The authors would like to acknowledge the support of Universiti Putra Malaysia.

NOTE: All the chemical and biochemical reagents to be used should be of analytical grade and used without further purification. Prepare all solutions using sterile deionized water. Autoclave all glassware prior to sterilization.
Caution: Please use all appropriate safety practices when performing laboratory activities including the use of engineering controls (fume hood, glovebox) and personal protective equipment (safety glasses, gloves, lab coat, full length pants, closed-toe shoes).
1. Fabrication and Characterization of Modified Electrode using PLA-AuNPs
<ol>
	<li>Preparation and characterization of PLA-AuNPs
	<ol>
		<li>Quickly add 10 mL of sodium citrate solution (38.8 mM) to 100 mL of boiling aqueous chloroauric acid solution (1 mM) and cool it down to ambient temperature. Observe the changes in color in the prepared AuNPs solution which starts as yellow, changes to blackish and finally ends as dark ruby red.</li>
		<li>Place the PLA pellets in a stainless-steel mold for the melting process and preheat them at a temperature of 190 &#176;C for 10 min. Follow with the pressing procedure: put them under a pressure of 2.2 MPa for 1 min as part of the PLA sheet preparation. The PLA sheet will be ready for use after cooling for about 3 h.</li>
		<li>Stirring vigorously, dissolve 0.68 mg of the PLA sheets in 5 mL of chloroform at room temperature. Mix the dissolved PLA with 10 mL of the previously prepared AuNPs solution and homogeneously stir it at room temperature. The homogeneous mixtures can then be denoted as PLA-AuNPs and characterized using UV-Vis, XRD, TEM, and FESEM with EDX.</li>
	</ol>
	</li>
	<li>Preparation and characterization of modified screen-printed carbon electrode 
	NOTE: The SPCE used in this study comprises a three-electrode system: a counter electrode, a carbon working electrode, and an Ag/AgCl reference electrode.
	<ol>
		<li>Quickly pipette 25 &#181;L of the homogenous solution of PLA-AuNPs onto the SPCE and then air dry it for 24 h prior to use.</li>
		<li>Electrochemically characterize the modified electrodes, SPCE/PLA-AuNPs, in potassium ferro cyanide (K3[Fe(CN)6]3-/4-) to measure active surface area, electrochemical impedance spectroscopy, repeatability, reproducibility, and stability30.</li>
	</ol>
	</li>
</ol>
2. Development of the Electrochemical DNA Biosensor
<ol>
	<li>Probe preparation 
	Note: The sequences of the ssDNA probe and complementary DNA were chosen based on information from the National Center for Biotechnology Information (NCBI) database.
	<ol>
		<li>Purchase synthetic oligonucleotides (20-mer ssDNA probe, 20-mer complementary DNA, 20-mer mismatched DNA, and 21-mer non-complementary DNA) as lyophilized powder from commercial laboratories, based on the following sequences: 
		thiolated ssDNA probe: 5&#8242;- / 5ThioMC6-D/CGGATTATGCAGAAGCACTG - 3&#8242; 
		complementary DNA: 5&#8242; - CAGTGCTTCTGCATAATCCG - 3&#8242; 
		one-base mismatched DNA: 5&#8242; - CAGTGCTTCTGC &#7786;TAATCCG - 3&#8242; 
		three-base mismatched DNA: 5&#8242; - CAGTGCTTCT &#266; &#7786;&#7786;TAATCCG - 3&#8242; 
		non-complementary DNA: 5&#8242; - CGCACAAGGCTCGACGGCTGA - 3&#8242;</li>
		<li>Prepare stock solutions of all oligonucleotides (100 &#181;M) using a sterile TE solution (10 mM Tris-HCl, 1 mM EDTA, pH 7.5), divided into analytical portions. Keep this at -4 &#176;C and then make the appropriate dilutions just prior to use.</li>
	</ol>
	</li>
	<li>Optimization of Immobilization and Hybridization 
	Note: An SPCE modified with PLA-AuNPs, denoted as SPCE/PLA-AuNPs, was used for this study and a drop casting method was used for the DNA immobilization and hybridization.
	<ol>
		<li>First, immobilize 25 &#181;L of thiolated ssDNA probe on the SPCE/PLA-AuNPs and then air dry it for 24 h at room temperature, after which it will be finally denoted as SPCE/PLA-AuNPs/ssDNA. Determine optimization of the immobilization condition by using three factors: the concentration of ssDNA (ranging from 0.2 to 1.4 &#181;M), time (ranging from 30 to 210 min), and temperature (ranging from 25 to 75 &#176;C).</li>
		<li>Pipette 25 &#181;L of the complementary DNA on to the surface of SPCE/PLA-AuNPs/ssDNA to carry out the hybridization event after which it can be finally denoted as SPCE/PLA-AuNPs/dsDNA. Determine optimization of the hybridization condition via the two factors of time (ranging from 5 to 30 min) and temperature (ranging from 25 to 75 &#176;C).</li>
		<li>Immerse the immobilized and hybridized electrodes in 20 &#181;M MB for 30 min. Remove the non-specifically adsorbed DNA and excess MB by washing with 0.5 M ABS/20 mM NaCl (pH 4.5) and then rinsing with deionized water. Measure the peak current of MB reduction using DPV technique. Execute the DPV measurement using 0.1 M PBS (pH 7) containing no indicator.</li>
	</ol>
	</li>
	<li>Characterization of the fabricated DNA biosensor
	<ol>
		<li>Immerse the SPCE/PLA-AuNPs in 20 &#181;M MB for 30 min, wash with 0.5 M ABS/20 mM NaCl (pH 4.5), and then rinse with deionized water prior to measuring. Follow a similar procedure for all interactions including the probe DNA, complementary DNA, mismatched DNA, and non-complementary DNA samples.</li>
		<li>Measure the electrochemical reduction. 
		NOTE: We measured DPV using a commercially manufactured Autolab with interface software. 
		The DPV measurements of the MB electrochemical reduction performed at a potential ranging from -0.5 V to 0.25 V, with a step potential of 0.005 V, modulation amplitude of 0.05 V, and a scan rate of 7.73 mVs-1 in 0.1 M PBS (pH 7), containing no indicator. The selectivity, sensitivity, reproducibility, and heat stability of the fabricated DNA biosensor were further studied. Reported results were presented as mean value measurements in three replicates.</li>
	</ol>
	</li>
</ol>
3. Validation of the Fabricated DNA Biosensor Using Real Samples
<ol>
	<li>Preparation of bacterial strains
	<ol>
		<li>Select bacterial samples based on their significant contamination of seafood31,32 . 
		NOTE: V. parahaemolyticus as reference strains and 8 other bacterial strains (Campylobacter jejuni, Listeria monocytogenes, Salmonella typhimurium, Salmonella enteritis, Klebsiella pneumonia, Escherichia coli O157:H7, Bacillus cereus, and Vibrio alginolyticus) of the common foodborne pathogen were employed for the electrochemical DNA biosensor validation in this study.</li>
		<li>Conduct a routine sub-culture of bacterial strains on their respective agar every two weeks to maintain their viability, refer Table 1 for culture conditions.</li>
		<li>Maintain long-term preservation of the bacterial strains in their respective growing broths containing 20% (v/v) glycerol at -80 &#176;C as glycerol protects bacteria by preventing the formation of ice crystals that can damage them during the freezing process. Next, inoculate a loop of preserved bacterial cell culture in glycerol stocks into the respective broths. Incubate the broths according to their respective growth time and temperature when needing to revive the bacteria.</li>
		<li>Determine the quantity of V. parahaemolyticus cells using a spread plate technique33, a standard and a well-known method for enumerating microorganisms derived from a series of dilutions.
		<ol>
			<li>Culture V. parahaemolyticus in Trypticase Soy Broth (TSB + 3% NaCl) at 37 &#176;C in a 140-rpm shaking condition. Then, transfer 1 mL of the bacteria cell culture into 9 mL of TSB + 3% NaCl to obtain a 10-1 dilution factor.</li>
		</ol>
		</li>
		<li>Repeat this step nine times to get a full series of up to 10-10 dilution factor. Next, spread 0.1 mL of each dilution factor (starting from 10-1 to 10-10) on a Vibrio&#39;s selective agar plate for colony counting, respectively. Incubate the plates incubated at 37 &#176;C for 24 h.</li>
		<li>Use a colony counter to count individual colonies and then back-calculate (count the CFU/pipetted amount x dilution factor) to get a colony-forming unit per milliliter density (CFU mL-1). Derive the concentration of the colony forming units (CFUs) in the bacteria cell suspensions from the calibration plot of CFU mL-1 against absorbance.</li>
	</ol>
	</li>
	<li>Preparation of the PCR assay
	<ol>
		<li>Extract genomic DNA following a modified boiled lysis procedure34. First, streak an individual bacterial strain on agar media and inoculate it in broth media, followed by incubating it at its relative growth condition, a 140 rpm shaking condition.</li>
		<li>Pipette a 1 mL culture of broth into a micro centrifuge tube. Centrifuge this at 4830 x g and 4 &#176;C for 1 min to obtain pellets. Use about 500 &#181;L of sterile TE buffer for re-suspension with the pellet. Hold the resulting suspension for 10 min at 98 &#177; 2 &#176;C in a heating block and immediately chill it at -18 &#176;C for 10 min to lyse the cells and release the DNA.</li>
		<li>Centrifuge the genomic DNA at 4830 x g and 4 &#176;C for 3 min to obtain a clear suspension and keep the supernatant at -20 &#176;C for further use. Use a biophotometer measurement with UV absorption at a wavelength of 260 nm (as nucleic acids absorbing wavelength of light) and also at a wavelength of 280 nm (as the proteins absorbing wavelength of light) to determine the concentration and purity of the extracted genomic DNA and then identify all strains using standard biochemical assays35 and verifying them by 16S rRNA gene sequencing36. Finally, denature the genomic DNA at 92 &#176;C for 2 min and cool it rapidly in ice water prior to application to the biosensor.</li>
		<li>Further confirm the presence V. parahaemolyticus using PCR to target the toxR gene. Perform this procedure in a thermocycler using a primer pair (5&#39;-GTCTTCTGACGCAATCGTTG-3&#39; and 5&#39;-ATACGAGTGGTTGCTGTCATG-3&#39;). Optimize the PCR amplification in a total reaction volume of 25 &#181;L consisting of sterile water (15.5 &#181;L), buffer (5 &#181;L), primer (1 &#181;L, 10 &#181;M), dNTP mix (1 &#181;L), DNA template (2 &#181;L), and Taq DNA polymerase (0.2 &#181;L, 10x).</li>
		<li>Mix the components well and arrange the PCR amplification of the target sequence in a thermocycler programmed for 30 cycles of amplification. In our study, each cycle consisted of three-step reactions i.e., initial denaturation (94 &#176;C, 3 min) followed by 30 cycles of denaturation (94 &#176;C, 1 min), annealing (63 &#176;C, 1.5 min) and extension (72 &#176;C, 1.5 min), followed by final extension (72 &#176;C, 7 min).</li>
		<li>Determine the amplified products and their sizes via electrophoresis on 1.5% agarose gel. Capture the gel images with a commercially produced gel-documentation system.</li>
	</ol>
	</li>
	<li>Preparation of cockle samples
	<ol>
		<li>Obtain fresh samples. 
		NOTE: Our fresh cockles (Anadara granosa) were obtained from the wet market in Serdang, Selangor, and quickly brought to the laboratory in an ice cooler box for analysis. Divide the samples into 2 groups, namely the treated and untreated group, assuming that the cockles were harvested uniformly from the start of the harvest until placing them into cold storage.</li>
		<li>Pre-treat cockles in the treated group by storing them at -20 &#176;C for 24 h, followed by exposure to UV light at 20 &#176;C for 4 h prior to DNA extraction. 
		NOTE: The freezing temperature and UV exposure used for the controlled group kills or at least limits the naturally accumulating V. parahaemolyticus in the cockles. Do not apply a higher pasteurization regime of 70 &#176;C as the aim of the controlled condition in this study is to mimic the actual situation of the fresh cockles. Meanwhile, analyze samples directly from the untreated group without any pre-treatment as soon as they arrive in the laboratory.</li>
		<li>Subculture a strain of V. parahaemolyticus ATCC 17802 in TSB (3% NaCl). Determine the level of viable cells in the inoculum via plating of appropriate dilutions of TSB (3% NaCl) on CA in order to obtain an inoculum of 104 CFU mL-1 of V. parahaemolyticus. Wash each cockle in distilled water and scrub it free of dirt before using sterile forceps in a laminar flow cabinet to remove the tissues from the shell.</li>
		<li>Homogenize about 10 g of cockle tissue samples with a homogenizer in 90 mL of sterile TSB (3% NaCl) for 60 s. Add a known amount of V. parahaemolyticus to 9 mL of the homogenized sample broth for the spiked samples. Use the unspiked samples as a negative control. Estimate the cell counts of V. parahaemolyticus spiked on to the cockle samples by plating 0.1 mL of the samples on CA, and subsequently, pipetting 1 mL of samples into a microcentrifuge tube for DNA sample extraction, to be used in the biosensor and PCR assay.</li>
		<li>Extract the genomic DNA of the V. parahaemolyticus from the spiked and unspiked samples following a modified boiled lysis procedure36. Finally, determine the DNA concentration and purity using a bio photometer measurement with UV absorption at a wavelength of 260 nm (as nucleic acids absorbing wavelength of light) and also at a wavelength of 280 nm (as the proteins absorbing wavelength of light).</li>
	</ol>
	</li>
</ol>

The authors have nothing to disclose.

The critical steps in a framework for successful development of this type of electrochemical biosensor are selection of appropriate biological recognition elements for the transducer (nucleic acid or DNA here); chemical approach for constructing the sensing layer of the transducer; transduction material; optimization of DNA immobilization and hybridization; and validation of the developed biosensor using real samples.
Core to the successful development of a sensitive and selective electrochemi...

A major topic of public and scientific debate in recent years, food poisoning is mainly associated with 3 agents: microorganisms1, chemicals2, and parasites3. Contaminated food can cause serious health consequences in humans, especially in the higher risk group of those with weak immune systems, the elderly, pregnant women, babies, and young children4. With more than a million cases of acute diarrhea occurring annually in children under 5 years old in Africa, Asia, and Latin America, food poisoning is a major global disease5,6 and the World Health Organization has established microorganisms as the most important contributor7. Vibrio parahaemolyticus stands out amongst the most widely recognized virulent strains. Usually found in coastal, estuarine, and marine environments8, it is a Gram-negative bacterium, which becomes active in high salt environments, and causes serious human gastroenteritis when eaten in inadequately cooked, mishandled or raw marine products9. Additionally, existing medical conditions in some people make them prone to wound infection, septicemia or ear infection arising from V. parahaemolyticus10. The virulence factors of V. parahaemolyticus hemolysins are divided into two types which contribute to the disease pathogenesis: thermostable direct hemolysin (TDH) coded by tdh genes, and TDH-related hemolysin coded by trh genes11. The virulence markers (tdh and trh genes) of V. parahaemolyticus are mostly found in clinical specimens rather than in environmental specimens.
V. parahaemolyticus possesses the ability to survive under a broad range of conditions, rapidly responding to environmental changes12. Its proliferation mechanism escalates its hazard potential as its toxicity increases in parallel with cell mass13. Even worse, climate change is providing these bacteria with ample conditions to accelerate their cell population growth14. Due to its high frequency, V. parahaemolyticus needs to be monitored along the food supply chain, particularly in the trade and production of seafood since those products are where they are found in enormous quantities15,16 throughout the world. Currently the bacteria are identified and isolated using a range of methods including biochemical tests, enrichment and selective media17, enzyme-linked immunomagnetic sorbent assay (ELISA)18, pulse-field gel electrophoresis (PFGE)19, latex agglutination tests, and polymerase chain reaction (PCR) tests20. These methods usually require qualified personnel, sophisticated instruments, and laborious techniques which do not provide information about contamination immediately. This severely limits the likelihood of promptly detecting harmful contamination and on-site applications. Rapid detection tools remain an outstanding challenge.
Biosensing is emerging as a promising option for the detection of foodborne pathogens because it offers a time-saving, cost-effective, practical, and real-time analysis method21,22,23,24. However, although there have been many positive results of analyte detection in spiked samples and standard solution using biosensors, there is still a lack of research applied to real samples either in aqueous mixtures or organic extracts25. Recently, electrochemical biosensors using direct and/or indirect deoxyribonucleic acid (DNA) detection have received increased attention among scientists, due to their specific detection of the complementary target via a hybridization event26,27,28,29. These unique approaches are more stable in comparison with enzyme-based biosensors, thus offering a promising technology for miniaturization and commercialization. The target of the study reported here is to construct a fast tool that can detect V. parahaemolyticus with high selectivity, sensitivity, and practicality, based on the DNA sequence specificity during hybridization. Identification strategies involve the combination of polylactic acid-stabilized gold nanoparticles (PLA-AuNPs)30 and screen-printed carbon electrodes (SPCEs) in the presence of the hybridization indicator, methylene blue (MB). The potential of the developed detection construct is further explored using bacteria DNA lysate and fresh cockle samples.

<table><tbody><tr><td>Acetic acid</td><td>Merck</td><td>100056</td><td></td></tr><tr><td>Chloroform</td><td>Merck</td><td>102445</td><td></td></tr><tr><td>Diaminoethane tetraacetic acid</td><td>Promega</td><td>E5134</td><td></td></tr><tr><td>Dibasic sodium phosphate&amp;nbsp;</td><td>Sigma-Aldrich</td><td>S9763</td><td></td></tr><tr><td>Disodium hydrogen phosphate</td><td>Sigma-Aldrich</td><td>255793</td><td></td></tr><tr><td>Ethanol&amp;nbsp;</td><td>Sigma-Aldrich</td><td>16368</td><td></td></tr><tr><td>Gold (III) chloride trihydrate</td><td>Sigma-Aldrich</td><td>520918</td><td></td></tr><tr><td>Hydrochloric acid</td><td>Merck</td><td>100317</td><td></td></tr><tr><td>Methylene blue</td><td>Sigma-Aldrich</td><td>M44907</td><td></td></tr><tr><td>Monobasic sodium phosphate, monohydrate</td><td>Sigma-Aldrich</td><td>S3522</td><td></td></tr><tr><td>Phosphate-buffered saline</td><td>Sigma-Aldrich</td><td>P5119</td><td></td></tr><tr><td>Poly(lactic acid) resin, commercial grade 4042D</td><td>NatureWorks</td><td>4042D</td><td></td></tr><tr><td>Potassium chloride</td><td>R&amp;amp;M Chemicals</td><td>59435</td><td></td></tr><tr><td>Potassium dihydrogen phosphate</td><td>Sigma-Aldrich</td><td>P9791</td><td></td></tr><tr><td>Potassium hexacyanoferrate III</td><td>R&amp;amp;M Chemicals</td><td>208019</td><td></td></tr><tr><td>Sodium acetate anhydrous salt</td><td>Sigma-Aldrich</td><td>S2889</td><td></td></tr><tr><td>Sodium chloride</td><td>Sigma-Aldrich</td><td>S9888</td><td></td></tr><tr><td>Trisodium citrate</td><td>Sigma-Aldrich</td><td>S1804</td><td></td></tr><tr><td>Tris(hydroxymethyl) aminomethane</td><td>Fisher Scientific</td><td>T395-100</td><td></td></tr><tr><td>Tris-Base</td><td>Fisher Scientific</td><td>BP152-500</td><td></td></tr><tr><td>2X PCR Master Mix with Dual-Dye</td><td>Norgen Biotek</td><td>28240</td><td></td></tr><tr><td>Agarose gel</td><td>Merck</td><td>101236</td><td></td></tr><tr><td>Bolton Agar</td><td>Merck</td><td>100079</td><td></td></tr><tr><td>Bolton Broth</td><td>Merck</td><td>100079</td><td></td></tr><tr><td>CHROMagar Vibrio</td><td>CHROMagar</td><td>VB910</td><td></td></tr><tr><td>dNTPs</td><td>Promega</td><td>U1511</td><td></td></tr><tr><td>Nuclease-free water</td><td>Thermo Scientific</td><td>R0581</td><td></td></tr><tr><td>Eosin methylene blue agar&amp;nbsp;</td><td>Merck</td><td>101347</td><td></td></tr><tr><td>GelRed</td><td>Biotium</td><td>41001</td><td></td></tr><tr><td>Glycerol</td><td>Merck</td><td>104092</td><td></td></tr><tr><td>Go Taq Buffer</td><td>Promega</td><td>M7911</td><td></td></tr><tr><td>Loading dye 100 bp DNA ladder</td><td>Promega</td><td>G2101</td><td></td></tr><tr><td>Loading dye 1kb DNA ladder</td><td>Promega</td><td>G5711</td><td></td></tr><tr><td>Magnesium chloride</td><td>Promega</td><td>91176</td><td></td></tr><tr><td>Mannitol egg yolk polymyxin agar</td><td>Merck</td><td>105267</td><td></td></tr><tr><td>McConkey Agar</td><td>Merck</td><td>105465</td><td></td></tr><tr><td>Nutrient Broth</td><td>Merck</td><td>105443</td><td></td></tr><tr><td>Taq polymerase</td><td>Merck</td><td>71003</td><td></td></tr><tr><td>Trypticase Soy Broth</td><td>Merck</td><td>105459</td><td></td></tr><tr><td>Trypticase Soy Agar</td><td>Merck</td><td>105458</td><td></td></tr></tbody></table>

development of an electrochemical dna biosensor to detect a foodborne pathogen

Vibrio parahaemolyticus (V. parahaemolyticus) is a common foodborne pathogen that contributes to a large proportion of public health problems globally, significantly affecting the rate of human mortality and morbidity. Conventional methods for the detection of V. parahaemolyticus such as culture-based methods, immunological assays, and molecular-based methods require complicated sample handling and are time-consuming, tedious, and costly. Recently, biosensors have proven to be a promising and comprehensive detection method with the advantages of fast detection, cost-effectiveness, and practicality. This research focuses on developing a rapid method of detecting V. parahaemolyticus with high selectivity and sensitivity using the principles of DNA hybridization. In the work, characterization of synthesized polylactic acid-stabilized gold nanoparticles (PLA-AuNPs) was achieved using X-ray Diffraction (XRD), Ultraviolet-visible Spectroscopy (UV-Vis), Transmission Electron Microscopy (TEM), Field-emission Scanning Electron Microscopy (FESEM), and Cyclic Voltammetry (CV). We also carried out further testing of stability, sensitivity, and reproducibility of the PLA-AuNPs. We found that the PLA-AuNPs formed a sound structure of stabilized nanoparticles in aqueous solution. We also observed that the sensitivity improved as a result of the smaller charge transfer resistance (Rct) value and an increase of active surface area (0.41 cm2). The development of our DNA biosensor was based on modification of a screen-printed carbon electrode (SPCE) with PLA-AuNPs and using methylene blue (MB) as the redox indicator. We assessed the immobilization and hybridization events by differential pulse voltammetry (DPV). We found that complementary, non-complementary, and mismatched oligonucleotides were specifically distinguished by the fabricated biosensor. It also showed reliably sensitive detection in cross-reactivity studies against various food-borne pathogens and in the identification of V. parahaemolyticus in fresh cockles.

Formation of AuNPs was revealed through the change in color of the aqueous solution with sodium citrate present. This caused the color to change from light yellow to a deep ruby red. The generation of PLA-AuNPs was confirmed from the UV-vis spectra (Figure 1) where the growth of the surface plasmon resonance (SPR) peak was found at around 540 nm. The formation and existence of PLA-AuNPs was indicated at 500-600 nm wavelength ranges, depending on particle size...

Watch this Scientific Journal Video about Development of an Electrochemical DNA Biosensor to Detect a Foodborne Pathogen at JoVE.com

Development of an Electrochemical DNA Biosensor to Detect a Foodborne Pathogen

A protocol for the development of an electrochemical DNA biosensor comprising a polylactic acid-stabilized, gold nanoparticles-modified, screen-printed carbon electrode to detect Vibrio parahaemolyticus is presented.

Vibrio parahaemolyticus (V. parahaemolyticus) is a common foodborne pathogen that contributes to a large proportion of public health problems globally, ...

development-an-electrochemical-dna-biosensor-to-detect-foodborne

Universidad de Cartagena UDEC

Research

JoVE Journal

Bioengineering

13.0K Views.  Universiti Putra Malaysia. A protocol for the development of an electrochemical DNA biosensor comprising a polylactic acid-stabilized, gold nanoparticles-modified, screen-printed carbon electrode to detect Vibrio parahaemolyticus is presented.

Video: Development of an Electrochemical DNA Biosensor to Detect a Foodborne Pathogen

Fabrication of Electrochemical-DNA Biosensors for the Reagentless Detection of Nucleic Acids, Proteins and Small Molecules

As medicine is currently practiced, doctors send specimens to a central laboratory for testing and thus must wait hours or days to 
receive the results. Many patients would be better served by rapid, bedside tests. To this end our laboratory and others have developed a versatile, reagentless 
biosensor platform that supports the quantitative, reagentless, electrochemical detection of nucleic acids (DNA, RNA), proteins (including antibodies) and small 
molecules analytes directly in unprocessed clinical and environmental samples. In this video, we demonstrate the preparation and use of several biosensors in this 
"E-DNA" class. In particular, we fabricate and demonstrate sensors for the detection of a target DNA sequence in a polymerase chain reaction mixture, an HIV-specific antibody and the drug cocaine. The preparation procedure requires only three hours of hands-on effort followed by an overnight incubation, and their use requires only minutes.

"E-DNA" sensors, reagentless, electrochemical biosensors that perform well even when challenged directly in blood and other complex matrices, have been adapted to the detection of a wide range of nucleic acid, protein and small molecule analytes. Here we present a general procedure for the fabrication and use of such sensors.

As medicine is currently practiced, doctors send specimens to a central laboratory for testing and thus must wait hours or days to 
receive the results. ...

Bacterial Detection &amp; Identification Using Electrochemical Sensors

Electrochemical sensors are widely used for rapid and accurate measurement of blood glucose and can be adapted for detection of a wide variety of analytes. Electrochemical sensors operate by transducing a biological recognition event into a useful electrical signal. Signal transduction occurs by coupling the activity of a redox enzyme to an amperometric electrode. Sensor specificity is either an inherent characteristic of the enzyme, glucose oxidase in the case of a glucose sensor, or a product of linkage between the enzyme and an antibody or probe.
Here, we describe an electrochemical sensor assay method to directly detect and identify bacteria. In every case, the probes described here are DNA oligonucleotides. This method is based on sandwich hybridization of capture and detector probes with target ribosomal RNA (rRNA). The capture probe is anchored to the sensor surface, while the detector probe is linked to horseradish peroxidase (HRP). When a substrate such as 3,3',5,5'-tetramethylbenzidine (TMB) is added to an electrode with capture-target-detector complexes bound to its surface, the substrate is oxidized by HRP and reduced by the working electrode. This redox cycle results in shuttling of electrons by the substrate from the electrode to HRP, producing current flow in the electrode.

Bacterial Detection & Identification Using Electrochemical Sensors

We describe an electrochemical sensor assay method for rapid bacterial detection and identification. The assay involves a sensor array functionalized with DNA oligonucleotide capture probes for ribosomal RNA (rRNA) species-specific sequences. Sandwich hybridization of target rRNA with the capture probe and a horseradish peroxidase-linked DNA oligonucleotide detector probe produces a measurable amperometric current.

Electrochemical  sensors are widely used for rapid and accurate measurement of blood glucose and  can be adapted for detection of a wide variety of ...

Detection of Bacteria Using Fluorogenic DNAzymes

Outbreaks linked to food-borne and hospital-acquired pathogens account for millions of deaths and hospitalizations as well as colossal economic losses each and every year. Prevention of such outbreaks and minimization of the impact of an ongoing epidemic place an ever-increasing demand for analytical methods that can accurately identify culprit pathogens at the earliest stage. Although there is a large array of effective methods for pathogen detection, none of them can satisfy all the following five premier requirements embodied for an ideal detection method: high specificity (detecting only the bacterium of interest), high sensitivity (capable of detecting as low as a single live bacterial cell), short time-to-results (minutes to hours), great operational simplicity (no need for lengthy sampling procedures and the use of specialized equipment), and cost effectiveness. For example, classical microbiological methods are highly specific but require a long time (days to weeks) to acquire a definitive result.1 PCR- and antibody-based techniques offer shorter waiting times (hours to days), but they require the use of expensive reagents and/or sophisticated equipment.2-4 Consequently, there is still a great demand for scientific research towards developing innovative bacterial detection methods that offer improved characteristics in one or more of the aforementioned requirements. Our laboratory is interested in examining the potential of DNAzymes as a novel class of molecular probes for biosensing applications including bacterial detection.5
DNAzymes (also known as deoxyribozymes or DNA enzymes) are man-made single-stranded DNA molecules with the capability of catalyzing chemical reactions.6-8 These molecules can be isolated from a vast random-sequence DNA pool (which contains as many as 1016 individual sequences) by a process known as "in vitro selection" or "SELEX" (systematic evolution of ligands by exponential enrichment).9-16 These special DNA molecules have been widely examined in recent years as molecular tools for biosensing applications.6-8
Our laboratory has established in vitro selection procedures for isolating RNA-cleaving fluorescent DNAzymes (RFDs; Fig. 1) and investigated the use of RFDs as analytical tools.17-29 RFDs catalyze the cleavage of a DNA-RNA chimeric substrate at a single ribonucleotide junction (R) that is flanked by a fluorophore (F) and a quencher (Q). The close proximity of F and Q renders the uncleaved substrate minimal fluorescence. However, the cleavage event leads to the separation of F and Q, which is accompanied by significant increase of fluorescence intensity.
More recently, we developed a method of isolating RFDs for bacterial detection.5 These special RFDs were isolated to "light up" in the presence of the crude extracellular mixture (CEM) left behind by a specific type of bacteria in their environment or in the media they are cultured (Fig. 1). The use of crude mixture circumvents the tedious process of purifying and identifying a suitable target from the microbe of interest for biosensor development (which could take months or years to complete). The use of extracellular targets means the assaying procedure is simple because there is no need for steps to obtain intracellular targets.
Using the above approach, we derived an RFD that cleaves its substrate (FS1; Fig. 2A) only in the presence of the CEM produced by E. coli (CEM-EC).5 This E. coli-sensing RFD, named RFD-EC1 (Fig. 2A), was found to be strictly responsive to CEM-EC but nonresponsive to CEMs from a host of other bacteria (Fig. 3).
Here we present the key experimental procedures for setting up E. coli detection assays using RFD-EC1 and representative results.

We have recently reported a novel approach for generating fluorogenic DNAzyme probes that can be applied to set up a simple, "mix-and-read" fluorescent assay for bacterial detection. These special DNA probes catalyze the cleavage of a chromophore-modified DNA-RNA chimeric substrate in the presence of crude extracellular mixture (CEM) produced by a specific bacterium, thereby translating bacterial detection into fluorescence signal generation. In this report we will describe key experimental procedures where a specific DNAzyme probe denoted "RFD-EC1" is employed for the detection of the model bacterium, Escherichia coli (E. coli).

Outbreaks linked to food-borne and hospital-acquired pathogens account for millions of deaths and hospitalizations as well as colossal economic losses ...

Immunology and Infection

Optical Detection of E. coli Bacteria by Mesoporous Silicon Biosensors

A label-free optical biosensor based on a nanostructured porous Si is designed for rapid capture and detection of Escherichia coli K12 bacteria, as a model microorganism. The biosensor relies on direct binding of the target bacteria cells onto its surface, while no pretreatment (e.g.&#160;by cell lysis) of the studied sample is required. A mesoporous Si thin film is used as the optical transducer element of the biosensor. Under white light illumination, the porous layer displays well-resolved Fabry-P&#233;rot fringe patterns in its reflectivity spectrum. Applying a fast Fourier transform (FFT) to reflectivity data results in a single peak. Changes in the intensity of the FFT peak are monitored. Thus, target bacteria capture onto the biosensor surface, through antibody-antigen interactions, induces measurable changes in the intensity of the FFT peaks, allowing for a &#39;real time&#39; observation of bacteria attachment.
The mesoporous Si film, fabricated by an electrochemical anodization process, is conjugated with monoclonal antibodies, specific to the target bacteria. The immobilization, immunoactivity and specificity of the antibodies are confirmed by fluorescent labeling experiments. Once the biosensor is exposed to the target bacteria, the cells are directly captured onto the antibody-modified porous Si surface. These specific capturing events result in intensity changes in the thin-film optical interference spectrum of the biosensor. We demonstrate that these biosensors can detect relatively low bacteria concentrations (detection limit of 104 cells/ml) in less than an hour.

Optical Detection of E. coli Bacteria by Mesoporous Silicon Biosensors

A label-free optical biosensor for rapid bacteria detection is introduced. The biosensor is based on a nanostructured porous Si, which is designed to directly capture the target bacteria cells onto its surface. We use monoclonal antibodies, immobilized onto the porous transducer, as the capture probes. Our studies demonstrate the applicability of these biosensors for the detection of low bacterial concentrations within minutes with no prior sample processing (such as cell lysis).

A label-free optical biosensor based on a nanostructured porous Si is designed for rapid capture and detection of Escherichia coli K12 bacteria, as a ...

A Microfluidic-based Electrochemical Biochip for Label-free DNA Hybridization Analysis

Miniaturization of analytical benchtop procedures into the micro-scale provides significant advantages in regards to reaction time, cost, and integration of pre-processing steps. Utilizing these devices towards the analysis of DNA hybridization events is important because it offers a technology for real time assessment of biomarkers at the point-of-care for various diseases. However, when the device footprint decreases the dominance of various physical phenomena increases. These phenomena influence the fabrication precision and operation reliability of the device. Therefore, there is a great need to accurately fabricate and operate these devices in a reproducible manner in order to improve the overall performance. Here, we describe the protocols and the methods used for the fabrication and the operation of a microfluidic-based electrochemical biochip for accurate analysis of DNA hybridization events. The biochip is composed of two parts: a microfluidic chip with three parallel micro-channels made of polydimethylsiloxane (PDMS), and a 3 x 3 arrayed electrochemical micro-chip. The DNA hybridization events are detected using electrochemical impedance spectroscopy (EIS) analysis. The EIS analysis enables monitoring variations of the properties of the electrochemical system that are dominant at these length scales. With the ability to monitor changes of both charge transfer and diffusional resistance with the biosensor, we demonstrate the selectivity to complementary ssDNA targets, a calculated detection limit of 3.8 nM, and a 13% cross-reactivity with other non-complementary ssDNA following 20 min&#160;of incubation. This methodology can improve the performance of miniaturized devices by elucidating on the behavior of diffusion at the micro-scale regime and by enabling the study of DNA hybridization events.

We present a microfluidic-based electrochemical biochip for DNA hybridization detection. Following ssDNA probe functionalization, the specificity, sensitivity, and detection limit are studied with complementary and non-complementary ssDNA targets. Results illustrate the influence of the DNA hybridization events on the electrochemical system, with a detection limit of 3.8 nM.

Miniaturization of analytical benchtop procedures into the micro-scale provides significant advantages in regards to reaction time, cost, and integration ...

ELIME (Enzyme Linked Immuno Magnetic Electrochemical) Method for Mycotoxin Detection

Immunoassays are a valid alternative to the more expensive and time consuming quantitative HPLC or GC1, 2 methods for the screening detection of hazardous mycotoxins in food commodities. In this protocol we show how to fabricate and interrogate an electrochemical competitive Enzyme linked immunomagnetic assay based on the use of magnetic beads as solid support for the immunochemical chain3 and screen printed electrodes as sensing platform.
Our method aims to determine the total amount of HT-2 and T-2 toxins, mycotoxins belonging to the trichothecenes family and of great concern for human health4. The use of an antibody clone with a cross reactivity of 100% towards HT-2 and T-2 allows to simultaneously detect both toxins with similar sensitivity5.
The first step of our assay is the coating step where we immobilize HT2-KLH conjugate toxin on the surface of magnetic beads. After a blocking step, necessary to avoid non-specific absorptions, the addition of a monoclonal antibody allows the competition between immobilized HT-2 and free HT-2 or T-2 present in the sample or dissolved in a standard solution.
At the end of the competition step, the amount of monoclonal antibody linked to the immobilized HT-2 will be inversely proportional to the amount of toxin in the sample solution.
A secondary antibody labeled with alkaline phosphatase (AP) is used to reveal the binding between the specific antibody and the immobilized HT-2. The final measurement step is performed by dropping an aliquot of magnetic bead suspension, corresponding to a specific sample/standard solution, on the surface of a screen-printed working electrode; magnetic beads are immobilized and concentrated by means of a magnet placed precisely under the screen-printed electrode. After two minutes of incubation between magnetic beads and a substrate for AP, the enzymatic product is detected by Differential Pulse Voltammetry (DPV) using a portable instrument (PalmSens) also able to initiate automatically eight measurements within an interval of few seconds.

ELIME Enzyme Linked Immuno Magnetic Electrochemical Method for Mycotoxin Detection

A protocol to detect trichothecenes (mycotoxins of concern for human health) using a newly developed screening method based on a competitive immunochemical method and a final electrochemical detection is demonstrated.

Immunoassays are a valid alternative to the more expensive and time consuming quantitative HPLC or GC1, 2 methods for the screening detection of hazardous ...

Biology

Foodborne Pathogen Screening Using Magneto-fluorescent Nanosensor: Rapid Detection of E. Coli O157:H7

Enterohemorrhagic Escherichia coli O157:H7 has been linked to both waterborne and foodborne illnesses, and remains a threat despite the food- and water-screening methods used currently. While conventional bacterial detection methods, such as polymerase chain reaction (PCR) and enzyme-linked immunosorbent assays (ELISA) can specifically detect pathogenic contaminants, they require extensive sample preparation and lengthy waiting periods. In addition, these practices demand sophisticated laboratory instruments and settings, and must be executed by trained professionals. Herein, a protocol is proposed for a simpler diagnostic technique that features the unique combination of magnetic and fluorescent parameters in a nanoparticle-based platform. The proposed multiparametric magneto-fluorescent nanosensors (MFnS) can detect E. coli O157:H7 contamination with as little as 1 colony-forming unit present in solution within less than 1 h. Furthermore, the ability of MFnS to remain highly functional in complex media such as milk and lake water has been verified. Additional specificity assays were also used to demonstrate the ability of MFnS to only detect the specific target bacteria, even in the presence of similar bacterial species. The pairing of magnetic and fluorescent modalities allows for the detection and quantification of pathogen contamination in a wide range of concentrations, exhibiting its high performance in both early- and late-stage contamination detection. The effectiveness, affordability, and portability of the MFnS make them an ideal candidate for point-of-care screening for bacterial contaminants in a wide range of settings, from aquatic reservoirs to commercially packaged foods.

Foodborne Pathogen Screening Using Magneto-fluorescent Nanosensor: Rapid Detection of E. Coli O157:H7

The overall goal of this protocol is to synthesize functional nanosensors for the portable, cost-effective, and rapid detection of specifically targeted pathogenic bacteria through a combination of magnetic relaxation and fluorescence emission modalities.

Enterohemorrhagic Escherichia coli O157:H7 has been linked to both waterborne and foodborne illnesses, and remains a threat despite the food- and ...

Electrowetting-based Digital Microfluidics Platform for Automated Enzyme-linked Immunosorbent Assay

Electrowetting is the effect by which the contact angle of a droplet exposed to a surface charge is modified. Electrowetting-on-dielectric (EWOD) exploits the dielectric properties of thin insulator films to enhance the charge density and hence boost the electrowetting effect. The presence of charges results in an electrically induced spreading of the droplet which permits purposeful manipulation across a hydrophobic surface. Here, we demonstrate EWOD-based protocol for sample processing and detection of four categories of antigens, using an automated surface actuation platform, via two variations of an Enzyme-Linked Immunosorbent Assay (ELISA) methods. The ELISA is performed on magnetic beads with immobilized primary antibodies which can be selected to target a specific antigen. An antibody conjugated to HRP binds to the antigen and is mixed with H2O2/Luminol for quantification of the captured pathogens. Assay completion times of between 6 and 10 min were achieved, whilst minuscule volumes of reagents were utilized.

Electrowetting-based digital microfluidic is a technique that utilizes a voltage-driven change in the apparent contact angle of a microliter-volume droplet to facilitate its manipulation. Combining this with functionalized magnetic beads enables the integration of multiple laboratory unit operations for sample preparation and identification of pathogens using Enzyme-linked Immunosorbent Assay (ELISA).

Electrowetting is the effect by which the contact angle of a droplet exposed to a surface charge is modified. Electrowetting-on-dielectric (EWOD) exploits ...

A High-throughput Platform for the Screening of Salmonella spp./Shigella spp.

Fecal-oral transmission of acute gastroenteritis occurs from time to time, especially when people who handled food and water are infected by Salmonella spp./Shigella spp. The gold standard method for the detection of Salmonella spp./Shigella spp. is direct culture but this is labor-intensive and time-consuming. Here, we describe a high-throughput platform for Salmonella spp./Shigella spp. screening, using real-time polymerase chain reaction (PCR) combined with guided culture. There are two major stages: real-time PCR and the guided culture. For the first stage (real-time PCR), we explain each step of the method: sample collection, pre-enrichment, DNA extraction and real-time PCR. If the real-time PCR result is positive, then the second stage (guided culture) is performed: selective culture, biochemical identification and serological characterization. We also illustrate representative results generated from it. The protocol described here would be a valuable platform for the rapid, specific, sensitive and high-throughput screening of Salmonella spp./Shigella spp.

A High-throughput Platform for the Screening of Salmonella spp./Shigella spp.

Salmonella spp./Shigella spp. are common pathogens attributed to diarrhea. Here, we describe a high-throughput platform for the screening of Salmonella spp./Shigella spp. using real-time PCR combined with guided culture.

Fecal-oral transmission of acute gastroenteritis occurs from time to time, especially when people who handled food and water are infected by Salmonella ...

Colorimetric Detection of Bacteria Using Litmus Test

There are increasing demands for simple but still effective methods that can be used to detect specific pathogens for point-of-care or field applications. Such methods need to be user-friendly and produce reliable results that can be easily interpreted by both specialists and non-professionals. The litmus test for pH is simple, quick, and effective as it reports the pH of a test sample via a simple color change. We have developed an approach to take advantage of the litmus test for bacterial detection. The method exploits a bacterium-specific RNA-cleaving DNAzyme to achieve two functions: recognizing a bacterium of interest and providing a mechanism to control the activity of urease. Through the use of magnetic beads immobilized with a DNAzyme-urease conjugate, the presence of bacteria in a test sample is relayed to the release of urease from beads to solution. The released urease is transferred to a test solution to hydrolyze urea into ammonia, resulting in an increase of pH that can be visualized using the classic litmus test.

We describe a protocol for colorimetric detection of E. coli using a modified litmus test that takes advantage of an RNA-cleaving DNAzyme, urease, and magnetic beads.

There are increasing demands for simple but still effective methods that can be used to detect specific pathogens for point-of-care or field applications. ...

Development of an Electrochemical DNA Biosensor to Detect a Foodborne Pathogen

Summary

Explore More Videos

Chapters in this video

Fabrication of Electrochemical-DNA Biosensors for the Reagentless Detection of Nucleic Acids, Proteins and Small Molecules

Bacterial Detection & Identification Using Electrochemical Sensors

Detection of Bacteria Using Fluorogenic DNAzymes

Optical Detection of E. coli Bacteria by Mesoporous Silicon Biosensors

A Microfluidic-based Electrochemical Biochip for Label-free DNA Hybridization Analysis

ELIME (Enzyme Linked Immuno Magnetic Electrochemical) Method for Mycotoxin Detection

Foodborne Pathogen Screening Using Magneto-fluorescent Nanosensor: Rapid Detection of E. Coli O157:H7

Electrowetting-based Digital Microfluidics Platform for Automated Enzyme-linked Immunosorbent Assay

A High-throughput Platform for the Screening of Salmonella spp./Shigella spp.

Colorimetric Detection of Bacteria Using Litmus Test