Name: modifying baculovirus expression vectors to produce secreted plant proteins in insect cells
Uploaded: 2018-08-20T15:00:00.000+00:00
Duration: 9 min 14 s
Description: Watch this Scientific Journal Video about Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells at JoVE.com

Bu eser Guozhou Xu için Kuzey Carolina Eyalet Üniversitesi yeni öğretim başlangıç fonlar tarafından desteklenmiştir.

Not: Bir böcek cep/baculovirus sistemi ile değiştirilmiş ifade vektörel çizimler salgı bitki protein ifade ve kristalizasyon için kullanılır.
1. bir Baculovirus ifade vektör GP67 sinyal peptid bitki Protein salgılanması ifade ile modifikasyonu
<ol><li>Bir 5' BglII kesme makinası13, GP67 salgılanması sinyal sıra ve NotI, BamHI, EcoRI, StuI, SalI, SpeI, XbaI, PstI ve XhoI (Şekil 1A) ile bir çok klonlama site içeren bir DNA parçası sentez. Not: BglII ve BamHI sindirilmiş beri DNA aynı yapışkanlı sona sonuçlandı, tavlanmış ligasyonu sırayla BglII ve BamHI siteleri tarafından yarilabilir değil bir sıra mutasyona iken Doğrusallaştırılmış vektör sindirilir DNA parçası ligate ya BglII ya da BamHI14.</li>
	<li>BglII ve XhoI ile DNA'ın Özeti 4 µg ve14BamHI ve XhoI ile bir ifade vektör DNA 4 µg. 1 x konsantrasyon tepki arabellek (50 mM potasyum asetat, 20 mM Tris-asetat, 10 mM magnezyum asetat ve 100 µg/mL BSA, pH 7,9 25 ° c) DNA'daki ile her Restriksiyon enzimi ile 10 birim mix ve 4 h için 37 ° C'de karışımı kuluçkaya.<ol>
<li>Eksize DNA parçası ve bir DNA jel ekstraksiyon kiti15tarafından Doğrusallaştırılmış vektör DNA arındırmak.</li>
	</ol>
</li>
	<li>Yöneyin Doğrusallaştırılmış DNA 400 ile mix 100 ng ng sindirilir DNA parçası 1 x T4 DNA ligaz tepki arabellek (50 mM Tris-HCl, 10 mM MgCl2, 1 mM ATP ve 10 mM DTT, pH 7.5 25 ° c) ve 5 adet T4 DNA içeren bir 10 µL ligasyonu tepki karışımı ligaz. 16 ° C 16 h için tepki karisimin kuluçkaya.</li>
	<li>5 µL ligasyonu karışımı DH5α yetkili hücre bir standart dönüştürme protokol sonrası 100 µL dönüştürmek ve bir ampisilin-LB agar plaka16üzerinde elde edilen kolonileri seçin. 5-10 kolonileri kadar almak ve her koloni 220 devir/dakika ve 37 ° C 16 h için titreyen bir kuluçka 100 µg/mL ampisilin içeren LB Orta 2 ml büyür.</li>
	<li>Her plazmid DNA ile DNA miniprep kit17 ayıklamak ve klonlar tarafından DNA sıralama bir astar AGTATTTTACTGTTTTCGTAACAG ile onaylayın.</li>
	<li>PCR yükseltmek A. thaliana TDR gen parçası kodlama artıkları sentetik bir TDR gen üzerinden 30-642 oluşturmak (ileri astar: CATG GCGGCCGC CTCAAGTTTTCACCTCAACTCTTGTC, geriye doğru astar: GC GGATCC CTA GTG GTG ATG GTG GTG GTG ACCGTCTATATCTGCATTTCCGGC). 0,5 mM dNTP mix, 0.2 µM astar, şablonun DNA 0.1 µg, 0.4 mM MgCl2ve 1 tepki adet DNA polimeraz içeren DNA polimeraz tepki arabellekte 30 döngüleri için DNA yükseltmek.<ol>
<li>30 95 ° C'de ilk denatürasyon PCR döngüsü adımlar için küme s ve sonra 30 döngüleri denatürasyon 95 ° C'de 30 s, 30 s ve uzantısına sahip bir son 5 min için 72 ° C'de 72 ° c için 1 dakika, uzantısı için 55 ° C'de tavlama.</li>
	</ol>
</li>
	<li>PCR parçası ve yazmamalı ve BamHI kısıtlama endonükleaz enzimleri ile değiştirilmiş vektör sindirmek. Gen parça Doğrusallaştırılmış vektör ile ligate. Yöneyin Doğrusallaştırılmış DNA 400 ile mix 100 ng ng sindirilir DNA parçası T4 DNA ligaz reaksiyon tamponu ve 5 adet T4 DNA ligaz içeren bir 10 µL ligasyonu tepki karışımı. 16 ° C 16 h için tepki karisimin kuluçkaya.</li>
	<li>5 µL ligasyonu karışımı DH5α yetkili hücre bir standart dönüştürme protokol sonrası 100 µL dönüştürmek ve bir ampisilin-LB agar plaka16üzerinde elde edilen kolonileri seçin. Doğru klon DNA sıralama tarafından onaylayın.</li>
</ol>2. bir Baculovirus ifade vektör böcek Hemolin sinyal peptid bitki Protein salgılanması ifade ile modifikasyonu
<ol><li>Bir 5' BglII kesme makinası13, böcek hemolin salgılanması sinyal sıra ve NotI, BamHI, EcoRI, StuI, SalI, SpeI, XbaI, PstI ve XhoI (Şekil 1B) ile bir çok klonlama site içeren bir DNA parçası sentez.</li>
	<li>BglII ve XhoI ile DNA'ın Özeti 4 µg ve14BamHI ve XhoI ile bir ifade vektör DNA 4 µg. 1 x konsantrasyon tepki arabellek (50 mM potasyum asetat, 20 mM Tris-asetat, 10 mM magnezyum asetat ve 100 µg/mL BSA, pH 7,9 25 ° c) DNA'daki ile her Restriksiyon enzimi ile 10 birim mix ve 4 h için 37 ° C'de karışımı kuluçkaya.<ol>
<li>Eksize DNA parçası ve bir DNA jel ekstraksiyon kiti15tarafından Doğrusallaştırılmış vektör DNA arındırmak.</li>
	</ol>
</li>
	<li>Yöneyin Doğrusallaştırılmış DNA 400 ile mix 100 ng ng sindirilir DNA parçası 1 x T4 DNA ligaz tepki arabellek (50 mM Tris-HCl, 10 mM MgCl2, 1 mM ATP ve 10 mM DTT, pH 7.5 25 ° c) ve 5 adet T4 DNA içeren bir 10 µL ligasyonu tepki karışımı ligaz. 16 ° C 16 h için tepki karisimin kuluçkaya.</li>
	<li>5 µL ligasyonu karışımı DH5α yetkili hücre 100 µL dönüştürmek ve koloniler ampisilin-LB agar plaka üzerinde seçin. 5-10 kolonileri kadar almak ve 2 mL LB ortamda 100 µg/mL 220 devir/dakika ve 37 ° C 16 h için titreyen bir kuluçka ampisilin içeren her koloni büyür.</li>
	<li>Plazmid DNA ile DNA miniprep kit17 ayıklamak ve klonlar tarafından DNA sıralama bir astar AGTATTTTACTGTTTTCGTAACAG ile onaylayın.</li>
	<li>A. thaliana polen reseptör kinaz 3 (PRK3) gen parça PCR yükseltmek artıkları 20-237 sentetik bir PRK3 gen yapısı üzerinden kodlama (ileri astar: CATG GCGGCCGC CTACAAAACGTTAGTGAATCGGAACC, geriye doğru astar: CGC GGATCC CTA GTG GTG ATG GTG GTG GTG TGAAGGTTTCTCATCGCATTCTATATTC). 0,5 mM dNTP mix, 0.2 µM astar, şablonun DNA 0.1 µg, 0.4 mM MgCl2ve 1 tepki adet DNA polimeraz içeren DNA polimeraz tepki arabellekte 30 döngüleri için DNA yükseltmek.<ol>
<li>30 95 ° C'de ilk denatürasyon PCR döngüsü adımlar için küme s ve sonra 30 döngüleri denatürasyon 95 ° C'de 30 s, 30 s ve uzantısı için 30 72 ° C'de 55 ° C'de tavlama her döngüsü ve 5 min için 72 ° C'de son uzantısı içinde s.</li>
	</ol>
</li>
	<li>PCR parçası ve yazmamalı ve BamHI kısıtlama endonükleaz enzimleri ile değiştirilmiş vektör sindirmek. Gen parça Doğrusallaştırılmış vektör ile ligate. Yöneyin Doğrusallaştırılmış DNA 400 ile mix 100 ng ng sindirilir DNA parçası T4 DNA ligaz reaksiyon tamponu ve 5 adet T4 DNA ligaz içeren bir 10 µL ligasyonu tepki karışımı. 16 ° C 16 h için tepki karisimin kuluçkaya.</li>
	<li>5 µL ligasyonu karışımı DH5α yetkili hücre bir standart dönüştürme protokol sonrası 100 µL dönüştürmek ve bir ampisilin-LB agar plaka16üzerinde elde edilen kolonileri seçin. Doğru klon DNA sıralama tarafından onaylayın.</li>
</ol>3. üretim ve Baculovirus amplifikasyon oluşturur rekombinant Protein ifade kaset yataklık
<ol><li>DH10Bac yetkili hücre baculovirus ifade sistem1protokol sonrası 40 µL dönüştürmek için yapı plazmid kullanım 100 ng. 48 h 37 ° C'de dönüştürme plakaları kuluçkaya.</li>
	<li>İki beyaz kolonileri her dönüştürme plaka almak, her koloni 2 mL 50 µg/mL sefaloridin, 7 µg/mL gentamisin ve 10 µg/mL tetrasiklin içeren LB orta aşılamak. Ayıklamak ve DNA bacmid doğrulamak için baculovirus ifade sistem1 Protokolü izleyin. Aliquot her DNA 20 µL her, ile iki tüpler ve borular-20 ° C'de depolayın Not: Aşağıdaki adımları aseptik ameliyat gerektirir.</li>
	<li>Bir monolayer Kültür medya % 10 fetal Sığır serum (FBS) ve 100 µg/mL (veya 100 I.U./mL) ile penisilin-streptomisin antibiyotik 27 ° C'de Sf9 hücrelerinin % 80 izdiham bir 6-şey plaka için büyür. Doku kültürü plaka üzerinde kapalı alan yüzdesini temel izdiham yüzdesini tahmin ediyoruz.</li>
	<li>İki steril 1.5 mL santrifüj tüpleri aşağıdaki çözümleri hazırlayın.<ol>
<li>Tüp 1: her transfection için bacmid DNA unsupplemented Sf9 hücre kültür orta antibiyotikler olmadan 100 µL içine 20 µL oranında seyreltin. Seyreltme karışımı yavaşça tüp tarafında flicking tarafından.</li>
		<li>Tüp 2: her transfection için unsupplemented Sf9 hücre kültür orta antibiyotikler olmadan 100 µL içine lipid transfection reaktif 8 µL oranında seyreltin. Seyreltme yukarı ve aşağı 6 x için pipetting tarafından iyice karıştırın.</li>
	</ol>
</li>
	<li>İki çözüm birleştirmek, onları karışımı yavaşça yavaşça yukarı ve aşağı 3 x için pipetting tarafından ve onları 20-40 dakika oda sıcaklığında kuluçkaya.</li>
	<li>Sf9 monolayer her şey hücreleri 2 x 3 mL unsupplemented Sf9 hücre kültür orta olmadan antibiyotik ile yıkayın. Her transfection için unsupplemented Sf9 hücre kültür orta antibiyotikler olmadan 0.8 mL lipid-DNA karışımı içeren her tüpün ekleyin. Tüpler içeriğini karışımı yavaşça yavaşça yukarı ve aşağı 3 x için pipetting tarafından. Tabak yıkama medyadan Aspire edin ve transfection karışımı ile örnekleri yerleşimi.</li>
	<li>Transfection karışımı eklenmesinden sonra 27 ° C'de 5 h transfected plaka kuluçkaya Tam Sf9 hücre kültür veya % 10 FBS ve 100 µg/mL (100 I.U./mL) içeren orta ile transfection ortamı değiştirin penisilin-streptomisin antibiyotik. 4 d için 27 ° C'de transfected plaka kuluçkaya.</li>
	<li>Hasat ve rekombinant baculovirus yükseltmek.<ol>
<li>Süpernatant steril 15 mL konik tüp içinde virüslü plaka, kuluçka sonra 4 d toplayın. Süpernatant vasıl 1010 x g hücre artıkları kaldırmak 5 min için spin. Pelet atmak ve süpernatant temiz bir tüp için dikkatle boşaltmak ve 4 ° C ilâ 1 yıl için saklayın. Not: Bu P0 virüs olduğunu. Bu uzun bir süre için bölünmemeli ve-80 ° C'de depolanmış olabilir.</li>
		<li>Rekombinant her virüs yükseltmek için % 80 izdiham monolayer 150 mm tabakta Sf9 hücrelerin büyümek. Plaka medyadan Aspire edin, 2 mL P0 virüs hücreleri yapışık plaka ekleyin ve 1 h 27 ° C kuluçka plaka kuluçkaya. Orta hücre ile karıştırmak için plaka her 15dk rock.<ol>
<li>25 mL % 10 FBS ve 100 µg/mL (veya 100 I.U./mL) içeren tam Grace'in medya ekleyin penisilin-streptomisin antibiyotik. P1 geçit virüs almak için 27 ° C kuluçka 3 d plaka kuluçkaya.</li>
		</ol>
</li>
		<li>Steril 50 mL konik tüp ve 1010 x g hücre artıkları kaldırmak 5 min için spin virüslü plaka süpernatant toplamak. Süpernatant temiz bir tüp için dikkatle boşaltmak ve 4 ° C ilâ 1 yıl için saklayın. Not: P1 virüs bölünmemeli ve saklı-80 ° C'de daha uzun bir süre için olabilir.</li>
		<li>Virüs--dan P1 P2 geçiş için yükseltmek için bir monolayer 150 mm tabakta Sf9 hücrelerinin % 90 izdiham için büyümek, medya plaka Aspire edin, P1 virüs 2 mL plaka ekleyin ve 1 h 27 ° C kuluçka için kuluçkaya.</li>
		<li>3.8.2 ve 3.8.3 virüslerin P2 ve P3 pasajlar edinmek için adımları yineleyin. P3 virüs 2 aydan fazla tutmayın.</li>
	</ol>
</li>
</ol>4. protein ifade, NiNTA ve kristalizasyon ile arıtma
<ol><li>2 x 106 100 devirde bir 27 ° C kuluçka Shaker yoğunluğu kültür medya 100 µg/mL (veya 100 I.U./mL) ile penisilin-streptomisin antibiyotiklere Hi5 böcek hücrelerinin 1 L kültür. Spin aşağı hücreleri 570 x g 5 min için de, süpernatant dikkatle boşaltmak, 20 mL taze üretilen P3 şunun hücrelerde resuspend ve 1 h. yavaşça sarsmak için her 15 dk x 1 hücreleri resuspend için spin şişe oda sıcaklığında saklayın.</li>
	<li>Hücreleri 1 litre 100 µg/mL (veya 100 I.U./mL) ile Kültür medya penisilin-streptomisin antibiyotikler, transfer 100 devirde bir 27 ° C kuluçka Shaker 72 h. Spin 1.010 x g 5 min için de hücreleri aşağı için hücre kültür ve süpernatant toplamak.</li>
	<li>Kullanım pH göstergesi süpernatant 8,0 pH 0,1 M HCl veya 0.1 M NaOH ekleyerek ayarlayın ve 20 mM Tris tampon pH 8.0, 100 mM NaCl ve 5 mM imidazole içeren bir son konsantrasyonu, bağlama arabellek eklemek için şeritler. Üzerinde ifade O'nun öğesini Rekombinant protein verim tahmini göre belirli bir miktar NiNTA reçine (10-40 mL) ekleyin.<ol>
<li>Çözüm manyetik heyecan üzerinde 1 h. Yıkama için 4 ° C'de düşük hız ile reçine mix ve standart NiNTA arıtma Protokolü18takip ilişkili protein elute.</li>
	</ol>
</li>
	<li>Saf protein iyon değiştirme için konu ve filtrasyon Kromatografi yanı sıra homojen bir örnek vermeye diğer protein saflaştırma yöntemleri jel. Not: TDR ectodomain için 20 mM Tris, pH 8, 100 mM NaCl kullanılan jel filtrasyon arabellek. PRK3 ectodomain için 20 mM BIS-Tris, pH 6, 100 mM NaCl tercih edilen jel filtrasyon arabellek kullanılmıştır.</li>
</ol>

<ol>
	<li>Contreras-Gomez, A., Sanchez-Miron, A., Garcia-Camacho, F., Molina-Grima, E., Chisti, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+production+using+the+baculovirus-insect+cell+expression+system.">Protein production using the baculovirus-insect cell expression system.</a> Biotechnology Progress. 30, 1-18 (2014).</li><li>Khan, S., Ng, M. L., Tan, Y. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+the+severe+acute+respiratory+syndrome+coronavirus+3a+protein+and+the+assembly+of+coronavirus-like+particles+in+the+baculovirus+expression+system.">Expression of the severe acute respiratory syndrome coronavirus 3a protein and the assembly of coronavirus-like particles in the baculovirus expression system.</a> Methods in Molecular Biology. 379, 35-50 (2007).</li><li>Possee, R. D., King, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Baculovirus+Transfer+Vectors.">Baculovirus Transfer Vectors.</a> Methods in Molecular Biology. 1350, 51-71 (2016).</li><li>Vaughn, J. L., Goodwin, R. H., Tompkins, G. J., McCawley, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+establishment+of+two+cell+lines+from+the+insect+Spodoptera+frugiperda+(Lepidoptera;+Noctuidae).">The establishment of two cell lines from the insect Spodoptera frugiperda (Lepidoptera; Noctuidae).</a> In Vitro. 13, 213-217 (1977).</li><li>Hink, W. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Established+insect+cell+line+from+the+cabbage+looper,+Trichoplusia+ni.">Established insect cell line from the cabbage looper, Trichoplusia ni.</a> Nature. 226, 466-467 (1970).</li><li>Davis, T. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+recombinant+protein+production+of+eight+insect+cell+lines.">Comparative recombinant protein production of eight insect cell lines.</a> In Vitro Cellular &amp; Development Biology - Animal. 29A, 388-390 (1993).</li><li>Wickham, T. J., Nemerow, G. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+growth+methods+and+recombinant+protein+production+in+BTI-Tn-5B1-4+insect+cells+using+the+baculovirus+expression+system.">Optimization of growth methods and recombinant protein production in BTI-Tn-5B1-4 insect cells using the baculovirus expression system.</a> Biotechnology Progress. 9, 25-30 (1993).</li><li>Davis, T. R., Trotter, K. M., Granados, R. R., Wood, H. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Baculovirus+expression+of+alkaline+phosphatase+as+a+reporter+gene+for+evaluation+of+production,+glycosylation+and+secretion.">Baculovirus expression of alkaline phosphatase as a reporter gene for evaluation of production, glycosylation and secretion.</a> Nature Biotechnology. 10, 1148-1150 (1992).</li><li>Murphy, C. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhanced+expression,+secretion,+and+large-scale+purification+of+recombinant+HIV-1+gp120+in+insect+cell+using+the+baculovirus+egt+and+p67+signal+peptides.">Enhanced expression, secretion, and large-scale purification of recombinant HIV-1 gp120 in insect cell using the baculovirus egt and p67 signal peptides.</a> Protein Expression and Purification. 4, 349-357 (1993).</li><li>Sun, S. C., Lindstrom, I., Boman, H. G., Faye, I., Schmidt, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemolin:+an+insect-immune+protein+belonging+to+the+immunoglobulin+superfamily.">Hemolin: an insect-immune protein belonging to the immunoglobulin superfamily.</a> Science. 250, 1729-1732 (1990).</li><li>Li, Z., Chakraborty, S., Xu, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+CLE+peptide+perception+by+plant+receptors+implicated+from+structural+and+functional+analyses+of+TDIF-TDR+interactions.">Differential CLE peptide perception by plant receptors implicated from structural and functional analyses of TDIF-TDR interactions.</a> PLoS One. 12, e0175317 (2017).</li><li>Chakraborty, S., Pan, H., Tang, Q., Woolard, C., Xu, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Extracellular+Domain+of+Pollen+Receptor+Kinase+3+is+structurally+similar+to+the+SERK+family+of+co-receptors.">The Extracellular Domain of Pollen Receptor Kinase 3 is structurally similar to the SERK family of co-receptors.</a> Scientific Reports. 8, 2796 (2018).</li><li>Khorana, H. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Total+synthesis+of+a+gene.">Total synthesis of a gene.</a> Science. 203, 614-625 (1979).</li><li>Bahl, C. P., Marians, K. J., Wu, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+general+method+for+inserting+specific+DNA+sequences+into+cloning+vehicles.">A general method for inserting specific DNA sequences into cloning vehicles.</a> Gene. 1, 81-92 (1976).</li><li>Xu, W., Zhang, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+Characterization+of+Vaccine-Derived+Polioviruses,+Relevance+for+the+Global+Polio+Eradication+Initiative.">Isolation and Characterization of Vaccine-Derived Polioviruses, Relevance for the Global Polio Eradication Initiative.</a> Methods in Molecular Biology. 1387, 213-226 (2016).</li><li>Hanahan, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studies+on+transformation+of+Escherichia+coli+with+plasmids.">Studies on transformation of Escherichia coli with plasmids.</a> Journal of Molecular Biology. 166, 557-580 (1983).</li><li>Zhang, S., Cahalan, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purifying+plasmid+DNA+from+bacterial+colonies+using+the+QIAGEN+Miniprep+Kit.">Purifying plasmid DNA from bacterial colonies using the QIAGEN Miniprep Kit.</a> Journal of Visualized Experiments. (6), 247 (2007).</li><li>Reddy, B. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+and+purification+of+the+alpha+subunit+of+the+epithelial+sodium+channel,+ENaC.">Expression and purification of the alpha subunit of the epithelial sodium channel, ENaC.</a> Protein Expression and Purification. 117, 67-75 (2016).</li><li>Harris, T. J., Emtage, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+heterologous+genes+in+E.+coli.">Expression of heterologous genes in E. coli.</a> Microbiological Sciences. 3, 28-31 (1986).</li><li>Kaur, J., Kumar, A., Kaur, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Strategies+for+optimization+of+heterologous+protein+expression+in+E.+coli:+Roadblocks+and+reinforcements.">Strategies for optimization of heterologous protein expression in E. coli: Roadblocks and reinforcements.</a> International Journal of BIological Macromolecules. 106, 803-822 (2018).</li><li>Guo, Y., Yang, F., Tang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Overview+of+Protein+Secretion+in+Yeast+and+Animal+Cells.">An Overview of Protein Secretion in Yeast and Animal Cells.</a> Methods in Molecular Biology. 1662, 1-17 (2017).</li><li>Blight, M. A., Chervaux, C., Holland, I. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+secretion+pathway+in+Escherichia+coli.">Protein secretion pathway in Escherichia coli.</a> Current Opinion in Biotechnology. 5, 468-474 (1994).</li><li>Idiris, A., Tohda, H., Kumagai, H., Takegawa, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+of+protein+secretion+in+yeast:+strategies+and+impact+on+protein+production.">Engineering of protein secretion in yeast: strategies and impact on protein production.</a> Applied Microbiology and Biotechnology. 86, 403-417 (2010).</li><li>Wormald, M. R., Dwek, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Glycoproteins:+glycan+presentation+and+protein-fold+stability.">Glycoproteins: glycan presentation and protein-fold stability.</a> Structure. 7, R155-R160 (1999).</li><li>Geisler, C., Mabashi-Asazuma, H., Jarvis, D. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Overview+and+History+of+Glyco-Engineering+in+Insect+Expression+Systems.">An Overview and History of Glyco-Engineering in Insect Expression Systems.</a> Methods in Molecular Biology. 1321, 131-152 (2015).</li><li>Li, Z., Chakraborty, S., Xu, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=X-ray+crystallographic+studies+of+the+extracellular+domain+of+the+first+plant+ATP+receptor,+DORN1,+and+the+orthologous+protein+from+Camelina+sativa.">X-ray crystallographic studies of the extracellular domain of the first plant ATP receptor, DORN1, and the orthologous protein from Camelina sativa.</a> Acta Crystallographica Section F: Structural BIology and Crystallization Communications. 72, 782-787 (2016).</li><li>Aricescu, A. R., Owens, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+recombinant+glycoproteins+in+mammalian+cells:+towards+an+integrative+approach+to+structural+biology.">Expression of recombinant glycoproteins in mammalian cells: towards an integrative approach to structural biology.</a> Current Opinion in Structural Biology. 23, 345-356 (2013).</li><li>Reuter, L. J., Bailey, M. J., Joensuu, J. J., Ritala, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Scale-up+of+hydrophobin-assisted+recombinant+protein+production+in+tobacco+BY-2+suspension+cells.">Scale-up of hydrophobin-assisted recombinant protein production in tobacco BY-2 suspension cells.</a> Plant Biotechnology Journal. 12, 402-410 (2014).</li><li>Dohi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inducible+virus-mediated+expression+of+a+foreign+protein+in+suspension-cultured+plant+cells.">Inducible virus-mediated expression of a foreign protein in suspension-cultured plant cells.</a> Archives of Virology. 151, 1075-1084 (2006).</li></ol>

Yazarlar ifşa gerek yok.

Çeşitlilik içinde büyüklük ve istikrar proteinlerin biyolojik sistemlerde mevcut binlerce göz önüne alındığında, bu kez bir araştırma için ampirik laboratuvar hangi Contegra ifade sistem karar vardır belirli bir protein ifade için seçilecek. E. coli ifade sistem kez up19ölçeklemek için ilk kısa yaşam döngüsü nedeniyle protein ifade bakterilerin düşük maliyetli Kültür Medya ve göreceli kolaylığı için seçimdir. Ancak, E. coli kullanarak 60 kDa ...

X-ışını crystallographic çalışmalar için özellikle Biyokimya ve biyofizik karakterizasyonu için homojen rekombinant proteinlerin büyük miktarlarda üretme yeteneğine sahip olması bir araştırma laboratuvarı için zorunludur. Escherichia coli, mantar, böcek hücreleri, memeli hücreleri, bitki hücreleri, vb aralarında gibi birçok tanınmış Contegra ifade sistemleri vardır, böcek hücre baculovirus-aracılı ifade sistem en çoğunlukla teknikleri yapısal olarak katlanmış büyük ölçekli rekombinant ökaryotik proteinler protein kristalizasyon1için büyük miktarlarda üretmek için kullanılır.
İfade vektörel çizimler baculovirus ifade sisteminin güçlü polyhedrin veya yüksek bir verim rekombinant proteinler hücre içi2,3üretmek için P10 organizatörü içerecek şekilde tasarlanmıştır. Rekombinant baculovirus yapmak için faiz gen Autographa californica multi-nucleopolyhedroviral genom polyhedrin (polh) odağı içeren bir böcek vektörü klonlanmış. Elde edilen yapı sonra sıralı ve onun doğru açık okuma çerçevesi (ORF) doğrulanır. Doğru yapı sonra transfection sürecinde ana bilgisayar böcek hücresine tanıttı. Gen ilgi viral Genom tarafından Homolog rekombinasyon eklenir. Bu olay rekombinant üretmek için hangi sonra çoğaltır virüs parçacıkları1budded rekombinant viral genom üretiminde sonuçlanır.
İfade sisteminde en sık kullanılan böcek hücreleri Sf9 ve yüksek beş (Hi5) hücrelerdir. Spodoptera frugiperda, pupa yumurtalık hücrelerinden elde edilen Sf21, klonal bir izole Sf9 hücrelerdir ve ebeveyn Trichoplusia ni yumurtalık hücre satırı TN-3684,5dan türetilmiş bir klonal izole Hi5 hücrelerdir. Hi5 hücreleri genellikle rekombinant proteinler6daha yüksek miktarlarda üretmek için seçili iken eş transfections, virüs amplifikasyon ve plak deneyleri Sf9 hücreleri üzerinde yapılmaktadır. Hi5 hücreleri mutasyona uğramış virüs üretmek için onların eğilimi nedeniyle üretimi ve virüs ettiklerinizden amplifikasyon için uygun değildir fazlalaştı. Geleneksel olarak, 25-30 ° C sıcaklık aralığı böcek hücreleri ekimi için iyi olarak kabul edilir. Ancak, 27-28 ° C en uygun sıcaklık böcek hücre büyüme ve enfeksiyon7,için8olduğu bildirilmiştir.
Giriş Gen önceki bir güçlü sinyal sırasında salgılanan proteinler yüksek ifade için gereklidir. Sinyal sıra verimli bir şekilde çevrilmiş Rekombinant protein endoplazmik retikulum protein salgılanması ve translasyonel modifikasyonlar uygun katlama ve sabitleme3için gerekli için deliklere. Protein GP64/67, bal arısı melittin ve diğerleri, baculovirus örtmek gibi sinyal peptid dizileri, baculovirus-aracılı ifade sistemleri3salgı rekombinant proteinlerin ifadesi kolaylaştırmak için seçildi. GP67 sinyal peptid getirilmesi ile karşılaştırıldığında içsel sinyal peptid hedef gen9kullanarak salgılanan bir Rekombinant protein, ifade verimini artırmak için gösterilmiştir. Hemolin bir bakteri enfeksiyonu10indüklenen dev ipek güve Hyalophora cecropia, hemolymph proteindir. İndüklenen ifade nispeten yüksek seviyede nedeniyle, gen sinyal peptid dizisi rekombinant proteinlerin salgılanmasını ifade baculovirus-böcek hücre sisteminde arabuluculuk için kullanılabilir.
A. thaliana Tracheary öğesi farklılaşma inhibitör faktör reseptör (TDR) ve polen reseptör kinaz her ikisi de proteinler11,12 bitki lösin yönünden zengin tekrar reseptör benzeri kinaz (LRR-RLK) ailesine ait 3 (PRK3) . Yapısı ve fonksiyonu, bu ailenin diğer bitki salgılanan proteinler yapısal ve biyokimyasal karakterizasyonu kolaylaştırmak için bitki reseptör protein, de eğitim için baculovirus-böcek hücre ifade sistem için değiştirildi protein verim kalitesi ve üretim geliştirmek. Ekstrasellüler etki alanları TDR ve PRK3 başarıyla baculovirus-böcek hücre ifade sisteminde iki değiştirilmiş ifade vektörel çizimler kullanarak ifade edilmiştir. Her iki ekstrasellüler etki alanı TDR ve PRK3 proteinlerin kristalize. Ya bir GP67 ya da hemolin sinyal dizisi düzenleyici ve birden çok klonlama arasında dahil ederek ifade ve arıtma rekombinant salgılanan bitki proteinleri iki değiştirilmiş baculovirus ifade vektörel çizimler ile büyük miktarda Bu makale raporları siteleri.

<table><tbody><tr><td>Incubator shaker</td><td>VWR</td><td>Model Excella E25</td><td>27 &lt;sup&gt;o&lt;/sup&gt;C</td></tr><tr><td>Incubator</td><td>VWR</td><td>Model 2005</td><td>27 &lt;sup&gt;o&lt;/sup&gt;C</td></tr><tr><td>Centrifuge</td><td>BECKMAN</td><td>Model J-6</td><td>with a swing bucket rotor</td></tr><tr><td>Herculase II Fusion DNA Polymerase</td><td>Agilent</td><td>600677-51</td><td>For PCR amplification of DNA</td></tr><tr><td>Thermal Cycler</td><td>BIO-RAD</td><td>Model C1000 Touch</td><td>For PCR amplification of DNA</td></tr><tr><td>Incubator shaker</td><td>New Brunswick Scientific</td><td>Model I 24</td><td>For growing baceria culture</td></tr><tr><td>Customer DNA synthesis</td><td>GENSCRIPT</td><td></td><td></td></tr><tr><td>BamHI (HF)</td><td>New England Biolabs</td><td>R3136S</td><td>Restriction Endonuclease</td></tr><tr><td>BglII</td><td>New England Biolabs</td><td>R0144S</td><td>Restriction Endonuclease</td></tr><tr><td>NotI (HF)</td><td>New England Biolabs</td><td>R3189S</td><td>Restriction Endonuclease</td></tr><tr><td>XhoI</td><td>New England Biolabs</td><td>R0146S</td><td>Restriction Endonuclease</td></tr><tr><td>T4 DNA ligase</td><td>New England Biolabs</td><td>M0202T</td><td>DNA ligation</td></tr><tr><td>QIAquick Gel Extraction Kit</td><td>Qiagen</td><td>28704</td><td>DNA purification from Agorase gel</td></tr><tr><td>QIAprep Spin Miniprep Kit</td><td>Qiagen</td><td>27104</td><td>Plasmid DNA purification from bacteria culture</td></tr><tr><td>Agarose</td><td>Thermo Fisher Scientific</td><td>15510-019</td><td>For DNA gel electropherosis</td></tr><tr><td>MAX Efficiency DH5&amp;alpha; competen cell</td><td>Invitrogen</td><td>18-258-012</td><td>For transformation of DNA ligation mixture</td></tr><tr><td>Lennox L LB Broth</td><td>Research Product International Corp.</td><td>L24066-5000.0</td><td>For making bacteria culture</td></tr><tr><td>Ampicillin sodium salt</td><td>Thermo Fisher Scientific</td><td>11593-019</td><td>Antibiotics</td></tr><tr><td>Kanamycin Sulfate</td><td>Thermo Fisher Scientific</td><td>15160-054</td><td>Antibiotics</td></tr><tr><td>Tetracycline</td><td>Thermo Fisher Scientific</td><td>64-75-5</td><td>Antibiotics</td></tr><tr><td>Gentamicin</td><td>Thermo Fisher Scientific</td><td>15710-064</td><td>Antibiotics</td></tr><tr><td>MAX Efficiency DH10Bac competent cells</td><td>Thermo Fisher Scientific</td><td>10361-012</td><td>For making bacmid DNA</td></tr><tr><td>S.O.C. Medium</td><td>Thermo Fisher Scientific</td><td>15544-034</td><td>For DNA transformation</td></tr><tr><td>CellFECTIN II Reagent</td><td>Thermo Fisher Scientific</td><td>10362-101</td><td>Insect cell transfection reagent</td></tr><tr><td>Bac-to-Bac Expression System</td><td>Thermo Fisher Scientific</td><td>10359-016</td><td>Baculovirus-insect cells expression kit</td></tr><tr><td>Bluo-gal</td><td>Thermo Fisher Scientific</td><td>15519-028</td><td>For isolation of recominant Bacmid DNA</td></tr><tr><td>IPTG</td><td>Thermo Fisher Scientific</td><td>15529-019</td><td>For isolation of recominant Bacmid DNA</td></tr><tr><td>pFastBac1</td><td>Thermo Fisher Scientific</td><td>10360014</td><td>Baculorirus expression vector</td></tr><tr><td>Sf9 cells</td><td>Thermo Fisher Scientific</td><td>11496015</td><td>Sf9 monolayer cells</td></tr><tr><td>Hi5 cells</td><td>Thermo Fisher Scientific</td><td>B85502</td><td>High Five insect cells</td></tr><tr><td>Grace&amp;rsquo;s insect medium, unsupplemented</td><td>Thermo Fisher Scientific</td><td>11595030</td><td>Sf9 cell transfection minimum medium</td></tr><tr><td>Grace&amp;rsquo;s insect medium, supplemented</td><td>Thermo Fisher Scientific</td><td>11605102</td><td>Sf9 monolayer cell culture complete medium</td></tr><tr><td>Sf-900 II SFM</td><td>Thermo Fisher Scientific</td><td>10902104</td><td>Sf9 suspension cell culture medium without FBS</td></tr><tr><td>Express Five SFM</td><td>Thermo Fisher Scientific</td><td>10486025</td><td>Hi5 cell culture medium</td></tr><tr><td>Penicillin-Streptomycin</td><td>Thermo Fisher Scientific</td><td>15140122</td><td>100 ml (10,000 I.U./ml)</td></tr><tr><td>L-Glutamine (200 mM)</td><td>Thermo Fisher Scientific</td><td>25030081</td><td>100 ml</td></tr><tr><td>FBS Certified</td><td>Thermo Fisher Scientific</td><td>16000-044</td><td>500 ml</td></tr><tr><td>6-well plates</td><td>Thermo Fisher Scientific</td><td>08-772-1B</td><td>Flat-bottom</td></tr><tr><td>150 mm plates</td><td>Thermo Fisher Scientific</td><td>353025</td><td>100/case</td></tr><tr><td>1.5 ml Microcentrifuge Tubes</td><td>USA Scientific</td><td>1415-2500</td><td>500 tubes/bag</td></tr><tr><td>15 ml conical screw cap centrifuge tubes</td><td>USA Scientific</td><td>1475-0511</td><td>25 tubes/bag</td></tr><tr><td>50 ml conical screw cap centrifuge tubes</td><td>USA Scientific</td><td>1500-1211</td><td>25 tubes/bag</td></tr><tr><td>Ni-NTA Superflow</td><td>Qiagen</td><td>30430</td><td>NiNTA resin</td></tr><tr><td>pH-indicator strips</td><td>EMD Millipore Corporation</td><td>1.09535.0001</td><td>pH 0 - 14</td></tr></tbody></table>

modifying baculovirus expression vectors to produce secreted plant proteins in insect cells

Rekombinant salgı ökaryotik proteinler yapısal ve biyokimyasal araştırmalar ifade etmek bilim adamları için bir mücadele vardı. Böcek hücre baculovirus-aracılı ifade sistem rekombinant ökaryotik salgı proteinler bazı translasyonel modifikasyonlar ile ifade etmek için kullanılan sistemlerinden biridir. Salgı proteinler için protein glikozilasyon, disülfür bağları oluşumu ve diğer translasyonel modifikasyonlar salgı yollar aracılığıyla yönlendirilmesi gerekir. Varolan böcek hücre ifade salgı bitki proteinlerin artırmak için bir baculovirus ifade vektör ya bir GP67 eklenmesi ya da bir hemolin sinyal peptid sırası organizatörü ve çoklu klonlama siteleri arasında tarafından değiştirilir. Bu yeni tasarlanmış değiştirilmiş vektör sistemi başarıyla Arabidopsis thalianaçözünür rekombinant salgılanan bitki reseptör proteinler yüksek bir verim üretti. İki ifade bitki proteinleri, Arabidopsis TDR ve PRK3 plazma membran reseptörleri, ekstrasellüler etki x-ışını crystallographic çalışmalar için kristalize. Değiştirilmiş vektör sistemi salgı rekombinant proteinler de hayvan krallığının bir ifade için kullanılabilir gelişmiş bir araçtır.

Şekil 1' de gösterildiği gibi iki değiştirilmiş pFastBac1 baculovirus ifade vektörel çizimler salgılanan proteinler ile GP67 ya da hemolin sinyal sıra hedef gen içsel sinyal sırasını değiştirmek için ifade etmek için kullanılmıştır. Viral GP67 ve böcek hemolin genler hücrelerde yüksek salgı ifade düzeyleri olmasını gösterdi. Füzyon protein ile ikisinden biri bu iki sinyal sıralarının salgı ifade düzeyleri büyük ölçüde ...

Watch this Scientific Journal Video about Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells at JoVE.com

Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells

Bitki proteinleri böcek hücrelerinde salgılanan Baculovirus ifade vektörel çizimler oluşturmak için değiştirme

Burada, bitki salgılanan proteinler için protein kristalizasyon büyük miktarlarda üretmek için böcek hücre ve baculovirus protein ifade sistemi kullanan iletişim kurallarını mevcut. Bir baculovirus ifade vektör GP67 ya da böcek hemolin sinyal peptid bitki protein salgılanması ifade böcek hücrelerinde ile değiştirildi.

It has been a challenge for scientists to express recombinant secretory eukaryotic proteins for structural and biochemical studies. The ...

modifying-baculovirus-expression-vectors-to-produce-secreted-plant

Universidad de Cartagena UDEC

Research

JoVE Journal

Biochemistry

11.4K Görüntüleme.  North Carolina State University. Burada, bitki salgılanan proteinler için protein kristalizasyon büyük miktarlarda üretmek için böcek hücre ve baculovirus protein ifade sistemi kullanan iletişim kurallarını mevcut. Bir baculovirus ifade vektör GP67 ya da böcek hemolin sinyal peptid bitki protein salgılanması ifade böcek hücrelerinde ile değiştirildi.

Video: Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells

Transient Expression of Foreign Genes in Insect Cells (sf9) for Protein Functional Assay

The transient gene expression system is one of the most important technologies for performing protein functional analysis in the baculovirus in vitro cell culture system. This system was developed to express foreign genes under the control of the baculoviral promoter in transient expression plasmids. Furthermore, this system can be applied to a functional assay of either the baculovirus itself or foreign proteins. The most widely and commercially available transient gene expression system is developed based on the immediate-early gene (IE) promoter of Orgyia pseudotsugata multicapsid nucleopolyhedrovirus (OpMNPV). However, a low expression level of foreign genes in insect cells was observed. Therefore, a transient gene expression system was constructed for improving protein expression. In this system, recombinant plasmids were constructed to contain the target sequence under the control of the Drosophila heat shock 70 (Dhsp70) promoter. This protocol presents the application of this heat shock-based pDHsp/V5-His (V5 epitope with 6 histidine)/Spodoptera frugiperda cell (sf9 cell) system; this system is available not only for gene expression but also for evaluating the anti-apoptotic activity of candidate proteins in insect cells. Furthermore, this system can be either transfected with one recombinant plasmid or co-transfected two potentially functionally antagonistic recombinant plasmids in insect cells. The protocol demonstrates the efficiency of this system and provides a practical case of this technique.

Transient Expression of Foreign Genes in Insect Cells sf9 for Protein Functional Assay

This protocol describes a heat shock-induced protein expression system (pDHsp/V5-His/sf9 cell system), which can be used for either expressing foreign proteins or evaluating the anti-apoptotic activity of potential foreign proteins and their truncated amino acids in insect cells.

Geçici ifade, yabancı genlerin Protein fonksiyonel tahlil için böcek hücrelerindeki (sf9)

The transient gene expression system is one of the most important technologies for performing protein functional analysis in the baculovirus in vitro cell ...

Genetik

Production and Purification of Baculovirus for Gene Therapy Application

Baculovirus has traditionally been used for the production of recombinant protein and vaccine. However, more recently, baculovirus is emerging as a promising vector for gene therapy application. Here, baculovirus is produced by transient transfection of the baculovirus plasmid DNA (bacmid) in an adherent culture of Sf9 cells. Baculovirus is subsequently expanded in Sf9 cells in a serum-free suspension culture until the desired volume is obtained. It is then purified from the culture supernatant using heparin affinity chromatography. Virus supernatant is loaded onto the heparin column which binds baculovirus particles in the supernatant due to the affinity of heparin for baculovirus envelop glycoprotein. The column is washed with a buffer to remove contaminants and baculovirus is eluted from the column with a high-salt buffer. The eluate is diluted to an isotonic salt concentration and baculovirus particles are further concentrated using ultracentrifugation. Using this method, baculovirus can be concentrated up to 500-fold with a 25% recovery of infectious particles. Although the protocol described here demonstrates the production and purification of the baculovirus from cultures up to 1 L, the method can be scaled-up in a closed-system suspension culture to produce a clinical-grade vector for gene therapy application.

In this protocol, baculovirus is produced by transient transfection of baculovirus plasmid into Sf9 cells and amplified in a serum-free suspension culture. The supernatant is purified by heparin affinity chromatography and further concentrated by ultracentrifugation. This protocol is useful for the production and purification of baculovirus for gene therapy application.

Üretim ve Baculovirus arınma gen tedavisi uygulaması için

Baculovirus has traditionally been used for the production of recombinant protein and vaccine. However, more recently, baculovirus is emerging as a ...

Expression and Purification of Mammalian Bestrophin Ion Channels

The human genome encodes four bestrophin paralogs, namely BEST1, BEST2, BEST3, and BEST4. BEST1, encoded by the BEST1 gene, is a Ca2+-activated Cl- channel (CaCC) predominantly expressed in retinal pigment epithelium (RPE). The physiological and pathological significance of BEST1 is highlighted by the fact that over 200 distinct mutations in the BEST1 gene have been genetically linked to a spectrum of at least five retinal degenerative disorders, such as Best vitelliform macular dystrophy (Best disease). Therefore, understanding the biophysics of bestrophin channels at the single-molecule level holds tremendous significance. However, obtaining purified mammalian ion channels is often a challenging task. Here, we report a protocol for the expression of mammalian bestrophin proteins with the BacMam baculovirus gene transfer system and their purification by affinity and size-exclusion chromatography. The purified proteins have the potential to be utilized in subsequent functional and structural analyses, such as electrophysiological recording in lipid bilayers and crystallography. Importantly, this pipeline can be adapted to study the functions and structures of other ion channels.

The purification of ion channels is often challenging, but once achieved, it can potentially allow in vitro investigations of the functions and structures of the channels. Here, we describe the stepwise procedures for the expression and purification of mammalian bestrophin proteins, a family of Ca2+-activated Cl- channels.

İfade ve arıtma memeli Bestrophin iyon kanalları

The human genome encodes four bestrophin paralogs, namely BEST1, BEST2, BEST3, and BEST4. BEST1, encoded by the BEST1 gene, is a Ca2+-activated Cl- ...

Biyokimya

Expression of Functional Recombinant Hemagglutinin and Neuraminidase Proteins from the Novel H7N9 Influenza Virus Using the Baculovirus Expression System

The baculovirus expression system is a powerful tool for expression of recombinant proteins. Here we use it to produce correctly folded and glycosylated versions of the influenza A virus surface glycoproteins - the hemagglutinin (HA) and the neuraminidase (NA). As an example, we chose the HA and NA proteins expressed by the novel H7N9 virus that recently emerged in China. However the protocol can be easily adapted for HA and NA proteins expressed by any other influenza A and B virus strains. Recombinant HA (rHA) and NA (rNA) proteins are important reagents for immunological assays such as ELISPOT and ELISA, and are also in wide use for vaccine standardization, antibody discovery, isolation and characterization. Furthermore, recombinant NA molecules can be used to screen for small molecule inhibitors and are useful for characterization of the enzymatic function of the NA, as well as its sensitivity to antivirals. Recombinant HA proteins are also being tested as experimental vaccines in animal models, and a vaccine based on recombinant HA was recently licensed by the FDA for use in humans. The method we describe here to produce these molecules is straight forward and can facilitate research in influenza laboratories, since it allows for production of large amounts of proteins fast and at a low cost. Although here we focus on influenza virus surface glycoproteins, this method can also be used to produce other viral and cellular surface proteins.

Here we describe a way to express correctly folded and functional influenza virus surface antigens derived from the novel Chinese H7N9 virus in insect cells. The technique can be adapted to express ectodomains of any viral or cellular surface proteins.

Bakülovirüs İfade Sistemi ile Novel H7N9 influenza virüs hemaglutinin Fonksiyonel rekombinant ve Neuraminidase Proteinlerin İfadesi

The baculovirus expression system is a powerful tool for expression of  recombinant proteins. Here we use it to produce correctly folded and  glycosylated ...

İmmünoloji ve Enfeksiyon

Production of Recombinant PRMT Proteins using the Baculovirus Expression Vector System

Protein arginine methyltransferases (PRMTs) methylate arginine residues on a wide variety of proteins that play roles in numerous cellular processes. PRMTs can either mono- or dimethylate arginine guanidino groups symmetrically or asymmetrically. The enzymology of these proteins is a complex and intensely investigated area that requires milligram quantities of high-quality recombinant protein. The baculovirus expression vector system (BEVS) employing Autographa californica multiple nucleopolyhedrovirus (AcMNPV) and Spodoptera frugiperda 9 (Sf9) insect cells has been used for expression screening and production of many PRMTs, including PRMT 1, 2, and 4 through 9. To simultaneously screen for the expression of multiple constructs of these proteins, including domains and truncated fragments as well as the full-length proteins, we have applied scalable methods utilizing adjustable and programmable multichannel pipettes, combined with 24- and 96-well plates and blocks. Overall, these method adjustments enabled a large-scale generation of bacmid DNA, recombinant viruses, and protein expression screening. Using culture vessels with a high-fill volume of Sf9 cell suspension helped to overcome space limitations in the production pipeline for single batch large-scale protein production. Here, we describe detailed protocols for the efficient and cost-effective expression of functional PRMTs for biochemical, biophysical, and structural studies.

The baculovirus expression vector system (BEVS) is a robust platform for expression screening and production of protein arginine methyltransferases (PRMTs) to be used for biochemical, biophysical, and structural studies. Milligram quantities of material can be produced for the majority of PRMTs and other proteins of interest requiring a eukaryotic expression platform.

Baculovirüs Ekspresyon Vektör Sistemi Kullanılarak Rekombinant PRMT Proteinlerinin Üretimi

Protein arginine methyltransferases (PRMTs) methylate arginine residues on a wide variety of proteins that play roles in numerous cellular processes. ...

The MultiBac Protein Complex Production Platform at the EMBL

Proteomics research revealed the impressive complexity of eukaryotic proteomes in unprecedented detail. It is now a commonly accepted notion that proteins in cells mostly exist not as isolated entities but exert their biological activity in association with many other proteins, in humans ten or more, forming assembly lines in the cell for most if not all vital functions.1,2 Knowledge of the function and architecture of these multiprotein assemblies requires their provision in superior quality and sufficient quantity for detailed analysis. The paucity of many protein complexes in cells, in particular in eukaryotes, prohibits their extraction from native sources, and necessitates recombinant production. The baculovirus expression vector system (BEVS) has proven to be particularly useful for producing eukaryotic proteins, the activity of which often relies on post-translational processing that other commonly used expression systems often cannot support.3 BEVS use a recombinant baculovirus into which the gene of interest was inserted to infect insect cell cultures which in turn produce the protein of choice. MultiBac is a BEVS that has been particularly tailored for the production of eukaryotic protein complexes that contain many subunits.4 A vital prerequisite for efficient production of proteins and their complexes are robust protocols for all steps involved in an expression experiment that ideally can be implemented as standard operating procedures (SOPs) and followed also by non-specialist users with comparative ease. The MultiBac platform at the European Molecular Biology Laboratory (EMBL) uses SOPs for all steps involved in a multiprotein complex expression experiment, starting from insertion of the genes into an engineered baculoviral genome optimized for heterologous protein production properties to small-scale analysis of the protein specimens produced.5-8 The platform is installed in an open-access mode at EMBL Grenoble and has supported many scientists from academia and industry to accelerate protein complex research projects.

Protein complexes catalyze key cellular functions. Detailed functional and structural characterization of many essential complexes requires recombinant production. MultiBac is a baculovirus/insect cell system particularly tailored for expressing eukaryotic proteins and their complexes. MultiBac was implemented as an open-access platform, and standard operating procedures developed to maximize its utility.

EMBL de MultiBac Protein Complex Üretim Platformu

Proteomics  research revealed the impressive complexity of eukaryotic proteomes in  unprecedented detail. It is now a commonly accepted notion that ...

Biyoloji

Efficient Agroinfiltration of Plants for High-level Transient Expression of Recombinant Proteins

Mammalian cell culture is the major platform for commercial production of human vaccines and therapeutic proteins. However, it cannot meet the increasing worldwide demand for pharmaceuticals due to its limited scalability and high cost. Plants have shown to be one of the most promising alternative pharmaceutical production platforms that are robust, scalable, low-cost and safe. The recent development of virus-based vectors has allowed rapid and high-level transient expression of recombinant proteins in plants. To further optimize the utility of the transient expression system, we demonstrate a simple, efficient and scalable methodology to introduce target-gene containing Agrobacterium into plant tissue in this study. Our results indicate that agroinfiltration with both syringe and vacuum methods have resulted in the efficient introduction of Agrobacterium into leaves and robust production of two fluorescent proteins; GFP and DsRed. Furthermore, we demonstrate the unique advantages offered by both methods. Syringe infiltration is simple and does not need expensive equipment. It also allows the flexibility to either infiltrate the entire leave with one target gene, or to introduce genes of multiple targets on one leaf. Thus, it can be used for laboratory scale expression of recombinant proteins as well as for comparing different proteins or vectors for yield or expression kinetics. The simplicity of syringe infiltration also suggests its utility in high school and college education for the subject of biotechnology. In contrast, vacuum infiltration is more robust and can be scaled-up for commercial manufacture of pharmaceutical proteins. It also offers the advantage of being able to agroinfiltrate plant species that are not amenable for syringe infiltration such as lettuce and Arabidopsis. Overall, the combination of syringe and vacuum agroinfiltration provides researchers and educators a simple, efficient, and robust methodology for transient protein expression. It will greatly facilitate the development of pharmaceutical proteins and promote science education.

Plants offer a novel system for the production of pharmaceutical proteins on a commercial scale that is more scalable, cost-efficient and safe than current expression paradigms. In this study, we report a simple and convenient, yet scalable approach to introduce target-gene containing Agrobacterium tumefaciens into plants for protein transient expression.

Rekombinant Proteinlerin Yüksek-düzey Geçici İfade için Bitkiler Verimli Agroinfiltration

Mammalian cell culture is the major platform for commercial production of human vaccines and therapeutic proteins. However, it cannot meet the increasing ...

Optimization and Utilization of Agrobacterium-mediated Transient Protein Production in Nicotiana

Agrobacterium-mediated transient protein production in plants is a promising approach to produce vaccine antigens and therapeutic proteins within a short period of time. However, this technology is only just beginning to be applied to large-scale production as many technological obstacles to scale up are now being overcome. Here, we demonstrate a simple and reproducible method for industrial-scale transient protein production based on vacuum infiltration of Nicotiana plants with Agrobacteria carrying launch vectors. Optimization of Agrobacterium cultivation in AB medium allows direct dilution of the bacterial culture in Milli-Q water, simplifying the infiltration process. Among three tested species of Nicotiana, N. excelsiana (N. benthamiana &#215; N. excelsior) was selected as the most promising host due to the ease of infiltration, high level of reporter protein production, and about two-fold higher biomass production under controlled environmental conditions. Induction of Agrobacterium harboring pBID4-GFP (Tobacco mosaic virus-based) using chemicals such as acetosyringone and monosaccharide had no effect on the protein production level. Infiltrating plant under 50 to 100 mbar for 30 or 60 sec resulted in about 95% infiltration of plant leaf tissues. Infiltration with Agrobacterium laboratory strain GV3101 showed the highest protein production compared to Agrobacteria laboratory strains LBA4404 and C58C1 and wild-type Agrobacteria strains at6, at10, at77 and A4. Co-expression of a viral RNA silencing suppressor, p23 or p19, in N. benthamiana resulted in earlier accumulation and increased production (15-25%) of target protein (influenza virus hemagglutinin).

Optimization and Utilization of Agrobacterium-mediated Transient Protein Production in Nicotiana

Transient protein production in Nicotiana plants based on vacuum infiltration with Agrobacteria carrying launch vectors (Tobacco mosaic virus-based) is a rapid and economic approach to produce vaccine antigens and therapeutic proteins. We simplified the procedure and improved target accumulation by optimizing conditions of bacteria cultivation, selecting host species, and co-introducing RNA silencing suppressors.

Optimizasyon ve Kullanımı<em&gt; Agrobacterium</emIn&gt; aracılı Geçici Protein Üretimi<em&gt; Nicotiana</em

Agrobacterium-mediated transient protein production in plants is a promising approach to produce vaccine antigens and therapeutic proteins within a short ...

Efficient Production and Purification of Recombinant Murine Kindlin-3 from Insect Cells for Biophysical Studies

Kindlins are essential coactivators, with talin, of the cell surface receptors&#160;integrins and also participate in integrin outside-in signalling, and the control of gene transcription in the cell nucleus. The kindlins are ~75 kDa multidomain proteins and bind to an NPxY motif and upstream T/S cluster of the integrin &#946;-subunit cytoplasmic tail. The hematopoietically-important kindlin isoform, kindlin-3, is critical for platelet aggregation during thrombus formation, leukocyte rolling in response to infection and inflammation and osteoclast podocyte formation in bone resorption. Kindlin-3&#39;s role in these processes has resulted in extensive cellular and physiological studies. However, there is a need for an efficient method of acquiring high quality milligram quantities of the protein for further studies. We have developed a protocol, here described, for the efficient expression and purification of recombinant murine kindlin-3 by use of a baculovirus-driven expression system in Sf9 cells yielding sufficient amounts of high purity full-length protein to allow its biophysical characterization. The same approach could be taken in the study of the other mammalian kindlin isoforms.

Kindlins are fundamental to cell adhesion through integrins but studies of them have been hampered by the difficulty encountered in expressing them recombinantly in bacterial hosts. We describe here methods for their efficient production in baculovirus-infected insect cells.

Verimli Üretimi ve Saflaştırılması Rekombinant murin kindlin-3 Biophysical Çalışmaları Böcek hücrelerinden

Kindlins are essential coactivators, with talin, of the cell surface receptors&#160;integrins and also participate in integrin outside-in signalling, and ...

A Comparative Analysis of Recombinant Protein Expression in Different Biofactories: Bacteria, Insect Cells and Plant Systems

Plant-based systems are considered a valuable platform for the production of recombinant proteins as a result of their well-documented potential for the flexible, low-cost production of high-quality, bioactive products.
In this study, we compared the expression of a target human recombinant protein in traditional fermenter-based cell cultures (bacterial and insect) with plant-based expression systems, both transient and stable.
For each platform, we described the set-up, optimization and length of the production process, the final product quality and the yields and we evaluated provisional production costs, specific for the selected target recombinant protein.
Overall, our results indicate that bacteria are unsuitable for the production of the target protein due to its accumulation within insoluble inclusion bodies. On the other hand, plant-based systems are versatile platforms that allow the production of the selected protein at lower-costs than Baculovirus/insect cell system. In particular, stable transgenic lines displayed the highest-yield of the final product and transient expressing plants the fastest process development. However, not all recombinant proteins may benefit from plant-based systems but the best production platform should be determined empirically with a case-by-case approach, as described here.

In this study the expression of a target human recombinant protein in different production platforms was compared. We focused on traditional fermenter-based cultures and on plants, describing the set-up of each system and highlighting, on the basis of the reported results, the inherent limits and advantages for each platform.

Bakteriler, Böcek Hücreleri ve Bitki Sistemleri: Rekombinant Protein Farklı Biofactories İfade Karşılaştırmalı Analizi

Plant-based systems are considered a valuable platform for the production of recombinant proteins as a result of their well-documented potential for the ...