the same sample holder and then directs the collection from the crystals of a series of partial diffraction data sets for subsequent merging and use in structure determination. MeshAndCollect can be applied to any type of micro-crystals, even if weakly diffracting. As an example, we present here the use of the technique to solve the crystal structure of the Cyan Fluorescent Protein (CFP) Cerulean.

We present the use of the MeshAndCollect protocol to obtain a complete diffraction data set, for use in subsequent structure determination, composed of partial diffraction data sets collected from many small crystals of the fluorescent protein Cerulean.

X-ray crystallography is the major technique used to obtain high resolution information concerning the 3-dimensional structures of biological ...

Analysis of SEC-SAXS data via EFA deconvolution and Scatter

BioSAXS is a popular technique used in molecular and structural biology to determine the solution structure, particle size and shape, surface-to-volume ratio and conformational changes of macromolecules and macromolecular complexes. A high quality SAXS dataset for structural modeling must be from monodisperse, homogeneous samples and this is often only reached by a combination of inline chromatography and immediate SAXS measurement. Most commonly, size-exclusion chromatography is used to separate samples and exclude contaminants and aggregations from the particle of interest allowing SAXS measurements to be made from a well-resolved chromatographic peak of a single protein species. Still, in some cases, even inline purification is not a guarantee of monodisperse samples, either because multiple components are too close to each other in size or changes in shape induced through binding alter perceived elution time. In these cases, it may be possible to deconvolute the SAXS data of a mixture to obtain the idealized SAXS curves of individual components. Here, we show how this is achieved and the practical analysis of SEC-SAXS data is performed on ideal and difficult samples. Specifically, we show the SEC-SAXS analysis of the vaccinia E9 DNA polymerase exonuclease minus mutant.

SEC-BioSAXS measurements of biological macromolecules are a standard approach for determining solution structure of macromolecules and their complexes. Here, we analyze SEC-BioSAXS data from two types of commonly encountered SEC traces&#8212;chromatograms with fully resolved and partially resolved peaks. We demonstrate the analysis and deconvolution using scatter and BioXTAS RAW.

BioSAXS is a popular technique used in molecular and structural biology to determine the solution structure, particle size and shape, surface-to-volume ...

Assembly and Characterization of Polyelectrolyte Complex Micelles

Polyelectrolyte complex micelles (PCMs), core-shell nanoparticles formed by self-assembly of charged polymers in aqueous solution, provide a powerful platform for exploring the physics of polyelectrolyte interactions and also offer a promising solution to the pressing problem of delivering therapeutic oligonucleotides in vivo. Developing predictive structure-property relationships for PCMs has proven difficult, in part due to the presence of strong kinetic traps during nanoparticle self-assembly. This article discusses criteria for choosing polymers for PCM construction and provides protocols based on salt annealing that enable assembly of repeatable, low-polydispersity nanoparticles. We also discuss PCM characterization using light scattering, small-angle X-ray scattering, and electron microscopy.

We provide protocols and representative data for designing, assembling, and characterizing polyelectrolyte complex micelles, core-shell nanoparticles formed by polyelectrolytes and hydrophilic charged-uncharged block copolymers.

Polyelectrolyte complex micelles (PCMs), core-shell nanoparticles formed by self-assembly of charged polymers in aqueous solution, provide a powerful ...

Combining X-Ray Crystallography with Small Angle X-Ray Scattering to Model Unstructured Regions of Nsa1 from S. Cerevisiae

Summary

Explore More Videos

Chapters in this video

Online Size-exclusion and Ion-exchange Chromatography on a SAXS Beamline

Atomic Scale Structural Studies of Macromolecular Assemblies by Solid-state Nuclear Magnetic Resonance Spectroscopy

Microcrystallography of Protein Crystals and In Cellulo Diffraction

Biochemical and Structural Characterization of the Carbohydrate Transport Substrate-binding-protein SP0092

Small and Wide Angle X-Ray Scattering Studies of Biological Macromolecules in Solution

Contrast-Matching Detergent in Small-Angle Neutron Scattering Experiments for Membrane Protein Structural Analysis and Ab Initio Modeling

Structural Studies of Macromolecules in Solution using Small Angle X-Ray Scattering

Structure Solution of the Fluorescent Protein Cerulean Using MeshAndCollect

Analysis of SEC-SAXS data via EFA deconvolution and Scatter

Assembly and Characterization of Polyelectrolyte Complex Micelles