Name: site specific lysine acetylation of histones for nucleosome reconstitution using genetic code expansion in escherichia coli
Uploaded: 2020-12-26T14:00:00.000+00:00
Duration: 7 min 26 s
Description: Watch this Scientific Journal Video about Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli at JoVE.com

Dr. Wesley Wang'a bu protokole ve değerli akıl hocalığına zemin hazırlayıp verdiği için teşekkür ederiz. Bu çalışma Kısmen Ulusal Sağlık Enstitüleri (GrantS R01GM127575 ve R01GM121584) ve Welch Foundation (Grant A-1715) tarafından desteklendi.

1. Plazmid yapımı
<ol><li>Hangi histone proteinin asetilasyona ve hangi lizin bölgesine karar vererek başlayın. Siteye yönlendirilmiş mutagenezi kullanarak siteyi amber stop codon'a (TAG) yönlendirin. NOT: Histone proteinlerinin ekspresyonu için daha önce tasarlanmış dört plazmid vardır. Dört histone proteini de N-terminal histidin etiketiyle pETDuet-1 vektörüne klonlandı. Histone H4 ayrıca bir SUMO etiketi, yaklaşık 40 kopya numarasına sahip çoğaltma colE1'in kökeni, ampisiline dayanıklı ve bir T7 promotörü içerir.<ol>
<li>Dört histone protein plazmidinden birinde istenen yerde (mevcut bir lizin kodonunu kehribar durdurma kodonu ile değiştirerek) TAG mutasyonu içeren ileri ve ters astarlar tasarlayın.</li>
		<li>Plazmid içeren TAG'i yükseltmek için tam plazmid PCR kullanın. Astarlar için uygun bir tavlama sıcaklığı belirleyin. Genel olarak, astarların eksi 5 °C'nin erime sıcaklığı (Tm)yeterli olacaktır. Bir PCR ürünü elde etmekte zorluk yaşanırsa, tavlama sıcaklığını amplifikasyon için optimize etmek için Tm - 5 °C civarında bir sıcaklık gradyanı kullanılabilir. NOT: Bu deneyde, aşağıdaki koşullarla 30 döngü boyunca şirket içinde ifade edilen bir PFU polimeraz kullanılmıştır: 30 s (denatürasyon) için 94 °C, 30 s için tavlama sıcaklığı ve 6 dakika (veya kilobase çiftleri başına 1 dk) için 72 °C. Bu tür PCR yöntemi hakkında daha fazla bilgiiçin bkz.</li>
		<li>Üreticinin protokolüne uyarak PCR ürününü pcr temizleme kiti ile temizleyin. PCR ürününü agarose jel elektroforezi ve daha sonra ethidyum bromür lekeleme ile analiz edin.</li>
		<li>Plazmidi 16 °C'de bir gecede T4 ligaz ile inkübasyon yaparak lige edin.</li>
	</ol>
</li>
	<li>İlk plazmid (AmpR)içeren TAG'i kimyasal olarak yetkin Escherichia coli'yedönüştürün. Dönüşümden en az 4 koloni seçin ve plazmidi arındırın. Standart yöntemleri kullanarak gliserol ile her birinin hücre stoklarını yapın ve -80 °C'de saklayın. İstenen TAG mutasyonu onaylamak için sıralama için gönderin.</li>
	<li>Dizi onaylandıktan sonra, pEVOL-AckRS (ChlR)ile TAG içeren plazmid (AmpR)ile birlikte ısı şoku yöntemini kullanarak BL21 hücrelerinin silinmesini kimyasal olarak yetkin CobB'ye (E. coli.)bilinen tek histone lizin deacetylazı) dönüştürün. pEVOL, düşük kopya numarası p15A kökenli bir orta kopya numarasına sahip bir plazmiddir. NOT: pEVOL plazmid serisi, ortogonal aaRS/tRNATyr çiftinin protein kesilmesini azaltmada ve mutant proteinlerin genel verimini artırmada etkili olduğunu gösteren önceki çalışmalara dayanarak inşa edilmiştir8. CobB silme hücrelerine erişilemediyse, kimyasal olarak yetkin BL21 hücreleriyle devam edin. CobB sirtuin benzeri bir histone lizin deacetylazdır ve Nicotinamide alternatif bir yaklaşım olarak CobB'yi inhibe etmek için histone protein ekspresyonu sırasında 5 mM son konsantrasyonda eklenebilir9.</li>
	<li>Bir hücre stoğu yapın ve -80 °C'de saklayın.</li>
</ol>2. Asetillenmiş histone protein ekspresyonu
<ol><li>Bir kültür şişesinde 1 L otomatik kapatılmış 2YT ortamı (veya seçim hacmi) hazırlayın.</li>
	<li>TAG içeren plazmid (AmpR)ve pEVOL-AckRS (Chl R) içeren ve 37 °C ila OD = 0,6(4-6 h) arasında büyüyen ortak dönüştürülmüş hücre stoğu ile uygun antibiyotikleri içeren 2YT ortam 20 mL aşıla.</li>
	<li>1 L otoklavlı 2YT ortama uygun antibiyotikleri ekleyin ve 20 mL başlangıç kültürü ile aşıleyin. 37 °C'de OD = 0,6-0,8 (2-3 saat) arasında büyüyün.</li>
	<li>IPTG 1 mM, %0,2 arabinoz ve AcK 5 mM'nin son konsantrasyonlarına indükleme ajanları ve asetilsin (AcK) ekleyin.</li>
	<li>Kültürü 37 °C'de 6-8 saat büyütün.</li>
	<li>Pelet hücreleri 15 dakika boyunca 2.700 x g'da.</li>
	<li>Hücre peletini gece boyunca -80 °C'de saklayın.</li>
	<li>Bu adımdan itibaren numuneyi her zaman buzda tutun. Hücre peletini 1 L kültür başına 50 mL histone lizis tamponunda çözün.</li>
	<li>Aşağıdaki döngüye göre sonicate: 1 s açık, 1 s kapalı, toplam zamanında: 3 dk% 60 genlik.</li>
	<li>Pelet dahil vücutları 45 dakika boyunca 41.600 x g'da.</li>
	<li>30 mL histone liziz tamponunda süpernatant ve resuspend inklüzyon gövdelerini atın. Pelet içerme 30 dakika boyunca 41.600 x g'dadır. </li>
	<li>Süpernatant atın ve 30 mL pelet yıkama tamponunda dahil etme gövdelerini yeniden dirsindirin. Pelet dahil vücutları 30 dakika boyunca 41.600 x g'da.</li>
	<li>Süpernatant atın ve 6 M Guanidine Hidroklorür (GuHCl) tamponunun 25 mL'sinde dahil etme gövdelerini çözün. 1 saat boyunca 37 °C'de ajitasyon ile kuluçkaya yaslanın. NOT: Gerekirse, dahil etme organları 4 °C'de bir gecede ajitasyon ile inkübe edilebilir.</li>
	<li>Pelet içerme 45 dakika boyunca 41.600 x g'dadır. 2 saat boyunca 6 M GuHCl tamponu ile dengelenmiş 1 mL Ni-NTA reçinesi ile süpernatantı kuluçkaya yaslanın.</li>
	<li>Denatüre koşullar altında Ni-NTA saflaştırma ile devam edin. Sütunu 3 sütun hacminde sütun yıkama arabelleğiyle yıkayın. Elute asetillenmiş histone proteini 10 mL elüsyon tamponu ile. NOT: Proteini burada konsantre etmeye çalışmak bir seçenektir, ancak asetillenmiş histonlar çok öngörülemezdir ve kolayca çökelebilir. Toplam hacimde 2 mL'yi geçmeniz önerilmez.</li>
	<li>Tuzları çıkarmak için asetilasyonlu histone proteinini% 5 asetik asit tamponuna karşı kapsamlı bir şekilde dialyze edin. Dialyze 4 °C'de bir seferde 3 saat, en az 6 kez taze tampon alışverişi. NOT: Geliştirilmiş protein saflığı için saf suya karşı diyalze etme seçeneği vardır. Bununla birlikte, bu, düşük verimli asetillenmiş histone proteinleri için istenmeyen önemli yağış ve verim azalmasına neden olur.</li>
	<li>Aliquot ve lyophilize protein, ve süresiz olarak -80 °C depolayın. Yabani tip histone proteinleri genellikle 10-50 mg/L verim, asetilasyonlu histone proteinlerisse özgü lizin bölgesine bağlı olarak 10 mg/L'den az verim verir. Örneğin, H3K79Ac ortalama 5 mg/L' dir.</li>
</ol>3. Vahşi tip histon proteini ekspresyonu
<ol><li>Tam nükleozomları birleştirmek için, 4 histone proteinini de ifade edin. Vahşi tip histonları ifade ederken ve arındırırken protokol, aşağıdakiler dışında asetilen histonları ile aynıdır:<ol>
<li>Birlikte dönüştürme gerçekleştirmeyin. Vahşi tip histone ifadesi için pEVOL-AcKRS kullanmayın. Antibiyotikleri buna göre ayarlayın.</li>
		<li>Hücresel ifadenin indüksiyonu sırasında CobB silme hücresi hattı kullanmayın veya Nikotinamid, AcK veya arabinoz eklemeyin.</li>
	</ol>
</li>
</ol>4. 601 DNA'nın hazırlanması
NOT: Nükleozom konumlandırmasını yönlendirmek için önceden tasarlanmış optimize edilmiş bir DNA dizisi, yüksek verimli mononükleozom üretmek için histone oktamers ile birleştirilir. Bu dizi 601 DNA veya Widom dizisi olarak adlandırılır. Bu dizi, kromatin remodeling testlerinden tek molekül ölçümlerine kadar nükleozomların in vitro çalışmaları için standart DNA dizisi haline gelmiştir10.
<ol><li>Nükleozom montajı için önemli miktarlarda 601 DNA hazırlamak için pGEM-3z/601'i Top 10 hücrelerine dönüştürün ve plazmid amplifikasyon ve ekstraksiyon için 10 mL kültür yetiştirin. Plazmid çıkarma kiti kullanın ve üreticinin tavsiyesine uyun.</li>
	<li>Bu amplifikasyon protokolü için şirket içinde ifade edilmiş bir PFU polimeraz (daha verimli) kullanın. PCR reaksiyonsu ayarlama: 250 μL reaksiyon için, 207.5 μL otoklavlı MQ H2O, 25 μL 10x PFU Tampon, 5 μL İleri Astar: ctggagaatcccggtgccg, 5 μL Ters Astar: acaggatgtatatctgacacg, 5 μL dNTP karışımı, 2.5 μL PFU enzimi kullanın. Genellikle aynı anda 60 reaksiyon çalıştırarak bir araya yetecek kadar DNA elde ederiz.</li>
	<li>PFU polimeraz kullanıyorsanız, 30 s için 52 °C tavlama sıcaklığı ve 30 s uzatma süresi kullanın. Aksi takdirde üreticilerin önerdiği koşulları izleyin.</li>
	<li>PCR yapıldıktan sonra, PCR ürününü saflaştırmak için tercih edilen bir PCR temizleme kiti kullanın.</li>
</ol>5. Histone oktamer montajı
<ol><li>H2A, H2B, H3 ve H4 histone protein peletlerinin aliquotlarını çözün, böylece GuHCl Buffer'daki her histone proteininin ayrı bir stoğu vardır ve toplam hacmi 100 μL'dir.</li>
	<li>A280 emiciliği ölçerek her bir histon proteininin konsantrasyonunu hesaplayın.</li>
	<li>Emicilik herhangi bir protein için 1'den büyükse, daha doğru bir konsantrasyon elde etmek için GuHCl tamponu ile seyreltin.</li>
	<li>H2A ve H2B proteinlerini 1:1 molar oranında birleştirin ve toplam 4 μg/μL protein konsantrasyonuna seyreltin.</li>
	<li>Dialyze bir gecede 2 M TE arabelleğe karşı 4 °C'de sırayla, 2 h için 1 M TE arabellek ve 5 saat için 0,5 M TE arabellek. NOT: Diyalizin ikinci ve üçüncü adımları, çökeltmek için kararsız protein uyumlarına neden olur. Bu adımlarda yoğun yağış görülmesi bekleniyor.</li>
	<li>4 °C'de 16.800 x g'da santrifüjleme ile çökeltmeleri çıkarın.</li>
	<li>Yine, A280 emiciliğini ölçen histone dimer (H2A/H2B karışımı) ve tetramerlerin (H3/H4 karışımı) konsantrasyonunu hesaplayın.</li>
	<li>Dimerleri ve tetramerleri 1:1 molar oranında karıştırın ve katı NaCl ilavesi ile NaCl'i 2 M'ye ayarlayın.</li>
	<li>Histone oktamer 4 °C'de saklanabilir ve dimer ve tetramerlerden daha kararlıdır. Demonteye neden olabileceği için asla histone oktamerini dondurmayın.</li>
	<li>Asetillenmiş histonlarla bir araya getiriyorsanız, vahşi tip proteini prosedürdeki asetilasyonlu proteinle değiştirmenız yeterlidir.</li>
</ol>6. Nükleozom montajı
<ol><li>601 DNA'yı 2M TE arabelleğe ayarlamak için 100x TE arabellek ve katı NaCl kullanın. 2M TE tampondaki 601 DNA'yı 0.85:1 ila 0.90:1 molar oranında histone oktamerine ekleyin. Jel kayma analizinde serbest DNA varsa daha düşük bir DNA oranı eklenebilir.</li>
	<li>DNA-histon karışımını bir diyaliz torbasına aktarın ve yaklaşık 200 mL 2M TE tampona (veya birden fazla numuneyi monte ediyorsanız daha fazla) yerleştirin ve 4 °C'de çok hafifçe karıştırın.</li>
	<li>Tuz TE tamponunda yavaşça damlatmak için temizlemek için peristaltik bir pompa ayarlayın. Hacim kabaca iki katına çıktığında, hacmin yarısını dökün. Bunu toplamda en az 4 kez yapın. Bir pompa ile bu, başlangıç hacmine bağlı olarak 4-8 saat sürebilir. Tuz konsantrasyonu 150 mM'ye düşürüldüğünde nükleozomlar oluşur (tuzluluk ölçer ile ölçülür).</li>
	<li>Tuz konsantrasyonu 150 mM'ye düşürüldükten sonra, bir gecede 20 mM TE tampona karşı dialyze edin.</li>
	<li>Çökeltme ile çökeltmeleri çıkarın ve bir plaka okuyucu kullanarak nükleozomların konsantrasyonunu A260 okuma ile ölçün.</li>
	<li>His-TEV proteazını ekleyin (TEV: nükleozom 1:30, w:w) ve tüm histidin etiketlerini kaldırmak için 4 °C'de bir gecede kuluçkaya yatırın. Ni-NTA reçinesi aşağı çekerek nükleozom çözeltisinden histidin etiket safsızlıklarını çıkarın.</li>
	<li>Nükleozomları konumlandırmak ve numuneyi homojenize etmek için 1 saat boyunca 60 °C'de kuluçkaya yatırın. NOT: Özellikle kararsız olan asetillenmiş siteler için bu adım tavsiye edilmeyebilir.</li>
	<li>Nükleozomları 4 °C'de kısa süreli (birkaç hafta) saklayın.</li>
	<li>Uzun süreli depolama için, nükleozomları depolama tamponuna karşı dialyze edin ve -80 °C'de saklayın.</li>
</ol>

<ol>
	<li>Srinivasan, G., James, C. M., Krzycki, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pyrrolysine+encoded+by+UAG+in+Archaea:+Charging+of+a+UAG-Decoding+specialized+tRNA.">Pyrrolysine encoded by UAG in Archaea: Charging of a UAG-Decoding specialized tRNA.</a> Science. 296 (5572), 1459-1462 (2002).</li><li>Wan, W., Tharp, J. M., Liu, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pyrrolysyl-tRNA+synthetase:+an+ordinary+enzyme+but+an+outstanding+genetic+code+expansion+tool.">Pyrrolysyl-tRNA synthetase: an ordinary enzyme but an outstanding genetic code expansion tool.</a> Biochimica Et Biophysica Acta. 1844 (6), 1059-1070 (2014).</li><li>Umehara, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=N-Acetyl+lysyl-tRNA+synthetases+evolved+by+a+CcdB-based+selection+possess+N-acetyl+lysine+specificity+in+vitro+and+in+vivo.">N-Acetyl lysyl-tRNA synthetases evolved by a CcdB-based selection possess N-acetyl lysine specificity in vitro and in vivo.</a> FEBS Letters. 586 (6), 729-733 (2012).</li><li>Hsu, W. W., Wu, B., Liu, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sirtuins+1+and+2+are+universal+histone+deacetylases.">Sirtuins 1 and 2 are universal histone deacetylases.</a> ACS Chemical Biology. 11 (3), 792-799 (2016).</li><li>Wang, W. W., Zeng, Y., Wu, B., Deiters, A., Liu, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+chemical+biology+approach+to+reveal+Sirt6-targeted+histone+H3+sites+in+nucleosomes.">A chemical biology approach to reveal Sirt6-targeted histone H3 sites in nucleosomes.</a> ACS Chemical Biology. 11 (7), 1973-1981 (2016).</li><li>Wang, W. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+click+chemistry+approach+reveals+the+chromatin-dependent+histone+H3K36+deacylase+nature+of+SIRT7.">A click chemistry approach reveals the chromatin-dependent histone H3K36 deacylase nature of SIRT7.</a> Journal of the American Chemical Society. 141 (6), 2462-2473 (2019).</li><li>Liu, H., Naismith, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+efficient+one-step+site-directed+deletion,+insertion,+single+and+multiple-site+plasmid+mutagenesis+protocol.">An efficient one-step site-directed deletion, insertion, single and multiple-site plasmid mutagenesis protocol.</a> BMC Biotechnology. 8 (1), 91 (2008).</li><li>Young, T. S., Ahmad, I., Yin, J. A., Schultz, P. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+enhanced+system+for+unnatural+amino+acid+mutagenesis+in+E.+coli.">An enhanced system for unnatural amino acid mutagenesis in E. coli.</a> Journal of Molecular Biology. 395 (2), 361-374 (2010).</li><li>Gallego-Jara, J., &#201;cija Conesa, A., de Diego Puente, T., Lozano Terol, G., C&#225;novas D&#237;az, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+CobB+kinetics+and+inhibition+by+nicotinamide.">Characterization of CobB kinetics and inhibition by nicotinamide.</a> PLoS One. 12 (12), 0189689 (2017).</li><li>Lowary, P. T., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+DNA+sequence+rules+for+high+affinity+binding+to+histone+octamer+and+sequence-directed+nucleosome+positioning.">New DNA sequence rules for high affinity binding to histone octamer and sequence-directed nucleosome positioning.</a> Journal of Molecular Biology. 276 (1), 19-42 (1998).</li><li>Zhao, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+molecular+basis+of+tight+nuclear+tethering+and+inactivation+of+cGAS.">The molecular basis of tight nuclear tethering and inactivation of cGAS.</a> Nature. 587 (7835), 673-677 (2020).</li><li>Burdette, D. L., Vance, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=STING+and+the+innate+immune+response+to+nucleic+acids+in+the+cytosol.">STING and the innate immune response to nucleic acids in the cytosol.</a> Nature Immunology. 14 (1), 19-26 (2013).</li><li>Barber, G. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Innate+immune+DNA+sensing+pathways:+STING,+AIMII+and+the+regulation+of+interferon+production+and+inflammatory+responses.">Innate immune DNA sensing pathways: STING, AIMII and the regulation of interferon production and inflammatory responses.</a> Current Opinion in Immunology. 23 (1), 10-20 (2011).</li><li>Ablasser, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=cGAS+produces+a+2'-5'-linked+cyclic+dinucleotide+second+messenger+that+activates+STING.">cGAS produces a 2'-5'-linked cyclic dinucleotide second messenger that activates STING.</a> Nature. 498 (7454), 380-384 (2013).</li><li>Gao, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclic+[G(2',5')pA(3',5')p]+is+the+metazoan+second+messenger+produced+by+DNA-activated+cyclic+GMP-AMP+synthase.">Cyclic [G(2',5')pA(3',5')p] is the metazoan second messenger produced by DNA-activated cyclic GMP-AMP synthase.</a> Cell. 153 (5), 1094-1107 (2013).</li><li>Zhao, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+conserved+PLPLRT/SD+motif+of+STING+mediates+the+recruitment+and+activation+of+TBK1.">A conserved PLPLRT/SD motif of STING mediates the recruitment and activation of TBK1.</a> Nature. 569 (7758), 718-722 (2019).</li></ol>

Yazarların hiçbiri tarafından beyan edilen rakip finansal çıkarlar yoktur.

Bir deney sırasında bu protokolü her ayrıntıya uymak önemlidir. Nükleozomlar çok kararlı değildir ve bu protokolün belirlenmesinde çok fazla deneme yanılma olmuştur. Partiküller montaj işlemlerine kolayca müdahale edebileceğinden, her adımda (veya gözlendiği zaman) çökeltileri kaldırmak anahtardır. Her zaman ton örneklerini buzda tut. Nükleozomlar 4 °C'de çok uzun süre saklanırsa, kendiliğinden sökülebilirsiniz. Herhangi bir denemede kullanılmadan önce 2 haftadan uzun bir süre 4 °C'd...

Biz sentezlemek ve siteye özgü asetillelenmiş histonlar ile yeniden inşa mononükleozomları birleştirmek içinPylRS ve tRNA Pyl kullandık. PylRS, post translational modifikasyonlara (PTM) sahip proteinler üretmek için genetik kod genişletme aracı olarak paha biçilmez olduğunu kanıtlamıştır ve genetik olarak yaklaşık 200 farklı nTA'yı içerecek şekilde evrimleştirilmiştir. PylRS, çeviri sırasında diğer amino asitlerden kaynaklanan rekabeti ortadan kaldırarak kehribar stop kodonuna dahil olur. PylRS ilk olarak metanojenik arkealarda keşfedilmiştir ve o zamandan beri kimyasal biyolojide yeni reaktif kimyasal grupları proteinlere dahil etmek için1,2.
MmAcKRS1, Methanosarcina mazei PylRS'den evrimleşmiştir ve laboratuvarımızda asetillenmiş proteinlerin sentezi için sıklıkla3, 4,5,6. MmAcKRS1, Escherichia coli'deçeviri sırasında tercih ettiği mRNA'daki bir kehribar mutasyon bölgesinde AcK sunar. Bu teknik daha önce K4, K9, K14, K18, K23, K27, K36, K56, K64 ve K79 histone H3 lizin sitelerinde Sirtuin 1, 2, 6 ve 7'nin asetilasyonlu mononükleozomlar4,5,6üzerindeki aktivitesini incelemek için kullanılmıştır. Burada asetillenmiş histonları ifade etmek ve asetillenmiş nükleozomları yeniden inşa etmek için bu yöntemi detaylandırıyoruz.

<table><tbody><tr><td>0.5 M TE Buffer</td><td>NA</td><td>NA</td><td>0.5 M NaCl, 20 mM Tris, 1 mM EDTA, pH 7.8</td></tr><tr><td>1 M TE Buffer</td><td>NA</td><td>NA</td><td>1 M NaCl, 20 mM Tris, 1 mM EDTA, pH 7.8</td></tr><tr><td>100x TE Buffer</td><td>NA</td><td>NA</td><td></td></tr><tr><td>2 M TE Buffer</td><td>NA</td><td>NA</td><td>2 M NaCl, 20 mM Tris, 1 mM EDTA, pH 7.8</td></tr><tr><td>20 mM TE Buffer</td><td>NA</td><td>NA</td><td>20 mM NaCl, 20 mM Tris, 1 mM EDTA, pH 7.8</td></tr><tr><td>6 M GuHCl</td><td></td><td></td><td>6M guanidinium chloride, 20 mM Tris, 500 mM NaCl, pH 8.0</td></tr><tr><td>Acetyllysine</td><td></td><td></td><td></td></tr><tr><td>Column Wash Buffer</td><td>NA</td><td>NA</td><td>6 M urea, 500 mM NaCl, 20 mM Tris, 20 mM imidazole pH 7.8</td></tr><tr><td>Elution Buffer</td><td>NA</td><td>NA</td><td></td></tr><tr><td>Fisherbrand&amp;nbsp;Variable-Flow Chemical Transfer Pump</td><td>Fischer Scientific</td><td>15-077-67</td><td></td></tr><tr><td>His-TEV protease</td><td></td><td></td><td></td></tr><tr><td>Histone Lysis Buffer</td><td>NA</td><td>NA</td><td>60 mM Tris, 100 mM NaCl, 0.5% Triton-X100 (v/v), 1 mM PMSF pH 8.0</td></tr><tr><td>Ni-NTA Resin</td><td></td><td></td><td>6 M urea, 500 mM NaCl, 20 mM Tris, 250 mM imidazole, pH 7.8</td></tr><tr><td>PCR Clean-Up Kit</td><td>Epoch Life Sicences</td><td>2360050</td><td></td></tr><tr><td>Pellet Wash Buffer</td><td>NA</td><td>NA</td><td>60 mM Tris, 100 mM NaCl, pH 8.0</td></tr><tr><td>petDUET-His-SUMO-TEV-H4</td><td></td><td></td><td></td></tr><tr><td>petDUET-His-TEV-H2A</td><td></td><td></td><td></td></tr><tr><td>petDUET-His-TEV-H2B</td><td></td><td></td><td></td></tr><tr><td>petDUET-His-TEV-H3</td><td></td><td></td><td></td></tr><tr><td>pEVOL-AckRS</td><td>Addgene</td><td>137976</td><td></td></tr><tr><td>pGEM-3z/601</td><td>Addgene</td><td>26656</td><td></td></tr><tr><td>Storage Buffer</td><td>NA</td><td>NA</td><td>20 mM NaCl, 20 mM Tris, 20 mM NaCl, 1 mM EDTA, 20% glycerol, pH 7.8</td></tr><tr><td>Thermocycler</td><td></td><td></td><td></td></tr></tbody></table>

site specific lysine acetylation of histones for nucleosome reconstitution using genetic code expansion in escherichia coli

Asetillenmiş histone proteinleri, bir mutant kodlayan Escherichia coli'de kolayca ifade edilebilir, Nε-asetil-lizin (AcK)-spesifik Methanosarcina mazi pirrolysine tRNA-synthetase (MmAcKRS1) ve onun konyak tRNA (tRNAPyl)siteye özgü asetillenmiş histonları ile yeniden inşa mononükleozomları birleştirmek için. MmAcKRS1 ve tRNAPyl, Escherichia coli'deçeviri sırasında tercih ettiği mRNA'daki bir kehribar mutasyon bölgesinde AcK sağlar. Bu teknik, H3 lizin sahalarında ACK'yı dahil etmek için yaygın olarak kullanılmıştır. Pyrrolysyl-tRNA sentezi (PylRS) ayrıca bölgeye özgü protein modifikasyonu veya fonksiyonelleştirme için diğer nonkanonik amino asitleri (ncAA'lar) içerecek şekilde kolayca geliştirilebilir. Burada MmAcKRS1 sistemini kullanarak AcK'yı histone H3'e dahil etmek ve asetillenmiş H3 proteinlerini yeniden inşa edilmiş mononükleozomlara entegre etmek için bir yöntem detaylandırıyoruz. Asetillenmiş yeniden inşa edilmiş mononükleozomlar biyokimyasal ve bağlayıcı tahlillerde, yapı belirlemede ve daha fazlasında kullanılabilir. Modifiye mononükleozomların elde edilmesi, yeni etkileşimler keşfetmek ve epigenetiği anlamakla ilgili deneyler tasarlamak için çok önemlidir.

Dimerler, tetramerler ve oktavlar% 12 SDS PAGE jeli (Şekil 1 ve Şekil 2)çalıştırılarak değerlendirilebilir. Burada, bazı asetilasyonlu tetramerlerin diğerlerinden daha düşük verime sahip olduğunu görebilirsiniz (Şekil 1). Aslında, çekirdek bölgeye ne kadar yakınsa, verim o kadar düşük gözlenir. Bu büyük olasılıkla, tetramer montajına müdahale eden asetilasyondan kaynakla...

Watch this Scientific Journal Video about Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli at JoVE.com

Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli

Burada, genetik kod genişlemesini kullanarak asetillenmiş histone proteinlerini ifade etmek ve yeniden inşa edilmiş nükleozomları in vitro olarak birleştirmek için bir yöntem sunuyoruz.

Escherichia coli'de Genetik Kod Genişlemesi Kullanılarak Nükleozom Rekonses için Histonların Siteye Özgü Lizin Asetilasyonu

Acetylated histone proteins can be easily expressed in Escherichia coli encoding a mutant, N&#949;-acetyl-lysine (AcK)-specific Methanosarcina mazi ...

site-specific-lysine-acetylation-histones-for-nucleosome

Universidad de Cartagena UDEC

Research

Education

JoVE Journal

JoVE Core

Cell Biology

Biochemistry

Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli

Unit 1

Structure and Organization of DNA

SCIENTISTS IN ACTION

3.9K Görüntüleme.  Texas A&M University. Burada, genetik kod genişlemesini kullanarak asetillenmiş histone proteinlerini ifade etmek ve yeniden inşa edilmiş nükleozomları in vitro olarak birleştirmek için bir yöntem sunuyoruz.

Video: Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli

Reconstitution of Nucleosomes with Differentially Isotope-labeled Sister Histones

Asymmetrically modified nucleosomes contain the two copies of a histone (sister histones) decorated with distinct sets of Post-translational Modifications (PTMs). They are newly identified species with unknown means of establishment and functional implications. Current analytical methods are inadequate to detect the copy-specific occurrence of PTMs on the nucleosomal sister histones. This protocol presents a biochemical method for the in vitro reconstitution of nucleosomes containing differentially isotope-labeled sister histones. The generated complex can be also asymmetrically modified, after including a premodified histone pool during refolding of histone subcomplexes. These asymmetric nucleosome preparations can be readily reacted with histone-modifying enzymes to study modification cross-talk mechanisms imposed by the asymmetrically pre-incorporated PTM using nuclear magnetic resonance (NMR) spectroscopy. Particularly, the modification reactions in real-time can be mapped independently on the two sister histones by performing different types of NMR correlation experiments, tailored for the respective isotope type. This methodology provides the means to study crosstalk mechanisms that contribute to the formation and propagation of asymmetric PTM patterns on nucleosomal complexes.

This protocol describes the reconstitution of nucleosomes containing differentially isotope-labeled sister histones. At the same time, asymmetrically post-translationally modified nucleosomes can be generated after using a premodified histone copy. These preparations can be readily used to study modification crosstalk mechanisms, simultaneously on both sister histones, by using high-resolution NMR spectroscopy.

Farklı Olarak izotopla işaretli Kardeş histonlarla nükleozomlann Sulandırma

Asymmetrically modified nucleosomes contain the two copies of a histone (sister histones) decorated with distinct sets of Post-translational Modifications ...

Biyokimya

Analysis of Histone Antibody Specificity with Peptide Microarrays

Post-translational modifications (PTMs) on histone proteins are widely studied for their roles in regulating chromatin structure and gene expression. The mass production and distribution of antibodies specific to histone PTMs has greatly facilitated research on these marks. As histone PTM antibodies are key reagents for many chromatin biochemistry applications, rigorous analysis of antibody specificity is necessary for accurate data interpretation and continued progress in the field. This protocol describes an integrated pipeline for the design, fabrication and use of peptide microarrays for profiling the specificity of histone antibodies. The design and analysis aspects of this procedure are facilitated by ArrayNinja, an open-source and interactive software package we recently developed to streamline the customization of microarray print formats. This pipeline has been used to screen a large number of commercially available and widely used histone PTM antibodies, and data generated from these experiments are freely available through an online and expanding Histone Antibody Specificity Database. Beyond histones, the general methodology described herein can be applied broadly to the analysis of PTM-specific antibodies.

This manuscript describes methods for applying peptide microarray technology to specificity profiling of antibodies that recognize histones and their post-translational modifications.

Histon Antikor Özgüllüğünün Peptit Mikroarraylerle Analizi

Post-translational modifications (PTMs) on histone proteins are widely studied for their roles in regulating chromatin structure and gene expression. The ...

Optimizing the Genetic Incorporation of Chemical Probes into GPCRs for Photo-crosslinking Mapping and Bioorthogonal Chemistry in Live Mammalian Cells

The genetic incorporation of non-canonical amino acids (ncAAs) via amber stop codon suppression is a powerful technique to install artificial probes and reactive moieties onto proteins directly in the live cell. Each ncAA is incorporated by a dedicated orthogonal suppressor-tRNA/amino-acyl-tRNA-synthetase (AARS) pair that is imported into the host organism. The incorporation efficiency of different ncAAs can greatly differ, and be unsatisfactory in some cases. Orthogonal pairs can be improved by manipulating either the AARS or the tRNA. However, directed evolution of tRNA or AARS using large libraries and dead/alive selection methods are not feasible in mammalian cells. Here, a facile and robust fluorescence-based assay to evaluate the efficiency of orthogonal pairs in mammalian cells is presented. The assay allows screening tens to hundreds of AARS/tRNA variants with a moderate effort and within a reasonable time. Use of this assay to generate new tRNAs that significantly improve the efficiency of the pyrrolysine orthogonal system is described, along with the application of ncAAs to the study of G-protein coupled receptors (GPCRs), which are challenging objects for ncAA mutagenesis. First, by systematically incorporating a photo-crosslinking ncAA throughout the extracellular surface of a receptor, binding sites of different ligands on the intact receptor are mapped directly in the live cell. Second, by incorporating last-generation ncAAs into a GPCR, ultrafast catalyst-free receptor labeling with a fluorescent dye is demonstrated, which exploits bioorthogonal strain-promoted inverse Diels Alder cycloaddition (SPIEDAC) on the live cell. As ncAAs can be generally applied to any protein independently on its size, the method is of general interest for a number of applications. In addition, ncAA incorporation does not require any special equipment and is easily performed in standard biochemistry labs.

A facile fluorescence assay is presented to evaluate the efficiency of amino-acyl-tRNA-synthetase/tRNA pairs incorporating non-canonical amino-acids (ncAAs) into proteins expressed in mammalian cells. The application of ncAAs to study G-protein coupled receptors (GPCRs) is described, including photo-crosslinking mapping of binding sites and bioorthogonal GPCR labeling on live cells.

Kimyasal ve genetik eklenmesi en iyi duruma getirme GPCRs fotoğraf-çapraz eşleme ve canlı memeli hücreleri Bioorthogonal kimyada probları

The genetic incorporation of non-canonical amino acids (ncAAs) via amber stop codon suppression is a powerful technique to install artificial probes and ...

Kimya

Detection of Post-translational Modifications on Native Intact Nucleosomes by ELISA

The genome of eukaryotes exists as chromatin which contains both DNA and proteins. The fundamental unit of chromatin is the nucleosome, which contains 146 base pairs of DNA associated with two each of histones H2A, H2B, H3, and H41. The N-terminal tails of histones are rich in lysine and arginine and are modified post-transcriptionally by acetylation, methylation, and other post-translational modifications (PTMs). The PTM configuration of nucleosomes can affect the transcriptional activity of associated DNA, thus providing a mode of gene regulation that is epigenetic in nature 2,3. We developed a method called nucleosome ELISA (NU-ELISA) to quantitatively determine global PTM signatures of nucleosomes extracted from cells. NU-ELISA is more sensitive and quantitative than western blotting, and is useful to interrogate the epiproteomic state of specific cell types. This video journal article shows detailed procedures to perform NU-ELISA analysis.

Nucleosome ELISA (NU-ELISA) is a sensitive and quantitative method to detect global patterns of post-translational modifications in preparations of native, intact nucleosomes. These modifications include methylations, acetylations, and phosphorylations at specific histone amino acid residues, and hence NU-ELISA provides a global proteomic assay of the overall chromatin modification states of specific cell types.

ELISA yöntemi ile yerli bozulmamış nükleozom Post-translasyonel modifikasyonlar Algılama

The genome of eukaryotes exists as chromatin which contains both DNA and proteins. The fundamental unit of chromatin is the nucleosome, which contains 146 ...

Biyoloji

Repressing Gene Transcription by Redirecting Cellular Machinery with Chemical Epigenetic Modifiers

Regulation of chromatin compaction is an important process that governs gene expression in higher eukaryotes. Although chromatin compaction and gene expression regulation are commonly disrupted in many diseases, a locus-specific, endogenous, and reversible method to study and control these mechanisms of action has been lacking. To address this issue, we have developed and characterized novel gene-regulating bifunctional molecules. One component of the bifunctional molecule binds to a DNA-protein anchor so that it will be recruited to an allele-specific locus. The other component engages endogenous cellular chromatin-modifying machinery, recruiting these proteins to a gene of interest. These small molecules, called chemical epigenetic modifiers (CEMs), are capable of controlling gene expression and the chromatin environment in a dose-dependent and reversible manner. Here, we detail a CEM approach and its application to decrease gene expression and histone tail acetylation at a Green Fluorescent Protein (GFP) reporter located at the Oct4 locus in mouse embryonic stem cells (mESCs). We characterize the lead CEM (CEM23) using fluorescent microscopy, flow cytometry, and chromatin immunoprecipitation (ChIP), followed by a quantitative polymerase chain reaction (qPCR). While the power of this system is demonstrated at the Oct4 locus, conceptually, the CEM technology is modular and can be applied in other cell types and at other genomic loci.

Regulation of the chromatin environment is an essential process required for proper gene expression. Here, we describe a method for controlling gene expression through the recruitment of chromatin-modifying machinery in a gene-specific and reversible manner.

Kimyasal epigenetik değiştiriciler ile hücresel makine yeniden yönlendirerek Gen transkripsiyonu bastırmak

Regulation of chromatin compaction is an important process that governs gene expression in higher eukaryotes. Although chromatin compaction and gene ...

Biyomühendislik

<meta charset="utf8"></head><body>Tek moleküllü çalışmalar için yerinde nükleozom sulandırması

In Situ Nucleosome Assembly for Single-Molecule Correlative Force and Fluorescence Microscopy

Nucleosomes constitute the primary unit of eukaryotic chromatin and have been the focus of numerous informative single-molecule investigations regarding their biophysical properties and interactions with chromatin-binding proteins. Nucleosome reconstitution on DNA for these studies typically involves a salt dialysis procedure that provides precise control over the placement and number of nucleosomes formed along a DNA tether. However, this protocol is time-consuming and requires a substantial amount of DNA and histone octamers as inputs. To offer an alternative strategy, an in situ nucleosome reconstitution method for single-molecule force and fluorescence microscopy that utilizes the histone chaperone Nap1 is described. This method enables users to assemble nucleosomes on any DNA template without the need for strong nucleosome positioning sequences, adjust nucleosome density on demand, and use fewer reagents. In situ nucleosome formation occurs within seconds, offering a simpler experimental workflow and a convenient transition into single-molecule measurements. Examples of two downstream assays for probing nucleosome mechanics and visualizing the behavior of individual proteins on chromatin are further described.

<meta charset="utf8"></head><body>Yazar Spotlight: Tek Moleküllü Teknikler için Verimli Nükleozom Sulandırma

This article presents a detailed experimental procedure for reconstituting nucleosome-containing DNA tethers for single-molecule correlative force and fluorescence microscopy. It further describes several downstream experiments that can be conducted to visualize the binding behavior of chromatin-interacting proteins and analyze changes in the physical properties of nucleosomes.

Tek moleküllü korelasyon kuvveti ve floresan mikroskobu için yerinde nükleozom düzeneği

Nucleosomes constitute the primary unit of eukaryotic chromatin and have been the focus of numerous informative single-molecule investigations regarding ...

A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli

Post-translational modifications that occur at specific positions of proteins have been shown to play important roles in a variety of cellular processes. Among them, reversible lysine acetylation is one of the most widely distributed in all domains of life. Although numerous mass spectrometry-based acetylome studies have been performed, further characterization of these putative acetylation targets has been limited. One possible reason is that it is difficult to generate purely acetylated proteins at desired positions by most classic biochemical approaches. To overcome this challenge, the genetic code expansion technique has been applied to use the pair of an engineered pyrrolysyl-tRNA synthetase variant, and its cognate tRNA from Methanosarcinaceae species, to direct the cotranslational incorporation of acetyllysine at the specific site in the protein of interest. After first application in the study of histone acetylation, this approach has facilitated acetylation studies on a variety of proteins. In this work, we demonstrated a facile protocol to produce site-specifically acetylated proteins by using the model bacterium Escherichia coli as the host. Malate dehydrogenase was used as a demonstration example in this work.

A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli

Genetic code expansion serves as a powerful tool to study a wide range of biological processes, including protein acetylation. Here we demonstrate a facile protocol to exploit this technique for generating homogeneously acetylated proteins at specific sites in Escherichia coli cells.

Escherichia Coli proteinler Site-Specifically oluşturmak için Facile iletişim kuralı Acetylated

Post-translational modifications that occur at specific positions of proteins have been shown to play important roles in a variety of cellular processes. ...

İmmünoloji ve Enfeksiyon

Application of MassSQUIRM for Quantitative Measurements of Lysine Demethylase Activity

Recently, epigenetic regulators have been discovered as key players in many different diseases 1-3. As a result, these enzymes are prime targets for small molecule studies and drug development 4. Many epigenetic regulators have only recently been discovered and are still in the process of being classified. Among these enzymes are lysine demethylases which remove methyl groups from lysines on histones and other proteins. Due to the novel nature of this class of enzymes, few assays have been developed to study their activity. This has been a road block to both the classification and high throughput study of histone demethylases. Currently, very few demethylase assays exist. Those that do exist tend to be qualitative in nature and cannot simultaneously discern between the different lysine methylation states (un-, mono-, di- and tri-). Mass spectrometry is commonly used to determine demethylase activity but current mass spectrometric assays do not address whether differentially methylated peptides ionize differently. Differential ionization of methylated peptides makes comparing methylation states difficult and certainly not quantitative (Figure 1A). Thus available assays are not optimized for the comprehensive analysis of demethylase activity.
Here we describe a method called MassSQUIRM (mass spectrometric quantitation using isotopic reductive methylation) that is based on reductive methylation of amine groups with deuterated formaldehyde to force all lysines to be di-methylated, thus making them essentially the same chemical species and therefore ionize the same (Figure 1B). The only chemical difference following the reductive methylation is hydrogen and deuterium, which does not affect MALDI ionization efficiencies. The MassSQUIRM assay is specific for demethylase reaction products with un-, mono- or di-methylated lysines. The assay is also applicable to lysine methyltransferases giving the same reaction products. Here, we use a combination of reductive methylation chemistry and MALDI mass spectrometry to measure the activity of LSD1, a lysine demethylase capable of removing di- and mono-methyl groups, on a synthetic peptide substrate 5. This assay is simple and easily amenable to any lab with access to a MALDI mass spectrometer in lab or through a proteomics facility. The assay has ~8-fold dynamic range and is readily scalable to plate format 5.

We present a method for using MALDI mass spectrometry and reductive methylation chemistry to quantify changes in lysine methylation.

Lizin demetilaz Faaliyet Kantitatif Ölçümler MassSQUIRM Uygulaması

Recently, epigenetic regulators have been discovered as key players in many different diseases 1-3. As a result, these enzymes are prime targets for small ...

Escherichia coli'de Genetik Kod Genişlemesi Kullanılarak Nükleozom Rekonses için Histonların Siteye Özgü Lizin Asetilasyonu

Özet

Daha Fazla Video Keşfet

Bu videodaki bölümler

Farklı Olarak izotopla işaretli Kardeş histonlarla nükleozomlann Sulandırma

Histon Antikor Özgüllüğünün Peptit Mikroarraylerle Analizi

Kimyasal ve genetik eklenmesi en iyi duruma getirme GPCRs fotoğraf-çapraz eşleme ve canlı memeli hücreleri Bioorthogonal kimyada probları

ELISA yöntemi ile yerli bozulmamış nükleozom Post-translasyonel modifikasyonlar Algılama

Kimyasal epigenetik değiştiriciler ile hücresel makine yeniden yönlendirerek Gen transkripsiyonu bastırmak

Tek moleküllü korelasyon kuvveti ve floresan mikroskobu için yerinde nükleozom düzeneği

Tek moleküllü korelasyon kuvveti ve floresan mikroskobu için yerinde nükleozom düzeneği

Tek moleküllü korelasyon kuvveti ve floresan mikroskobu için yerinde nükleozom düzeneği

Escherichia Coli proteinler Site-Specifically oluşturmak için Facile iletişim kuralı Acetylated

Lizin demetilaz Faaliyet Kantitatif Ölçümler MassSQUIRM Uygulaması