Supported by funding from the Italian Association for Cancer Research (AIRC) to MF (MFAG 11676) and to MN (Special Program Molecular Clinical Oncology - 5 per mille n. 9980, 2010/15) and from the Italian Ministry of Instruction, University and Research FIRB 2011 to MN (Project RBAPIIBYNP).

MicroRNA Isolation from Plasma or Serum
Note: Plasma and serum preparation is a relevant step in circulating miRNA quantification. There is no preferred procedure for plasma and serum preparation. The only important thing to consider is that all the samples from the same experiment must be processed using exactly the same workflow. Start from 200 &#181;l serum or plasma. Total RNA can be isolated from serum or plasma using commercially available kits.
1. Protocol for Total RNA (including miRNA) Isolation
<ol>
	<li>Thaw serum/plasma samples on ice.</li>
	<li>Add 1 ml of Lysis Reagent (e.g., QIAzol) to 200 &#181;l serum/plasma.</li>
	<li>Mix by vortexing and place the tube containing the homogenate on the bench at RT for 5 min.</li>
	<li>Add 3 &#181;l of a 4.16 nM solution of the synthetic miRNA cel-miR-39-3p from C. elegans.</li>
	<li>Add 200 &#181;l of chloroform. Shake the tube vigorously for 15 sec. Place the tube on the bench at RT for 2 min.</li>
	<li>Centrifuge for 15 min at 12,000 x g at 4 &#176;C to obtain phases separation: the upper aqueous phase contains RNA.</li>
	<li>Transfer the aqueous phase to a new tube, about 700 &#181;l, avoid transfer of any white interphase material.</li>
	<li>Add 1 ml of 100% ethanol and mix by inversion.</li>
	<li>Pipet up 700 &#181;l of the sample into a mini spin column placed on a 2 ml collection tube. Close the lid and centrifuge at 12,000 x g for 15 sec. Discard the flow-through.</li>
	<li>Repeat this step using the remaining sample.</li>
	<li>Add 700 &#181;l Buffer RWT to the mini spin column, close the lid and centrifuge for 15 sec at 12,000 x g to wash the column. Discard the flow-through.</li>
	<li>Pipet 500 &#181;l Buffer RPE into the mini spin column. Close the lid and centrifuge for 15 sec at 12,000 rpm. Discard the flow-through. Repeat this step again.</li>
	<li>Centrifuge the mini spin column at full speed for 2 min to dry the spin column membrane from residual ethanol.</li>
	<li>Transfer the mini spin column to a new 1.5 ml&#160;collection tube and pipet 35 &#181;l RNase-free water on the membrane of the column.</li>
	<li>Centrifuge for 1 min at 12,000 x g to elute the RNA.</li>
	<li>Store the RNA at -80 &#176;C. 
	Note: Since RNA concentration cannot be determined accurately, use fixed volumes as a measure for input amount.</li>
</ol>
2. MicroRNA Reverse Transcription
<ol>
	<li>Thaw the reverse transcription (RT) reagent mix components: 5x reaction buffer, nuclease-free water. Mix gently inverting the tubes and place on ice. Immediately before use, remove the enzyme mix from the freezer and place on ice. Spin down all reagents.</li>
	<li>Prepare the RT reagent mix on ice as described in Table 1. Prepare at least 10% exceeding mix.</li>
	<li>Mix the reaction by pipetting, and then spin down.</li>
	<li>Incubate for 60 min at 42 &#730;C.</li>
	<li>Heat-inactivate the reverse transcriptase for 5 min at 95 &#730;C.</li>
	<li>Immediately cool to 4 &#176;C.</li>
	<li>Store the cDNA at -20 &#176;C.</li>
</ol>
3. cDNA Dilution
<ol>
	<li>Dilute the amount of cDNA template needed for the planned ddPCR reactions in nuclease free water. Dilute the cDNA reaction between 1:50 and 1:500 in water, dependent on target miRNA abundance. Store the diluted cDNA at -20 &#176;C. The diluted cDNA proved to be stable for at least 3 months at -20 &#176;C.</li>
</ol>
4. Droplet Generation and PCR
Note: Droplet generation should be performed on 8 samples at a time. Technical replicates are not required, due to the high reproducibility of this technology 12,15.A No Template Control (NTC) sample should be run in every plate and for each different ddPCR condition.
<ol>
	<li>Thaw and equilibrate the master mix (e.g., EvaGreen Master Mix), microRNA primer set and cDNA at RT.</li>
	<li>Mix the Master Mix thoroughly by inverting the tube several times. Spin down all the reagents.</li>
	<li>Prepare the ddPCR mix as described in Table 2. When multiple ddPCR reactions are performed, prepare a ddPCR mix working-solution. Prepare at least 10% exceeding mix.</li>
	<li>Once assembled, thoroughly mix and spin down the ddPCR mix.</li>
	<li>Dispense 12 &#181;l of ddPCR mix into a 96-well PCR plate or PCR tubes.</li>
	<li>Add 8 &#181;l of diluted cDNA template to each tube/well.</li>
	<li>Insert the droplet generator cartridge into the holder.</li>
	<li>Transfer 20 &#181;l of each prepared sample to the sample wells (middle row) of the droplet generator cartridge carefully while avoiding air bubbles at the bottom of the well.</li>
	<li>Fill each oil well (bottom row) with 70 &#181;l of droplet generator oil.</li>
	<li>Hook the gasket over the cartridge holder and insert into the droplet generator.</li>
	<li>Close the lid to start droplet generation according to manufacturer&#39;s protocol. When droplet generation has finished, open the lid, remove the disposable gasket. The top wells of the cartridge contain the droplets.</li>
	<li>Pipet slowly and smoothly 40 &#181;l of the contents of the eight top wells (the droplets) into a single column of a 96-well PCR plate.</li>
	<li>Seal the PCR plate with foil immediately after transferring droplets to avoid evaporation. Use pierceable foil plate seals that are compatible with the needles in the droplet reader.</li>
	<li>Begin thermal cycling (PCR) within 30 min of sealing the plate.</li>
	<li>Perform the cycling protocol according to Table 3.</li>
</ol>
5. Droplet Reading
<ol>
	<li>Power on the droplet reader.</li>
	<li>Move the plate from the thermal cycler to the droplet reader.</li>
	<li>Place the 96-well PCR plate containing the post-PCR droplets into the base of the plate holder.</li>
	<li>Place the top of the plate holder on the PCR plate. Firmly press both release tabs down to secure the PCR plate in the holder.</li>
	<li>Start the software from the system PC.
	<ol>
		<li>Click Setup to define the experiment (Absolute quantification) then click Run to start the droplet reading.</li>
		<li>When droplet reading is complete, click &#34;Analyze&#34; button to open and analyze the data.</li>
		<li>Use the 2D amplitude plot in the analysis software to select the positive droplets (lasso tool) (Figure 1B).</li>
		<li>Use the Events tab to check the number of positive and total droplets. A total number of 18,000 - 21,000 droplets is usually achieved with probeless ddPCR.</li>
		<li>Once the positive droplets are selected, export the miRNA concentration values using the export .csv option from the Concentration tab.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Arroyo, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Argonaute2+complexes+carry+a+population+of+circulating+microRNAs+independent+of+vesicles+in+human+plasma.">Argonaute2 complexes carry a population of circulating microRNAs independent of vesicles in human plasma.</a> Proc Natl Acad Sci U S A. 108, 5003-5008 (2011).</li><li>Skog, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Glioblastoma+microvesicles+transport+RNA+and+proteins+that+promote+tumour+growth+and+provide+diagnostic+biomarkers.">Glioblastoma microvesicles transport RNA and proteins that promote tumour growth and provide diagnostic biomarkers.</a> Nat Cell Biol. 10, 1470-1476 (2008).</li><li>Vickers, K. C., Palmisano, B. T., Shoucri, B. M., Shamburek, R. D., Remaley, A. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNAs+are+transported+in+plasma+and+delivered+to+recipient+cells+by+high-density+lipoproteins.">MicroRNAs are transported in plasma and delivered to recipient cells by high-density lipoproteins.</a> Nat Cell Biol. 13, 423-433 (2011).</li><li>Braicu, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exosomes+as+divine+messengers:+are+they+the+Hermes+of+modern+molecular+oncology.">Exosomes as divine messengers: are they the Hermes of modern molecular oncology.</a> Cell Death Differ. 22, 34-45 (2015).</li><li>Creemers, E. E., Tijsen, A. J., Pinto, Y. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circulating+microRNAs:+novel+biomarkers+and+extracellular+communicators+in+cardiovascular+disease.">Circulating microRNAs: novel biomarkers and extracellular communicators in cardiovascular disease.</a> Circ Res. 110, 483-495 (2012).</li><li>Guay, C., Regazzi, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circulating+microRNAs+as+novel+biomarkers+for+diabetes+mellitus.">Circulating microRNAs as novel biomarkers for diabetes mellitus.</a> Nat Rev Endocrinol. 9, 513-521 (2013).</li><li>Schwarzenbach, H., Nishida, N., Calin, G. A., Pantel, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical+relevance+of+circulating+cell-free+microRNAs+in+cancer.">Clinical relevance of circulating cell-free microRNAs in cancer.</a> Nat Rev Clin Oncol. 11, 145-156 (2014).</li><li>Moldovan, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methodological+challenges+in+utilizing+miRNAs+as+circulating+biomarkers.">Methodological challenges in utilizing miRNAs as circulating biomarkers.</a> J Cell Mol Med. 18, 371-390 (2014).</li><li>Tiberio, P., Callari, M., Angeloni, V., Daidone, M. G., Appierto, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Challenges+in+Using+Circulating+miRNAs+as+Cancer+Biomarkers.">Challenges in Using Circulating miRNAs as Cancer Biomarkers.</a> Biomed Res Int. 2015, 731479 (2015).</li><li>Jarry, J., Schadendorf, D., Greenwood, C., Spatz, A., van Kempen, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+validity+of+circulating+microRNAs+in+oncology:+five+years+of+challenges+and+contradictions.">The validity of circulating microRNAs in oncology: five years of challenges and contradictions.</a> Mol Oncol. 8, 819-829 (2014).</li><li>Witwer, K. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circulating+MicroRNA+Biomarker+Studies:+Pitfalls+and+Potential+Solutions.">Circulating MicroRNA Biomarker Studies: Pitfalls and Potential Solutions.</a> Clin Chem. 61, 56-63 (2015).</li><li>Miotto, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantification+of+Circulating+miRNAs+by+Droplet+Digital+PCR:+Comparison+of+EvaGreen-+and+TaqMan-Based+Chemistries.">Quantification of Circulating miRNAs by Droplet Digital PCR: Comparison of EvaGreen- and TaqMan-Based Chemistries.</a> Cancer Epidemiol Biomarkers Prev. 23, 2638-2642 (2014).</li><li>Ferracin, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Absolute+quantification+of+cell-free+microRNAs+in+cancer+patients.">Absolute quantification of cell-free microRNAs in cancer patients.</a> Oncotarget. , (2015).</li><li>Mangolini, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diagnostic+and+prognostic+microRNAs+in+the+serum+of+breast+cancer+patients+measured+by+droplet+digital+PCR.">Diagnostic and prognostic microRNAs in the serum of breast cancer patients measured by droplet digital PCR.</a> Biomarker Research. , (2015).</li><li>Hindson, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Absolute+quantification+by+droplet+digital+PCR+versus+analog+real-time+PCR.">Absolute quantification by droplet digital PCR versus analog real-time PCR.</a> Nat Methods. 10, 1003-1005 (2013).</li><li>Mestdagh, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+quantitative+miRNA+expression+platforms+in+the+microRNA+quality+control+(miRQC)+study.">Evaluation of quantitative miRNA expression platforms in the microRNA quality control (miRQC) study.</a> Nat Methods. 11, 809-815 (2014).</li></ol>

The authors have nothing to disclose.

Circulating miRNAs are present in blood at extremely low concentrations and the amount of RNA that can be extracted from plasma and serum samples is low. For this reason, they are difficult to quantify with other techniques such as microarray and RNA sequencing. Moreover, there is a generalized lack of agreement on data normalization and the presence of endogenous &#34;reference&#34; miRNAs in the blood. In this context, a sensitive technology like droplet digital PCR, capable of counting the number of miRNA copies per m...

MicroRNAs (miRNAs) are released into blood circulation by potentially all the cells of the organism, as a consequence of active release or necrotic and apoptotic processes. Cell-free miRNAs have been detected in the bloodstream either as free stable molecules or linked to lipoproteins or enveloped inside exosomes and microvesicles 1-3. They are believed to function as cell-to-cell communicators 4, and their amount changes in the presence of cancer, cardiac disorders or autoimmune diseases 5-7. Their accurate and reproducible quantification is the basis for their evaluation as disease biomarkers. However, for several reasons already described elsewhere 8,9, miRNA quantification in serum or plasma, as well as other body fluids, could be very challenging 10,11. We recently developed a method for the absolute quantification of circulating miRNAs, based on miRNA-specific LNA primers and DNA-binding dye droplet digital PCR (ddPCR) technology 12. This methodology has been applied to the validation of miRNA breast cancer biomarkers 13,14. 
After the partitioning of each reverse-transcribed miRNA molecule inside a nanoliter-sized droplet, it is possible to count the copy number of each miRNA in each sample, basically counting the number of green, and therefore positive, fluorescent droplets. As soon as a PCR reaction occurs, a positive count is achieved, without the need to establish a standard curve or taking PCR efficiency into account in target amount calculation, as it happens with quantitative RT-PCR (RT-qPCR). In addition, ddPCR proved to be more sensitive and accurate than RT-qPCR in circulating miRNA quantification 15. In this article we present the detailed protocol of this methodology, discussing the most relevant steps andspecifically considering serum and plasma clinical samples.

<table><tbody><tr><td>miRNeasy Mini Kit</td><td>Qiagen</td><td>217004</td><td>Columns for total RNA, including miRNA, extraction from serum/plasma</td></tr><tr><td>100 nmole RNA oligo Cel-miR-39-3p</td><td>Integrated DNA Technologies</td><td>Custom</td><td>Sequence: UCACCGGGUGUAAAUCAGCUUG</td></tr><tr><td>Universal cDNA synthesis kit II, 8-64 rxns</td><td>Exiqon</td><td>203301</td><td>Kit for microRNA reverse transcription</td></tr><tr><td>MicroRNA LNA PCR primer set&amp;nbsp;</td><td>Exiqon</td><td>204000-206xxx and 2100000-21xxxxx</td><td>Primers for miRNA amplification inside droplets</td></tr><tr><td>QX200 droplet generator</td><td>BioRad</td><td>186-4002</td><td>Instrument used for droplet reading</td></tr><tr><td>QX200 droplet reader</td><td>BioRad</td><td>186-4003</td><td>Instrument used for droplet generation</td></tr><tr><td>QuantaSoft software</td><td>BioRad</td><td>186-3007</td><td>Software for data collection and analysis</td></tr><tr><td>PX1 PCR plate sealer</td><td>BioRad</td><td>181-4000</td><td>Plate sealer</td></tr><tr><td>DG8 droplet generator cartridges and gaskets</td><td>BioRad</td><td>186-4008</td><td>Cartridges used to mix sample and oil to generate droplets</td></tr><tr><td>QX200 ddPCR EvaGreen supermix</td><td>BioRad</td><td>186-4033/36</td><td>PCR supermix</td></tr><tr><td>QX200 droplet generator oil for EvaGreen dye</td><td>BioRad</td><td>186-4005</td><td>Oil for droplet generation</td></tr></tbody></table>

circulating microrna quantification using dna-binding dye chemistry and droplet digital pcr

Circulating (of cell-free) microRNAs (miRNAs) are released from cells into the blood stream. The amount of specific microRNAs in the circulation has been linked to a disease state and has the potential to be used as disease biomarker. A sensitive and accurate method for circulating microRNA quantification using a dye-based chemistry and droplet digital PCR technology has been recently developed. Specifically, using Locked Nucleic Acid (LNA)-based miRNA-specific primers with a green fluorescent DNA-binding dye in a compatible droplet digital PCR system it is possible to obtain the absolute quantification of specific miRNAs. Here, we describe how performing this technique to assess miRNA amount in biological fluids, such as plasma and serum, is both feasible and effective.

The absolute amount of specific miRNAs per ml of plasma or serum can be determined using a green fluorescent DNA-binding dye and droplet digital PCR technology. Figure 1 presents the process of positive-droplets selection, which determines the final miRNA concentration (copies/&#181;l) in the amplification reaction calculated by the analysis software. The amount of each miRNA in the blood is very different, being some miRNA species more abundant than others. Using a 1:50 ...

Watch this Scientific Journal Video about Circulating MicroRNA Quantification Using DNA-binding Dye Chemistry and Droplet Digital PCR at JoVE.com

Circulating MicroRNA Quantification Using DNA-binding Dye Chemistry and Droplet Digital PCR

A sensitive and accurate method for cell-free microRNAs quantification using a dye-based chemistry and droplet digital PCR technology is described.

Circulating (of cell-free) microRNAs (miRNAs) are released from cells into the blood stream. The amount of specific microRNAs in the circulation has been ...

circulating-microrna-quantification-using-dna-binding-dye-chemistry

Universidad de Cartagena UDEC

Research

JoVE Journal

Bioengineering

8.5K Views.  University of Bologna. A sensitive and accurate method for cell-free microRNAs quantification using a dye-based chemistry and droplet digital PCR technology is described.

Video: Circulating MicroRNA Quantification Using DNA-binding Dye Chemistry and Droplet Digital PCR

High Throughput MicroRNA Profiling: Optimized Multiplex qRT-PCR at Nanoliter Scale on the Fluidigm Dynamic ArrayTM IFCs

The broad involvement of miRNAs in critical processes underlying development, tissue homoeostasis and disease has led to a surging interest among the research and pharmaceutical communities. To study miRNAs, it is essential that the quantification of microRNA levels is accurate and robust. By comparing wild-type to small RNA deficient mouse embryonic stem cells (mESC), we revealed a lack of accuracy and robustness in previous published multiplex qRT-PCR techniques. Here, we describe an optimized method, including purifying away excessive primers from previous multiplex steps before singleplex real time detection, which dramatically increases the accuracy and robustness of the technique. Furthermore, we explain how performing the technique on a microfluidic chip at nanoliter volumes significantly reduces reagent costs and permits time effective high throughput miRNA expression profiling.

Here we describe an optimized multiplex reverse transcriptase quantitative PCR (qRT-PCR) protocol in combination with a microfluidic platform as a cost and time effective high-throughput screening tool for microRNA (miRNA) expression levels, especially when working with limited amounts of sample.

The broad involvement of miRNAs in critical processes underlying development, tissue homoeostasis and disease has led to a surging interest among the ...

Detection and Monitoring of Tumor Associated Circulating DNA in Patient Biofluids

Complications associated with upfront and repeat surgical tissue sampling present the need for minimally invasive platforms capable of molecular sub-classification and temporal monitoring of tumor response to therapy. Here, we describe our dPCR-based method for the detection of tumor somatic mutations in cell free DNA (cfDNA), readily available in&#160;patient biofluids. Although limited in the number of mutations that can be tested for in each assay, this method provides a high level of sensitivity and specificity. Monitoring of mutation abundance, as calculated by MAF, allows for the evaluation of tumor response to therapy, thereby providing a much-needed supplement to radiographic imaging.

Here, we present a protocol to detect tumor somatic mutations in circulating DNA present in patient biological fluids (biofluids). Our droplet digital polymerase chain reaction (dPCR)-based method enables quantification of the tumor mutation allelic frequency (MAF), facilitating a minimally invasive complement to diagnosis and temporal monitoring of tumor response.

Complications associated with upfront and repeat surgical tissue sampling present the need for minimally invasive platforms capable of molecular ...

Cancer Research

Enrichment of Native Lipoprotein Particles with microRNA and Subsequent Determination of Their Absolute/Relative microRNA Content and Their Cellular Transfer Rate

Lipoprotein particles are predominately transporters of lipids and cholesterol in the bloodstream. Furthermore, they contain small amounts of strands of noncoding microRNA (miRNA). In general, miRNA alters the protein expression profile due to interactions with messenger-RNA (mRNA). Thus, knowledge of the relative and absolute miRNA content of lipoprotein particles is essential to estimate the biological effect of cellular particle uptake. Here, a quantitative real-time polymerase chain reaction (qPCR)-based protocol is presented to determine the absolute miRNA content of lipoprotein particles&#8212;exemplified shown for native and miRNA-enriched lipoprotein particles. The relative miRNA content is quantified using multiwell microfluidic array cards. Furthermore, this protocol allows scientists to estimate the cellular miRNA and, thus, the lipoprotein particle uptake rate. A significant increase of the cellular miRNA level is observable when using high-density lipoprotein (HDL) particles artificially loaded with miRNA, whereas incubation with native HDL particles yields no significant effect due to their rather low miRNA content. In contrast, the cellular uptake of low-density lipoprotein (LDL) particles&#8212;neither with native miRNA nor artificially loaded with it&#8212;did not alter the cellular miRNA level.

Here, a quantitative real-time polymerase chain reaction-based protocol is presented for the determination of the native micro-RNA content (absolute/relative) of lipoprotein particles. In addition, a method for increasing the micro-RNA level, as well as a method for determining the cellular uptake rate of lipoprotein particles, is demonstrated.

Lipoprotein particles are predominately transporters of lipids and cholesterol in the bloodstream. Furthermore, they contain small amounts of strands of ...

Biochemistry

Digital PCR for Quantifying Circulating MicroRNAs in Acute Myocardial Infarction and Cardiovascular Disease

Circulating serum microRNAs (miRNAs) have shown promise as biomarkers for the cardiovascular disease and acute myocardial infarction (AMI), being released from the cardiovascular cells into the circulation. Circulating miRNAs are highly stable and can be quantified. The quantitative expression of specific miRNAs can be linked to the pathology, and some miRNAs show high tissue and disease specificity. Finding novel biomarkers for cardiovascular diseases is of importance for medical research. Quite recently, digital polymerase chain reaction (dPCR) has been invented. dPCR, combined with fluorescent hydrolysis probes, enables specific direct absolute quantification. dPCR exhibits superior technical qualities, including a low variability, high linearity, and high sensitivity compared to the quantitative polymerase chain reaction (qPCR). Thus, dPCR is a more accurate and reproducible method for directly quantifying miRNAs, particularly for the use in large multi-center cardiovascular clinical trials. In this publication, we describe how to effectively perform digital PCR in order to assess the absolute copy number in serum samples.

Circulating microRNAs have shown promise as biomarkers for cardiovascular diseases and acute myocardial infarctions. In this study, we describe a protocol for miRNA extraction, reverse transcription, and digital PCR for the absolute quantification of miRNAs in the serum of patients with cardiovascular disease.

Circulating serum microRNAs (miRNAs) have shown promise as biomarkers for the cardiovascular disease and acute myocardial infarction (AMI), being released ...

Medicine

Highly Efficient Ligation of Small RNA Molecules for MicroRNA Quantitation by High-Throughput Sequencing

MiRNA cloning and high-throughput sequencing, termed miR-Seq, stands alone as a transcriptome-wide approach to quantify miRNAs with single nucleotide resolution. This technique captures miRNAs by attaching 3&#8217; and 5&#8217; oligonucleotide adapters to miRNA molecules and allows de novo miRNA discovery. Coupling with powerful next-generation sequencing platforms, miR-Seq has been instrumental in the study of miRNA biology. However, significant biases introduced by oligonucleotide ligation steps have prevented miR-Seq from being employed as an accurate quantitation tool. Previous studies demonstrate that biases in current miR-Seq methods often lead to inaccurate miRNA quantification with errors up to 1,000-fold for some miRNAs1,2. To resolve these biases imparted by RNA ligation, we have developed a small RNA ligation method that results in ligation efficiencies of over 95% for both 3&#8217; and 5&#8242; ligation steps. Benchmarking this improved library construction method using equimolar or differentially mixed synthetic miRNAs, consistently yields reads numbers with less than two-fold deviation from the expected value. Furthermore, this high-efficiency miR-Seq method permits accurate genome-wide miRNA profiling from in vivo total RNA samples2.

MicroRNAs (miRNAs) are a widely conserved class of regulatory molecules. Here we describe a miRNA cloning method that relies upon two potent ligation steps followed by high-throughput sequencing. Our method permits accurate genome-wide quantitation of miRNAs.

MiRNA cloning and high-throughput sequencing, termed miR-Seq, stands alone as a transcriptome-wide approach to quantify miRNAs with single nucleotide ...

Biology

Probe-based Real-time PCR Approaches for Quantitative Measurement of microRNAs

Probe-based quantitative PCR (qPCR) is a favoured method for measuring transcript abundance, since it is one of the most sensitive detection methods that provides an accurate and reproducible analysis. Probe-based chemistry offers the least background fluorescence as compared to other (dye-based) chemistries. Presently, there are several platforms available that use probe-based chemistry to quantitate transcript abundance. qPCR in a 96 well plate is the most routinely used method, however only a maximum of 96 samples or miRNAs can be tested in a single run. This is time-consuming and tedious if a large number of samples/miRNAs are to be analyzed. High-throughput probe-based platforms such as microfluidics (e.g. TaqMan Array Card) and nanofluidics arrays (e.g. OpenArray) offer ease to reproducibly and efficiently detect the abundance of multiple microRNAs in a large number of samples in a short time. Here, we demonstrate the experimental setup and protocol for miRNA quantitation from serum or plasma-EDTA samples, using probe-based chemistry and three different platforms (96 well plate, microfluidics and nanofluidics arrays) offering increasing levels of throughput.

Circulating microRNAs have recently emerged as promising and novel biomarkers for various cancers and other diseases. The goal of this article is to discuss three different probe-based real-time PCR platforms and methods that are available to quantify and determine the abundance of circulating microRNAs.

Probe-based quantitative PCR (qPCR) is a favoured method for measuring transcript abundance, since it is one of the most sensitive detection methods that ...

Simple Bulk Readout of Digital Nucleic Acid Quantification Assays

Digital assays are powerful methods that enable detection of rare cells and counting of individual nucleic acid molecules. However, digital assays are still not routinely applied, due to the cost and specific equipment associated with commercially available methods. Here we present a simplified method for readout of digital droplet assays using a conventional real-time PCR instrument to measure bulk fluorescence of droplet-based digital assays.
We characterize the performance of the bulk readout assay using synthetic droplet mixtures and a droplet digital multiple displacement amplification (MDA) assay. Quantitative MDA particularly benefits from a digital reaction format, but our new method&#160;applies to any digital assay. For established digital assay protocols such as digital PCR, this method serves to speed up and simplify assay readout.
Our bulk readout methodology brings the advantages of partitioned assays without the need for specialized readout instrumentation. The principal limitations of the bulk readout methodology are reduced dynamic range compared with droplet-counting platforms and the need for a standard sample, although the requirements for this standard are less demanding than for a conventional real-time experiment. Quantitative whole genome amplification (WGA) is used to test for contaminants in WGA reactions and is the most sensitive way to detect the presence of DNA fragments with unknown sequences, giving the method great promise in diverse application areas including pharmaceutical quality control and astrobiology.

We describe an endpoint digital assay for quantifying nucleic acids with a simplified (analog) readout. We measure bulk fluorescence of droplet-based digital assays using a standard qPCR machine rather than specialized instrumentation and confirm our results by microscopy.

Digital assays are powerful methods that enable detection of rare cells and counting of individual nucleic acid molecules. However, digital assays are ...

Measuring Single-Cell Mitochondrial DNA Copy Number and Heteroplasmy Using Digital Droplet Polymerase Chain Reaction

The mammalian mitochondrial (mt)DNA is a small, circular, double-stranded, intra-mitochondrial DNA molecule, encoding 13 subunits of the electron transport chain. Unlike the diploid nuclear genome, most cells contain many more copies of mtDNA, ranging from less than 100 to over 200,000 copies depending on cell type. MtDNA copy number is increasingly used as a biomarker for a number of age-related degenerative conditions and diseases, and thus, accurate measurement of the mtDNA copy number is becoming a key tool in both research and diagnostic settings. Mutations in the mtDNA, often occurring as single nucleotide polymorphisms (SNPs) or deletions, can either exist in all copies of the mtDNA within the cell (termed homoplasmy) or as a mixture of mutated and WT mtDNA copies (termed heteroplasmy). Heteroplasmic mtDNA mutations are a major cause of clinical mitochondrial pathology, either in rare diseases or in a growing number of common late-onset diseases such as Parkinson's disease. Determining the level of heteroplasmy present in cells is a critical step in the diagnosis of rare mitochondrial diseases and in research aimed at understanding common late-onset disorders where mitochondria may play a role. MtDNA copy number and heteroplasmy have traditionally been measured by quantitative (q)PCR-based assays or deep sequencing. However, the recent introduction of ddPCR technology has provided an alternative method for measuring both parameters. It offers several advantages over existing methods, including the ability to measure absolute mtDNA copy number and sufficient sensitivity to make accurate measurements from single cells even at low copy numbers. Presented here is a detailed protocol describing the measurement of mtDNA copy number in single cells using ddPCR, referred to as droplet generation PCR henceforth, with the option for simultaneous measurement of heteroplasmy in cells with mtDNA deletions. The possibility of expanding this method to measure heteroplasmy in cells with mtDNA SNPs is also discussed.

Here we present a protocol for measuring absolute mitochondrial (mt)DNA copy number and mtDNA deletion heteroplasmy levels in single cells.

The mammalian mitochondrial (mt)DNA is a small, circular, double-stranded, intra-mitochondrial DNA molecule, encoding 13 subunits of the electron ...

Absolute Quantification of Plasma MicroRNA Levels in Cynomolgus Monkeys, Using Quantitative Real-time Reverse Transcription PCR

RT-qPCR is one of the most common methods to assess individual target miRNAs. MiRNAs levels are generally measured relative to a reference sample. This approach is appropriate for examining physiological changes in target gene expression levels. However, absolute quantification using better statistical analysis is preferable for a comprehensive assessment of gene expression levels. Absolute quantification is still not in common use. This report describes a protocol for measuring the absolute levels of plasma miRNA, using RT-qPCR with or without pre-amplification.
A fixed volume (200 &#181;L) of EDTA-plasma was prepared from the blood collected from the femoral vein of conscious cynomolgus monkeys (n = 50). Total RNA was extracted using commercially available system. Plasma miRNAs were quantified by probe-based RT-qPCR assays which contains miRNA-specific forward/reverse PCR primer and probe. Standard curves for absolute quantification were generated using commercially available synthetic RNA oligonucleotides. A synthetic cel-miR-238 was used as an external control for normalization and quality assessment. The miRNAs that showed quantification cycle (Cq) values above 35 were pre-amplified prior to the qPCR step.
Among the 8 miRNAs examined, miR-122, miR-133a, and miR-192 were detectable without pre-amplification, whereas miR-1, miR-206, and miR-499a required pre-amplification because of their low expression levels. MiR-208a and miR-208b were not detectable even after pre-amplification. Sample processing efficiency was evaluated by the Cq values of the spiked cel-miR-238. In this assay method, technical variation was estimated to be less than 3-fold and the lower limit of quantification (LLOQ) was 102 copy/&#181;L, for most of the examined miRNAs.
This protocol provides a better estimate of the quantity of plasma miRNAs, and allows quality assessment of corresponding data from different studies. Considering the low number of miRNAs in body fluids, pre-amplification is useful to enhance detection of poorly expressed miRNAs.

This report describes a protocol for measuring the absolute levels of plasma miRNA, using quantitative real-time reverse transcription PCR with or without pre-amplification. This protocol affords better understanding of the quantity of plasma miRNAs and allows qualitative assessment of corresponding data from different studies or laboratories.

RT-qPCR is one of the most common methods to assess individual target miRNAs. MiRNAs levels are generally measured relative to a reference sample. This ...

Quantification of Circular RNAs Using Digital Droplet PCR

Digital droplet polymerase chain reaction (dd-PCR) is one of the most sensitive quantification methods; it fractionates the reaction into nearly 20,000 water-in-oil droplets, and the PCR occurs in the individual droplets. The dd-PCR has several advantages over conventional real-time qPCR, including increased accuracy in detecting low-abundance targets, omitting reference genes for quantification, eliminating technical replicates for samples, and showing high resilience to inhibitors in the samples. Recently, dd-PCR has become one of the most popular methods for accurately quantifying target DNA or RNA for gene expression analysis and diagnostics. Circular RNAs (circRNAs) are a large family of recently discovered covalently closed RNA molecules lacking 5' and 3' ends. They have been shown to regulate gene expression by acting as sponges for RNA-binding proteins and microRNAs. Furthermore, circRNAs are secreted into body fluids, and their resistance to exonucleases makes them serve as biomarkers for disease diagnosis. This article aims to show how to perform divergent primer design, RNA extraction, cDNA synthesis, and dd-PCR analysis to accurately quantify specific circular RNA (circRNA) levels in cells. In conclusion, we demonstrate the precise quantification of circRNAs using dd-PCR.

This protocol describes the detailed method of digital droplet PCR (dd-PCR) for precise quantification of circular RNA (circRNA) levels in cells using divergent primers.

Digital droplet polymerase chain reaction (dd-PCR) is one of the most sensitive quantification methods; it fractionates the reaction into nearly 20,000 ...