Bu eser NIH/NHGRI R00 HG006922 ve NIH/NHGRI R01 HG008974 J.G. için ve avcı Kanser Enstitüsü tarafından desteklenmiştir. J.B.C. genetik T32GM007464 NIH eğitim programında tarafından desteklenmiştir.

<ol>
	<li>Consortium, E. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+integrated+encyclopedia+of+DNA+elements+in+the+human+genome.">An integrated encyclopedia of DNA elements in the human genome.</a> Nature. 489 (7414), 57-74 (2012).</li><li>Roadmap Epigenomics, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+analysis+of+111+reference+human+epigenomes.">Integrative analysis of 111 reference human epigenomes.</a> Nature. 518 (7539), 317-330 (2015).</li><li>Andersson, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+atlas+of+active+enhancers+across+human+cell+types+and+tissues.">An atlas of active enhancers across human cell types and tissues.</a> Nature. 507 (7493), 455-461 (2014).</li><li>Perry, M. W., Boettiger, A. N., Bothma, J. P., Levine, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Shadow+enhancers+foster+robustness+of+Drosophila+gastrulation.">Shadow enhancers foster robustness of Drosophila gastrulation.</a> Curr Biol. 20 (17), 1562-1567 (2010).</li><li>Lam, D. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Partially+redundant+enhancers+cooperatively+maintain+Mammalian+pomc+expression+above+a+critical+functional+threshold.">Partially redundant enhancers cooperatively maintain Mammalian pomc expression above a critical functional threshold.</a> PLoS Genet. 11 (2), e1004935 (2015).</li><li>Patwardhan, R. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massively+parallel+functional+dissection+of+mammalian+enhancers+in+vivo.">Massively parallel functional dissection of mammalian enhancers in vivo.</a> Nat Biotechnol. 30 (3), 265-270 (2012).</li><li>Savic, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Promoter-distal+RNA+polymerase+II+binding+discriminates+active+from+inactive+CCAAT/+enhancer-binding+protein+beta+binding+sites.">Promoter-distal RNA polymerase II binding discriminates active from inactive CCAAT/ enhancer-binding protein beta binding sites.</a> Genome Res. 25 (12), 1791-1800 (2015).</li><li>Mali, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-guided+human+genome+engineering+via+Cas9.">RNA-guided human genome engineering via Cas9.</a> Science. 339 (6121), 823-826 (2013).</li><li>Cheng, A. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplexed+activation+of+endogenous+genes+by+CRISPR-on,+an+RNA-guided+transcriptional+activator+system.">Multiplexed activation of endogenous genes by CRISPR-on, an RNA-guided transcriptional activator system.</a> Cell Res. 23 (10), 1163-1171 (2013).</li><li>Hilton, I. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenome+editing+by+a+CRISPR-Cas9-based+acetyltransferase+activates+genes+from+promoters+and+enhancers.">Epigenome editing by a CRISPR-Cas9-based acetyltransferase activates genes from promoters and enhancers.</a> Nat Biotechnol. , (2015).</li><li>Kearns, N. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+annotation+of+native+enhancers+with+a+Cas9-histone+demethylase+fusion.">Functional annotation of native enhancers with a Cas9-histone demethylase fusion.</a> Nat Methods. 12 (5), 401-403 (2015).</li><li>Thakore, P. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+specific+epigenome+editing+by+CRISPR-Cas9+repressors+for+silencing+of+distal+regulatory+elements.">Highly specific epigenome editing by CRISPR-Cas9 repressors for silencing of distal regulatory elements.</a> Nat Methods. 12 (12), 1143-1149 (2015).</li><li>Groner, A. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=KRAB-zinc+finger+proteins+and+KAP1+can+mediate+long-range+transcriptional+repression+through+heterochromatin+spreading.">KRAB-zinc finger proteins and KAP1 can mediate long-range transcriptional repression through heterochromatin spreading.</a> PLoS Genet. 6 (3), e1000869 (2010).</li><li>Qi, L. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Repurposing+CRISPR+as+an+RNA-guided+platform+for+sequence-specific+control+of+gene+expression.">Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression.</a> Cell. 152 (5), 1173-1183 (2013).</li><li>Fulco, C. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+mapping+of+functional+enhancer-promoter+connections+with+CRISPR+interference.">Systematic mapping of functional enhancer-promoter connections with CRISPR interference.</a> Science. 354 (6313), 769-773 (2016).</li><li>Joo, J. Y., Schaukowitch, K., Farbiak, L., Kilaru, G., Kim, T. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stimulus-specific+combinatorial+functionality+of+neuronal+c-fos+enhancers.">Stimulus-specific combinatorial functionality of neuronal c-fos enhancers.</a> Nat Neurosci. 19 (1), 75-83 (2016).</li><li>Xie, S., Duan, J., Li, B., Zhou, P., Hon, G. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplexed+Engineering+and+Analysis+of+Combinatorial+Enhancer+Activity+in+Single+Cells.">Multiplexed Engineering and Analysis of Combinatorial Enhancer Activity in Single Cells.</a> Mol Cell. 66 (2), 285-299 (2017).</li><li>Carleton, J. B., Berrett, K. C., Gertz, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+Enhancer+Interference+Reveals+Collaborative+Control+of+Gene+Regulation+by+Estrogen+Receptor+alpha-Bound+Enhancers.">Multiplex Enhancer Interference Reveals Collaborative Control of Gene Regulation by Estrogen Receptor alpha-Bound Enhancers.</a> Cell Syst. 5 (4), 333-344 (2017).</li><li>Gilbert, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-mediated+modular+RNA-guided+regulation+of+transcription+in+eukaryotes.">CRISPR-mediated modular RNA-guided regulation of transcription in eukaryotes.</a> Cell. 154 (2), 442-451 (2013).</li><li>Ayer, D. E., Laherty, C. D., Lawrence, Q. A., Armstrong, A. P., Eisenman, R. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mad+proteins+contain+a+dominant+transcription+repression+domain.">Mad proteins contain a dominant transcription repression domain.</a> Mol Cell Biol. 16 (10), 5772-5781 (1996).</li><li>Alland, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+for+N-CoR+and+histone+deacetylase+in+Sin3-mediated+transcriptional+repression.">Role for N-CoR and histone deacetylase in Sin3-mediated transcriptional repression.</a> Nature. 387 (6628), 49-55 (1997).</li><li>Konermann, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optical+control+of+mammalian+endogenous+transcription+and+epigenetic+states.">Optical control of mammalian endogenous transcription and epigenetic states.</a> Nature. 500 (7463), 472-476 (2013).</li><li>Rennoll, S. A., Scott, S. A., Yochum, G. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+repression+of+AXIN2+and+MYC+gene+expression+using+designer+TALEs.">Targeted repression of AXIN2 and MYC gene expression using designer TALEs.</a> Biochem Biophys Res Commun. 446 (4), 1120-1125 (2014).</li><li>Stampfel, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional+regulators+form+diverse+groups+with+context-dependent+regulatory+functions.">Transcriptional regulators form diverse groups with context-dependent regulatory functions.</a> Nature. 528 (7580), 147-151 (2015).</li><li>Perez-Pinera, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-guided+gene+activation+by+CRISPR-Cas9-based+transcription+factors.">RNA-guided gene activation by CRISPR-Cas9-based transcription factors.</a> Nat Methods. 10 (10), 973-976 (2013).</li><li>Heigwer, F., Kerr, G., Boutros, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=E-CRISP:+fast+CRISPR+target+site+identification.">E-CRISP: fast CRISPR target site identification.</a> Nat Methods. 11 (2), 122-123 (2014).</li><li>Parsi, K. M., Hennessy, E., Kearns, N., Maehr, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+an+Inducible+CRISPR-dCas9-KRAB+Effector+System+to+Dissect+Transcriptional+Regulation+in+Human+Embryonic+Stem+Cells.">Using an Inducible CRISPR-dCas9-KRAB Effector System to Dissect Transcriptional Regulation in Human Embryonic Stem Cells.</a> Methods Mol Biol. , 221-233 (2017).</li><li>Romanienko, P. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Vector+with+a+Single+Promoter+for+In+Vitro+Transcription+and+Mammalian+Cell+Expression+of+CRISPR+gRNAs.">A Vector with a Single Promoter for In Vitro Transcription and Mammalian Cell Expression of CRISPR gRNAs.</a> PLoS One. 11 (2), e0148362 (2016).</li><li>Smith, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+RNAi+and+CRISPR+technologies+by+large-scale+gene+expression+profiling+in+the+Connectivity+Map.">Evaluation of RNAi and CRISPR technologies by large-scale gene expression profiling in the Connectivity Map.</a> PLoS Biol. 15 (11), e2003213 (2017).</li><li>Liu, X. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Editing+DNA+Methylation+in+the+Mammalian+Genome.">Editing DNA Methylation in the Mammalian Genome.</a> Cell. 167 (1), 233-247 (2016).</li><li>O'Geen, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=dCas9-based+epigenome+editing+suggests+acquisition+of+histone+methylation+is+not+sufficient+for+target+gene+repression.">dCas9-based epigenome editing suggests acquisition of histone methylation is not sufficient for target gene repression.</a> Nucleic Acids Res. 45 (17), 9901-9916 (2017).</li><li>Amabile, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inheritable+Silencing+of+Endogenous+Genes+by+Hit-and-Run+Targeted+Epigenetic+Editing.">Inheritable Silencing of Endogenous Genes by Hit-and-Run Targeted Epigenetic Editing.</a> Cell. 167 (1), 219-232 (2016).</li></ol>

Yazarlar ifşa gerek yok.

Bu iletişim kuralı fiziksel olarak DNA dizisi değiştirmeden artırıcı fonksiyon için endojen genomik locus dissekan için basit ve esnek bir yöntem açıklanır. Benzer olsa da kavram dCas9 KRAB27kullanarak daha önce yayımlanmış CRISPR girişim iletişim kuralları, Enhancer-i 3 ana şekilde bu iletişim kurallarından farklıdır. İlk olarak, Enhancer-i artırıcı devre dışı bırakma ulaşmak için MAD120 SIN3A etkileşen etki alanı kullanır. Artırıcı devre dışı bırakma HDAC inhibitörleri, devre dışı bırakma birincil mekanizma HDAC bağımlı olduğunu düşündüren kullanarak kurtarıldı. CRISPR dCas9-KRAB müdahale, Enhancer-i H3K9me3 birikimi yol açmaz. Gerçeğini Enhancer-i RNA'ların, transfection 3 gün hasat hücreleri ile göndermek Kılavuzu geçici giriş üzerinde dayanır nedeniyle muhtemeldir. CRISPR müdahale, 7 gün mesaj iletim12, H3K9me3 bir artış görülmektedir. Son olarak, birden çok siteyi aynı anda hedef ve hedefleme etkinliğini izlemek için bir strateji Enhancer-i Protokolü sağlar. Mozaik-seq17, dCas9-KRAB aynı anda birden fazla arttırıcılar hedeflemek için kullanılır ama bu tekniği ifade değişiklikleri tanımlamak için tek hücreli RNA sıralama dayanıyor ve (gibi östrojen duyarlı genler) birçok genler nedeniyle düşük undetected gitmek tek hücreli RNA-seq. Enhancer-i duyarlılığını ayrı ayrı ve birlikte herhangi bir gen arttırıcılar çalışmak için güvenilir bir yöntem sağlar.
En kritik artırıcı-i transfection, faiz hücre satırı için optimize edilmelidir adımdır. Puromisindir tedavi transfected hücreler için zenginleştirmek için bu protokolü kullanır ama bu ortak transfecting RNA'ların floresan bir protein ve Kılavuzu akış sitometresi kullanarak floresan hücreleri için sıralama bazı hücre için daha iyi bir zenginleştirme yöntemi olarak kanıtlamak Mayıs mümkündür türleri. İfade düzey kılavuzun RNA'ların ve SID4x-dCas9-KRAB gidermek ve transfection onaylamak için qPCR tarafından izlenmesi tavsiye ediyoruz. Kılavuzu RNA düzeyleri düşüktür (döngüsü eşik > 30), kullanıcılar ayrıca RNA üretim stratejileri vitro transkripsiyon28gibi alternatif Kılavuzu düşünün. Yüksek gRNA düzeyleri rağmen Kılavuzu RNA SID4x-dCas9-KRAB protein verimsiz hedefliyor, bu durumda farklı Seçme Kılavuzu RNA dizilerinin gerekli olabilir olanağı da sağlar. Füzyon proteini ile kromatin Enhancer-i tedavi hücrelerden üzerinde ChIP-seq gerçekleştirerek, hedefleme verimliliğini takip edilebilir. SID4x-dCas9-KRAB adlı bölge ilgi yüksek sinyal ve onun sözde hedef gen ifade değişiklik tespit edilir ise, o zaman büyük olasılıkla bölge okudu koşullar altında bu gen ifadesi için katkı sağlamamaktadır.
Bir potansiyel Enhancer-i çok fazla siteleri aynı anda hedeflenir Eğer hedef kapalı etkileri birikebilir kısıtlamasıdır. Yine de, özellikle dCas9 KRAB ifade poliklonal hücre satırı kullanıldığında CRISPR müdahale stratejileri nakavt için az daha RNAi29, hedef etkileri off olmasını. SID4X-dCas9-KRAB hedef kapalı genomik bağlama 10 site aynı anda hedeflerken gördün mü iken, biz gen ifade değişikliklerin sonucu olarak bağlama olayları belirlenememiştir. Bazı arttırıcılar birden çok organizatör ve/veya diğer arttırıcılar ile temasa geçebilirsiniz, gen düzenlemesi bu tür ortak ise belirsiz olmasına rağmen birçok gen ifade tek bir artırıcı hedefleme üzerine değişebilir mümkündür. İfade değişiklikleri belirli bir artırıcı hedefleme nedeniyle çoğu gözlenen onaylamak ve off-efektler hedef değil için Kullanıcı Kılavuzu aynı bölge hedefleme RNA'ların üst üste iki farklı kümesi ile Enhancer-i gerçekleştirebilirsiniz. Buna ek olarak, nükleaz yetkili Cas9 kullanarak bölge genetik silinmesi daha fazla gen ekspresyonu üzerindeki etkileri onaylayabilirsiniz.
Histon deasetilasyonu, aracılığıyla Enhancer-i işlevleri olarak devre dışı bırakma yetenekleri histon asetilasyon kayda değer düzeyine sahip arttırıcılar sınırlıdır mümkündür. Belirli arttırıcılar hedefleme daha etkili olabilir alternatif baskıcı füzyon çeşitli vardır. DNA metiltransferaz füzyon dCas9 için distal arttırıcılar30' a hedef zaman gen ekspresyonu azaltmak için kullanılabilir, ancak bu baskı genellikle geçici değildir. Başka bir baskıcı füzyon histon H3 lizin 27 trimethylation yol açar..... .şarap gen ekspresyonu dCas9-KRAB için benzer düzeyde hücre satırları ve rehberleri31çeşitli, GATA1 arkadaş (FOG1) etki alanı kullanır. İlginçtir, dCas9 için FOG1 daha fazla kopya ekleme rehberleri, SID'si etki alanı tek bir kopyasını şu anda Enhancer-i içinde kullanılan 4 kopya daha daha fazla artırıcı deaktivasyon sağlayabilir düşündüren, baskıcı potansiyel azalır. Bazı loci yukarıdaki dCas9 füzyon farklı kombinasyonları ikili hedefleme üzerinden yararlanabilir mümkündür. Örneğin, istikrarlı uzun vadeli baskı dCas9-DNMT3a ve dCas9-KRAB32eşzamanlı iletim tarafından elde edilebilir. Bu baskıcı füzyon çoğu sadece tek bir odağı bir anda hedef ve aynı anda birden fazla arttırıcılar manipüle en etkili olduğu belirsizdir.
Kullanıcı genler yüzlerce sözde arttırıcılar çalışma isterse enhancer-i, genler, bir avuç arttırıcılar kombinasyonları çalışmak için uygun bir yöntem ise biraz hala'nın üretimi sınırlı. Bu tekniğin gelecekteki uygulamalar aynı anda birden fazla örnekleri içinde birden çok gen ölçmek için görüntüleme tabanlı teknolojiler dahil edecektir. Önemlisi, bu teknolojilerin zaman alan RNA izolasyon ihtiyacını ortadan kaldırarak RNA molekülleri lysate, üzerinden doğrudan tespiti ile uyumlu. Bu uyarlamalar arttırıcılar büyük kümeleri sorgulama kolaylaştıracaktır.

Büyük ölçekli projeler kodla1, yol haritası Epigenomics2ve FANTOM gibi sıralama3 belirledik insan genomu içinde sözde arttırıcılar milyonlarca hücre türleri yüzlerce arasında. Bu her organizatörü ortalama 4,9 arttırıcılar ile ilişkilendirir ve gen ekspresyonu kez birden çok dağıtılmış düzenleyici etkileşimleri bütünleştirilmesi sonucu olduğunu düşündüren her artırıcı ortalama 2.4 genler3, ilgili kişileri tahmin edilmektedir. Bir önemli kalan sadece tek tek nasıl arttırıcılar gen ekspresyonu için katkıda tanımlamak için mücadeledir ama nasıl ifade etkiler için birleştirir. Genetik yaklaşımlar arttırıcılar fareler5 Drosophila4 model organizmalarda arasındaki ilişkileri tanımlamak için yaygın olarak kullanılır. Ancak, bu deneyler zaman alıcı ve düşük-üretim için birden çok gen, birden çok arttırıcılar çalışma vardır.
Artırıcı işlevi büyük ölçüde çalışmak için bir yaklaşım kitlesel paralel muhabir deneyleri içerir. Bu deneyleri DNA dizileri için yeteneklerini ifade bir muhabir gen6sürücü için binlerce eşzamanlı tarama sağlar. Bu deneyleri DNA dizisi yalnız gen yönetmelik bilgileri7iletmek için yeterli olabilir göstermiştir, onlar yerel kromatin bağlam dışında gerçekleştirilen uyarılar ve kapaklı bir organizatörü ile gelmek. Buna ek olarak, DNA dizisi kitlesel paralel muhabir deneyleri içinde analiz ediliyor genellikle ilgili çevresindeki sıra hariç tutabilirsiniz az 200 basepairs boyutudur. Muhabir deneyleri sadece bir dizi etkinlik teker teker ölçmek. gibi önemlisi, onlar dikkate arttırıcılar arasında bulunabilir karmaşık ilişkiler yapmak değil almak. Kitlesel paralel muhabir deneyleri bir DNA dizisi içsel etkinlikler hakkında bilgilendirici olabilir, böylece, onlar mutlaka bize o DNA dizisi genom bağlamında işlev bilgi yok.
Son zamanlarda gelişmiş CRISPR/Cas9 Araçlar8 kolaylaştırdı gen düzenlemesi çalışmanın arttırıcılar endojen odağı, silme için izin kadar. Ancak, aynı anda birden fazla arttırıcılar silme için genomik istikrarsızlık neden olabilir ve zaman alan ardışık artırıcı silmeleri bir tek hücre satırı oluşturmak için. Buna ek olarak, yeni genomik sıra onarım takip silme sitesinde oluşturulur ve bu dizi düzenleyici fonksiyonu kazanç olabilir. Cas9 alternatif versiyonu özellikle gen ekspresyonu,9,10 etkinleştirme veya11,12 etki alanlarına Cas9 nükleaz eksikliği şeklinde bastırmak füzyon güvenerek oransal için geliştirilmiştir (dCas9). Bu füzyon proteinler onlar fiziksel olarak DNA dizisi alter, bunun yerine bir düzenleyici bölgesi sorgulamak için epigenetik modüle olarak ve aynı anda birden fazla loci eğitimi için idealdir. En çok kullanılan baskıcı KAP1 Co önleyici karmaşık acemi, baskı ilişkili histon H3 lizin 9 trimethylation (H3K9me3)13birikimi teşvik KRAB, birleşimidir. dCas9-KRAB, olarak da bilinen CRISPR girişim14, hedef ve ekran bireysel arttırıcılar gen ifade15,16katkılarından dolayı kullanılmıştır; Ancak, bu aynı anda birden çok bölge hedefleme için optimize edilmiş değil. Çok katmanlı CRISPR girişim arttırıcılar, mozaik-seq17, için bir sürüm tek hücre RNA-seq bir okuma kullanır ama bu teknoloji pahalı ve yalnızca tek hücre düşük duyarlılık nedeniyle son derece ifade genler incelenmesi uygundur RNA-devamı.
Kombinatorik artırıcı işlev bağlamında, östrojen transkripsiyon bir yanıt dissekan için girişim tabanlı bir CRISPR yöntem geliştirmek için çalıştı. Yaklaşık yarısı östrojen duyarlı genlerin birden çok arttırıcılar olabilir östrojen yanıt olarak katılan ve düzenleyici mantık gerektirecektir anlama olduğunu düşündüren östrojen reseptör Alfa (ER) tarafından18, bağlı 2 veya daha fazla artırıcılar içeren aynı anda birden fazla arttırıcılar hedefleme. İlk çalışmalar CRISPR girişim Organizatör kullanarak tüm rehberleri KRAB-aracılı baskı19' a eşit derecede duyarlı ettiği gibi dCas9 için ayrı baskıcı etki alanı eklenmesi, etkinliğini kolaylaştırabilir gerekçeli çeşitli arttırıcılar. Histon uyku21, işe alım açar gibi Sin3a etkileşim etki alanı, Mad1 (SID)20 hangi transkripsiyon aktivitesiyle ilişkili histon asetil grupları kaldırmak seçtik. Önemlisi, SID'si etki alanı dCas922 ve TALEs23erimiş zaman gen ekspresyonu azaltılmasını etkili oldu ve Sin3a artırıcı sıra bağlamlarda24çeşitli güçlü bir baskıcı ortak faktör gösterdi. Biz 10 farklı arttırıcılar ER tarafından bağlı hedeflemek için SID4x-dCas9-KRAB (Enhancer-i) kullanılan ve östrojen transkripsiyon yanıt 4 genler18için gerekli olan ER bağlayıcı siteleri (ERBS) tanımlar. Biz de östrojen transkripsiyon yanıt üretimde işbirliği siteleri tanımlamak için arttırıcılar kombinasyonları hedefli. En fazla 50 siteler potansiyel olarak aynı anda tespit gen ifade değişikliklerle hedeflenebilir ki bulduk. ChIP-seq ve RNA-seq kullanarak, Enhancer-i aynı anda birden fazla arttırıcılar eğitim için çok özel bir teknik olduğunu gösterdi.
Bu protokol için Enhancer-i, bir doku kültürü ortamında aynı anda birden fazla arttırıcılar fonksiyonel çalışma sağlayan esnek bir teknik gerçekleştirme adımları açıklar. Artırıcı-i genetik silme işlemine son derece ilişkilidir ama histon uyku (HDACs) üzerinde bağlıdır geçici etkinliğini kaldırmayı sağlar. Kılavuzu RNA'ların aksine viral vektörler aracılığıyla kararlı tümleştirme geçici transfection üzerinden sunarak, bu iletişim kuralı ifade ve potansiyel H3K9me3 yayılmasını önler. Bu protokolü ayrıntılar kılavuzu RNA tasarım ve Gibson derleme yolu ile transfection, klonlama RNA'ların lipofection kullanma kılavuzu ve qPCR tarafından elde edilen gen ekspresyon Analizi değiştirir. Biz de Enhancer-i genom ve transcriptome düzeyinde hedefleme özgüllüğü değerlendirmek için yöntemler içerir. Bu teknik eğitim için geliştirilen gen düzenlemesi er arttırıcılar insan kanser hücre hatlarında bağlı, herhangi bir memeli artırıcı diseksiyon için geçerlidir.

<table><tbody><tr><td>ZR 96-well Quick-RNA Kit</td><td>Zymo Research</td><td>R1053</td><td></td></tr><tr><td>Power SYBR Green RNA-to-CT 1-Step</td><td>Applied Biosystems</td><td>4389986</td><td></td></tr><tr><td>AflII restriction enzyme</td><td>NEB</td><td>R0520S</td><td></td></tr><tr><td>Phusion High-Fidelity PCR Master Mix with HF Buffer</td><td>NEB</td><td>M0531L</td><td></td></tr><tr><td>NEBuilder HiFi DNA Assembly Master Mix</td><td>NEB</td><td>E2621L</td><td></td></tr><tr><td>FuGENE HD</td><td>Promega</td><td>E2312</td><td></td></tr><tr><td>DNA Clean &amp;amp; Concentrator Kit</td><td>Zymo Research</td><td>D4013</td><td></td></tr><tr><td>Buffer RLT Plus</td><td>Qiagen</td><td>1053393</td><td></td></tr><tr><td>b-estradiol</td><td>Sigma-Aldrich</td><td>E2758</td><td></td></tr><tr><td>Human: Ishikawa cells</td><td>ECACC</td><td>99040201</td><td></td></tr><tr><td>H3K27ac rabbit polyclonal</td><td>Active Motif&amp;nbsp;</td><td>39133</td><td></td></tr><tr><td>H3K9me3 rabbit polyclonal</td><td>Abcam&amp;nbsp;</td><td>ab8898</td><td></td></tr><tr><td>FLAG mouse monoclonal</td><td>Sigma-Aldrich&amp;nbsp;</td><td>F1804</td><td></td></tr><tr><td>ER alpha rabbit polyclonal</td><td>Santa Cruz</td><td>sc-544</td><td></td></tr><tr><td>pGL3-U6-PGK-Puro plasmid</td><td>Addgene&amp;nbsp;</td><td>51133</td><td>Shen et al., 2014</td></tr><tr><td>gRNA_cloningVector plasmid</td><td>Addgene&amp;nbsp;</td><td>41824</td><td>Mali et al., 2013</td></tr><tr><td>AflII U6 puromycin plasmid</td><td>Addgene&amp;nbsp;</td><td>106404</td><td>Carleton et al., 2017</td></tr><tr><td>SID4X-dCas9-KRAB plasmid</td><td>Addgene&amp;nbsp;</td><td>106399</td><td>Carleton et al., 2017</td></tr><tr><td>2-Mercaptoethanol</td><td>Sigma-Aldrich</td><td>M6250-10ML</td><td></td></tr><tr><td>UltraPure DNase/RNase-Free Distilled Water</td><td>ThermoFisher Scientific</td><td>10977-023</td><td></td></tr><tr><td>Opti-MEM I Reduced Serum Medium</td><td>Gibco</td><td>31985070</td><td></td></tr><tr><td>KAPA Stranded mRNA-Seq Kit, with KAPA mRNA Capture Beads</td><td>Kapa Biosytems</td><td>KK8420</td><td></td></tr><tr><td>Pierce Protease and Phosphatase Inhibitor Mini Tablets</td><td>ThermoFisher Scientific</td><td>A32959</td><td></td></tr><tr><td>Formaldehyde solution</td><td>Sigma-Aldrich</td><td>252549-25ML</td><td></td></tr><tr><td>Geneticin Selective Antibiotic (G418 Sulfate) (50 mg/mL)</td><td>ThermoFisher Scientific</td><td>10131035</td><td></td></tr><tr><td>LB Broth</td><td>ThermoFisher Scientific</td><td>10855001</td><td></td></tr><tr><td>Quick-DNA Miniprep Kit</td><td>Zymo Research</td><td>D3020</td><td></td></tr><tr><td>Quick-Load Purple 2-Log DNA Ladder</td><td>NEB</td><td>N0050S</td><td></td></tr></tbody></table>

dissection of enhancer function using multiplex crispr-based enhancer interference in cell lines

Birden çok arttırıcılar, genellikle belirli bir gen düzenleyen henüz çoğu genler için bu hangi arttırıcılar gen ekspresyonu için gereklidir ve bu arttırıcılar transkripsiyon bir yanıt üretmek için birleştirmek nasıl belirsizdir. Arttırıcılar milyonlarca tanımlandığı gibi yüksek üretilen iş araçları bir genom geniş ölçekte artırıcı işlevini belirlemek için gereklidir. Nükleaz-usta Cas9 kullanarak genetik silme işlemlerini yapma artırıcı işlev eğitim için geçerli yöntemleri içerir, ancak birden çok ardışık klonal hücre satırı olmalıdır gibi bu tekniği kullanarak birden çok arttırıcılar Kombinatorik etkileri çalışma zordur oluşturulan. Burada, Enhancer-i, onların endojen loci, aynı anda birden fazla arttırıcılar fonksiyonel sorgulama için izin veren bir CRISPR parazit tabanlı yöntem mevcut. Artırıcı-i nükleaz eksikliği için erimiş iki baskıcı etki alanlarının Cas9, SID ve KRAB, artırıcı deaktivasyon histon deasetilasyonu hedeflenen loci, üzerinden elde etmek için kullanır. Bu iletişim kuralı Kılavuzu RNA'lar hedef bölgeleri geçici inactivation etkinleştirmek için geçici transfection kullanır ve doku kültürü ayarları uyaranların indüklenebilir transkripsiyon yanıtlarını engelleme özellikle etkilidir. Artırıcı-i genomik hedefleme ve küresel gen ekspresyonu üzerindeki etkileri hem de çok özel. Bu iletişim kuralı elde edilen sonuçlar bir artırıcı gen ekspresyonu, katkı büyüklüğü ve katkı tarafından yakındaki diğer arttırıcılar nasıl etkilenir katkıda olup olmadığını anlamak için yardımcı.

Şekil 1 bir şematik iletişim kuralında tanımlanan iş akışı gösterir. ER-bağlı arttırıcılar östrojen düzenlenir gen ChIP-seq (Şekil 2A) ile tanımlanan 3 bağlayıcı siteleri yakın olan MMP17, yakınındaki katkılarıyla RNA'ların yol belirlemek için her bölge için dizayn edilmiştir. Kılavuzu RNA'lar, sıra her ER çevreleyen bir 600-900 bp pencere tasarlamak için ilgi bağlama sitesi seçilen ve Kılavuzu RNA tasarım programına. Kılavuzu kaynaklanan RNA 0-2 hedeften siteleri BLAT kullanarak insan genomu uyumlu tahmin diziler. Dört üst üste rehberlik ChIP-seq tarafından tanımlanmış bölgesine yayılmış RNA'ların ve DNaseI aşırı duyarlılık (Şekil 2B) hedefleme için seçildi. (Tablo 1) ek sırası aşağı akım klonlama ve sonucu olan 59 nükleotit parçaları sipariş edilen kolaylaştırmak için her iki ucu için eklendi. Elimize RNA'ların seyreltilmiş ve site ve kısa bir PCR tarafından havuza alınmış Kılavuzu Homoloji bölgeler önce Gibson derleme eklemek için gerçekleştirildi. Beklenen Kılavuzu RNA ürün dizisinin 20 basepairs 59 basepair her sonuna kadar ekleyecek olan "U6_internal" primerler (Tablo 1), kullanılarak kısa bir PCR sonra Kılavuzu RNA parça, bir ~ 100 basepair sırada ortaya çıkan Şekil 2C gösterir. Gibson derleme, bu kılavuzu RNA havuzları bakteri dönüştürülmüş ve plazmid minipreps ertesi gün hazırlanmıştır. Şekil 2B sonuçları nerede MMP17 yakın birden çok arttırıcılar yalnız hedeflenir artırıcı diseksiyon deney ve birlikte Geliștirici-i kullanarak gösterir. Enhancer-i tarafından hedef siteleri ile siyah bir altıgen gösterilir. Belirtilen Site Hedefleme Rehberi RNA plazmid stabil SID4X-dCas9-KRAB ifade bir östrojen yoksun Ishikawa hücre kültürünü transfected. İki gün sonra medya değiştirildi ve puromisindir transfected hücreler için zenginleştirmek için eklendi. Ertesi gün, 8 saat 10 nM estradiol tedavi aşağıdaki hücre hasat edildi. RNA izole edildi ve bir tek adımlı qPCR gerçekleştirildi. Site 3 Bu koşullarda (Şekil 2B, şerit II-IV) katkı sağlamamaktadır Örneğin, siteleri 1 ve 2 MMP17, bir tam östrojenik yanıt için gerekli iken. Ne zaman sadece 2 veya 3 sitelerdir etkin (VI ve VII), östrojen yanıttır ne zaman yok sitelerdir için benzer aktif (VIII), bu sitelerde bağımsız olarak katkıda bulunamaz düşündüren. 1 sitesi bazı ifade katkıda bulunabilir tek başına (v), ama en büyük etkinlik siteleri 1 ve 2 etkin olduğunda görülür (IV).
(Şekil 3A), aynı anda 4 farklı genler yakınındaki 10 arttırıcılar işlemek için RNA'ların karmaşık takımlık rehberlik 42 artırıcı kılavuzları ve 16 organizatörü kılavuzları içeren oluşturulan. Kılavuzu RNA oligos Başlangıç Kılavuzu RNA uzantısı PCR (adım 3.3) önce havuza alınmış ve elde edilen PCR ürünleri Saflaştırılmış ve Gibson derleme kullanarak boş puromisindir U6 klonlama vektör ile kombine. Gibson derleme birden çok bağımsız dönüşümleri gerçekleştirilen ve kaplama. Tabakları LB kazınmış ve 2-4 h önce maxiprep için dışarı büyümeye izin. Bu kılavuzu RNA havuzları stabil SID4X-dCas9-KRAB ifade bir östrojen yoksun Ishikawa hücre kültürünü transfected ve (Şekil 2B) açıklandığı gibi tedavi Şekil 3B temsilcisi indirimleri gen ifadesinde qPCR tarafından gösterir. İndirimleri Enhancer-i gelen sözde hedef gen organizatörü hedefleyerek elde edilen benzer. Şekil 3 c seyreltme kılavuzun etkileri RNA'ların Enhancer-i kullanarak östrojen yanıt azalma gösterir. 1:50 G0S2 hala yakınındaki artırıcı Hedefleme Rehberi RNA havuzu seyreltme Enhancer-i ilâ 50 hedeflemek için kullanılabilir düşündüren gen ekspresyonu önemli azalma verimleri hemen siteler. Ancak, devre dışı bırakma, daha duyarlı algılama yöntemleri istihdam edilmektedir sürece sitelerin yüzlerce aynı anda hedeflenemediği gösteren seyreltilmiş.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57883/57883fig1.jpg"> Şekil 1. Protokolü Enhancer-ı. kullanarak çok katmanlı artırıcı diseksiyon için şematik Kılavuzu RNA'ların (kırmızı ve mavi) kullanarak e-net ve seçili UCSC genom tarayıcı kullanarak tasarlanmıştır. Dört kılavuzu RNA'ların bu faiz (ChIP-seq tarafından tanımlanan transkripsiyon faktörü bağlayıcı siteleri) bölgelerinde yayılan seçilir. Faiz (kırmızı ve mavi) bölgeye göre havuza Kılavuzu RNA oligonucleotides Gibson derleme ve dönüşüm önce Homoloji bölgeleri (turuncu) eklemek için bir PCR tabi. Elde edilen plazmid havuzları stabil SID4X-dCas9-KRAB ifade hücre hatları veya vahşi-türü hücre SID4X-dCas9-KRAB plazmid ile birlikte lipofection yolu ile transfected. Kılavuzu RNA plazmid havuzları ayrı ayrı bir zamanda veya aynı anda birden çok site hedeflemek için birlikte tek bir site hedeflemek için transfected. Transfected hücre kılavuzu RNA'ları içeren hücreler için zenginleştirmek için antibiyotik ile tedavi edilir. ~ 72 h sonrası transfection hücre hasat. Nükleik asitler qPCR, RNA-seq veya çip seq. için çıkarılan <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/57883/57883fig1large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57883/57883fig2.jpg"> Şekil 2. Kılavuzu MMP17için RNA tasarım ve artırıcı diseksiyon. (A) genom tarayıcı ekran görüntüsü yakınındaki hedef için ER Alfa bağlı arttırıcılar (gri) MMP17. Bu rakam Carleton, et al. değiştirildi 18. (B) Kılavuzu RNA siteleri18bağlama 3 için tasarımlar. Bağlama için ChIP-seq tarafından tanımlandığı şekilde ER hedef ve 4 Kılavuzu RNA'ların kiremit bu bölgede sitedir. Bağlama Makinası açıklıklı, DNaseI hassasiyet sinyali Kılavuzu RNA tasarım için hedef sırasını tanımlamak için de kullanılabilir. ChIP-seq ve DNaseI HS veri ile 10 nM estradiol Homoloji bölgeleri eklemek için kısa bir PCR geçirmiş Gibson montaj için hazır 1 h. (C) temsilcisi Kılavuzu RNA serileri için tedavi Ishikawa hücrelerden elde edilmiştir. (D) MMP17 göreli ifade, özel bölgelerin Enhancer-i ve bir 8-h10 nM estradiol tedavi ile hedefleme takip qPCR ile ölçülür. MMP17 estradiol ile tedavi değil hücrelerdeki CTCF ve ifade düzeyini ifade görelidir. RNA'lar hedef organizatörü denetim Rehberi IL1RN. Tüm hata çubukları SEM temsil eden, çift yıldız belirtmek p < 0,01 ve tek yıldız belirtmek p < 0,05 eşleştirilmiş bir t-test. Bu rakam Carleton, değiştirilmiş ve ark. 18. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/57883/57883fig2large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57883/57883fig3.jpg"> Şekil 3. Birden çok arttırıcılar ile aynı anda farklı genler yakınındaki hedefleme havuzlu Enhancer-ı. (A) şeması bağlayıcı siteleri ve havuza alınan Enhancer-i içinde var olmak hedef için organizatör. (B) ifade E2 tedavi Ishikawa hücrelerde Enhancer-i plazmid Havuzu (yeşil), organizatörü-i plazmid Havuzu (mavi) veya kontrol gRNAs (beyaz)18transfected sonra qPCR tarafından ölçülen üzerinde etkileri. Tüm genler önemli bir azalma Enhancer-i ile görülmektedir. Bu rakam Carleton, güncellenmiştir ve ark. 18. E2 tedaviden sonra G0S2 ifade düzeyleri üzerine etkisi Ishikawa hücrelerde transfected Kılavuzu G0S2hedefleme RNA'ların farklı miktarda (C) . Hatta küçük miktarlarda Kılavuzu RNA ile önemli bir azalma görülebilir (1:50 seyreltme), ilâ düşündüren 50 siteler hedef aynı anda. Tüm hata çubukları SEM temsil eden, çift yıldız belirtmek p < 0,01 ve tek yıldız belirtmek p < 0,05 eşleştirilmiş bir t-test. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/57883/57883fig3large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>Adı</td>
			<td>Sıra</td>
		</tr>
<tr>
<td>U6_internal_F</td>
			<td>TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCG</td>
		</tr>
<tr>
<td>U6_internal_R</td>
			<td>GACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC</td>
		</tr>
<tr>
<td>U6_PCR_F</td>
			<td>CCAATTCAGTCGACTGGATCCGGTA</td>
		</tr>
<tr>
<td>U6_PCR_R</td>
			<td>AAAAAAAGCACCGACTCGGTGCCA</td>
		</tr>
<tr>
<td>gRNA_qPCR_F</td>
			<td>GCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCG</td>
		</tr>
<tr>
<td>gRNA_qPCR_R</td>
			<td>AAAAAGCACCGACTCGGTGCC</td>
		</tr>
<tr>
<td>dCas9_qPCR_F</td>
			<td>GTGACCGAGGGAATGAGAAA</td>
		</tr>
<tr>
<td>dCas9_qPCR_R</td>
			<td>AGCTGCTTCACGGTCACTTT</td>
		</tr>
<tr>
<td>pAC95_PCR_F</td>
			<td>AGAAGAGAAAGGTGGAGGCC</td>
		</tr>
<tr>
<td>pAC95_PCR_R</td>
			<td>CGTCACCGCATGTTAGAAGG</td>
		</tr>
<tr>
<td>SID4X_PCR_F</td>
			<td>CAATAGAAACTGGGCTTGTCG</td>
		</tr>
<tr>
<td>SID4X_PCR_R</td>
			<td>TCGTGCTTCTTATCCTCTTCC</td>
		</tr>
</tbody></table>Tablo 1. Kılavuz RNA uzantısı ve sıralama, qPCR ve füzyon protein tespiti için kullanılan astar.

Watch this Scientific Journal Video about Dissection of Enhancer Function Using Multiplex CRISPR-based Enhancer Interference in Cell Lines at JoVE.com

Dissection of Enhancer Function Using Multiplex CRISPR-based Enhancer Interference in Cell Lines

Bu iletişim kuralını tasarlayın ve çoğaltılmış arttırıcılar deactivating füzyon protein SID4X-dCas9-KRAB, olarak da bilinen artırıcı girişim (Enhancer-i) ile hedefleme gerçekleştirmek için gereken adımları açıklar. Bu iletişim kuralı gen ekspresyonu düzenleyen arttırıcılar tanımlaması sağlar ve ortak bir hedef geni düzenleyen arttırıcılar arasındaki ilişkileri diseksiyon kolaylaştırır.

Diseksiyon artırıcı işlevi hücre hatlarında Multiplex artırıcı CRISPR tabanlı girişim kullanma

Multiple enhancers often regulate a given gene, yet for most genes, it remains unclear which enhancers are necessary for gene expression, and how these ...

dissection-enhancer-function-using-multiplex-crispr-based-enhancer

Universidad de Cartagena UDEC

Research

JoVE Journal

Genetics

9.2K Görüntüleme.  University of Utah. Bu iletişim kuralını tasarlayın ve çoğaltılmış arttırıcılar deactivating füzyon protein SID4X-dCas9-KRAB, olarak da bilinen artırıcı girişim (Enhancer-i) ile hedefleme gerçekleştirmek için gereken adımları açıklar. Bu iletişim kuralı gen ekspresyonu düzenleyen arttırıcılar tanımlaması sağlar ve ortak bir hedef geni düzenleyen arttırıcılar arasındaki ilişkileri diseksiyon kolaylaştırır.

Video: Dissection of Enhancer Function Using Multiplex CRISPR-based Enhancer Interference in Cell Lines

Efficient Generation of hiPSC Neural Lineage Specific Knockin Reporters Using the CRISPR/Cas9 and Cas9 Double Nickase System

Gene targeting is a critical approach for characterizing gene functions in modern biomedical research. However, the efficiency of gene targeting in human cells has been low, which prevents the generation of human cell lines at a desired rate. The past two years have witnessed a rapid progression on improving efficiency of genetic manipulation by genome editing tools such as the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas (CRISPR-associated) system. This manuscript describes a protocol for generating lineage specific human induced pluripotent stem cell (hiPSC) reporters using CRISPR/Cas system assisted homologous recombination. Procedures for obtaining necessary components for making neural lineage reporter lines using the CRISPR/Cas system, focusing on construction of targeting vectors and single guide RNAs, are described. This protocol can be extended to platform establishment and mutation correction in hiPSCs.

Genome editing tools such as the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas (CRISPR-associated) system have greatly improved gene targeting efficiency in human induced pluripotent stem cells (hiPSCs). This manuscript describes a protocol for generating lineage specific hiPSC reporter using CRISPR/Cas system assisted homologous recombination.

HiPSC Sinir Lineage Özgül Knockin Muhabirleri Verimli Nesil kullanma CRISPR / Cas9 ve Cas9 Çift Nickase Sistemi

Gene targeting is a critical approach for characterizing gene functions in modern biomedical research. However, the efficiency of gene targeting in human ...

Gelişim Biyolojisi

Genome Editing and Directed Differentiation of hPSCs for Interrogating Lineage Determinants in Human Pancreatic Development

Interrogating gene function in self-renewing or differentiating human pluripotent stem cells (hPSCs) offers a valuable platform towards understanding human development and dissecting disease mechanisms in a dish. To capitalize on this potential application requires efficient genome-editing tools to generate hPSC mutants in disease-associated genes, as well as in vitro hPSC differentiation protocols to produce disease-relevant cell types that closely recapitulate their in vivo counterparts. An efficient genome-editing platform for hPSCs named iCRISPR has been developed through the TALEN-mediated targeting of a Cas9 expression cassette in the AAVS1 locus. Here, the protocols for the generation of inducible Cas9 hPSC lines using cells cultured in a chemically defined medium and a feeder-free condition are described. Detailed procedures for using the iCRISPR system for gene knockout or precise genetic alterations in hPSCs, either through non-homologous end joining (NHEJ) or via precise nucleotide alterations using a homology-directed repair (HDR) template, respectively, are included. These technical procedures include descriptions of the design, production, and transfection of CRISPR guide RNAs (gRNAs); the measurement of the CRISPR mutation rate by T7E1 or RFLP assays; and the establishment and validation of clonal mutant lines. Finally, we chronicle procedures for hPSC differentiation into glucose-responsive pancreatic &#946;-like cells by mimicking in vivo pancreatic embryonic development. Combining iCRISPR technology with directed hPSC differentiation enables the systematic examination of gene function to further our understanding of pancreatic development and diabetes disease mechanisms.

Protocols to generate hPSC mutant lines using the iCRISPR platform and to differentiate hPSCs into glucose-responsive &#946;-like cells are described. Combining genome editing technology with hPSC-directed differentiation provides a powerful platform for the systematic analysis of the role of lineage determinants in human development and disease progression.

İnsan Pankreas Geliştirme Lineage Belirleyicileri sorgulanması için Genom Düzenleme ve hPSCs arasında Yönetmen Farklılaşma

Interrogating gene function in self-renewing or differentiating human pluripotent stem cells (hPSCs) offers a valuable platform towards understanding ...

Genetik

Generating CRISPR/Cas9 Mediated Monoallelic Deletions to Study Enhancer Function in Mouse Embryonic Stem Cells

Enhancers control cell identity by regulating tissue-specific gene expression in a position and orientation independent manner. These enhancers are often located distally from the regulated gene in intergenic regions or even within the body of another gene. The position independent nature of enhancer activity makes it difficult to match enhancers with the genes they regulate. Deletion of an enhancer region provides direct evidence for enhancer activity and is the gold standard to reveal an enhancer's role in endogenous gene transcription. Conventional homologous recombination based deletion methods have been surpassed by recent advances in genome editing technology which enable rapid and precisely located changes to the genomes of numerous model organisms. CRISPR/Cas9 mediated genome editing can be used to manipulate the genome in many cell types and organisms rapidly and cost effectively, due to the ease with which Cas9 can be targeted to the genome by a guide RNA from a bespoke expression plasmid. Homozygous deletion of essential gene regulatory elements might lead to lethality or alter cellular phenotype whereas monoallelic deletion of transcriptional enhancers allows for the study of cis-regulation of gene expression without this confounding issue. Presented here is a protocol for CRISPR/Cas9 mediated deletion in F1 mouse embryonic stem (ES) cells (Mus musculus129 x Mus castaneus). Monoallelic deletion, screening and expression analysis is facilitated by single nucleotide polymorphisms (SNP) between the two alleles which occur on average every 125 bp in these cells.

Experimental validation of enhancer activity is best approached by loss-of-function analysis. Presented here is an efficient protocol that uses CRISPR/Cas9 mediated deletion to study allele-specific regulation of gene transcription in F1 ES cells which contain a hybrid genome (Mus musculus129 x Mus castaneus).

Yaratma CRISPR / Cas9 aracılığı monoallelik Delesyonlar Fare Embriyonik Kök Hücreleri Artırıcı Fonksiyonu Eğitim için

Enhancers control cell identity by regulating tissue-specific gene expression in a position and orientation independent manner. These enhancers are often ...

Genome Editing in Mammalian Cell Lines using CRISPR-Cas

The clustered regularly interspaced short palindromic repeats (CRISPR) system functions naturally in bacterial adaptive immunity, but has been successfully repurposed for genome engineering in many different living organisms. Most commonly, the wildtype CRISPR associated 9 (Cas9) or Cas12a endonuclease is used to cleave specific sites in the genome, after which the DNA double-stranded break is repaired via the non-homologous end joining (NHEJ) pathway or the homology-directed repair (HDR) pathway depending on whether a donor template is absent or present respectively. To date, CRISPR systems from different bacterial species have been shown to be capable of performing genome editing in mammalian cells. However, despite the apparent simplicity of the technology, multiple design parameters need to be considered, which often leave users perplexed about how best to carry out their genome editing experiments. Here, we describe a complete workflow from experimental design to identification of cell clones that carry desired DNA modifications, with the goal of facilitating successful execution of genome editing experiments in mammalian cell lines. We highlight key considerations for users to take note of, including the choice of CRISPR system, the spacer length, and the design of a single-stranded oligodeoxynucleotide (ssODN) donor template. We envision that this workflow will be useful for gene knockout studies, disease modeling efforts, or the generation of reporter cell lines.

CRISPR-Cas is a powerful technology to engineer the complex genomes of plants and animals. Here, we detail a protocol to efficiently edit the human genome using different Cas endonucleases. We highlight important considerations and design parameters to optimize editing efficiency.

Memeli hücre CRISPR-Cas kullanarak satırları genom düzenleme

The clustered regularly interspaced short palindromic repeats (CRISPR) system functions naturally in bacterial adaptive immunity, but has been ...

Investigation of the Transcriptional Role of a RUNX1 Intronic Silencer by CRISPR/Cas9 Ribonucleoprotein in Acute Myeloid Leukemia Cells

The bulk of the human genome (~98%) is comprised of non-coding sequences. Cis-regulatory elements (CREs) are non-coding DNA sequences that contain binding sites for transcriptional regulators to modulate gene expression. Alterations of CREs have been implicated in various diseases including cancer. While promoters and enhancers have been the primary CREs for studying gene regulation, very little is known about the role of silencer, which is another type of CRE that mediates gene repression. Originally identified as an adaptive immunity system in prokaryotes, CRISPR/Cas9 has been exploited to be a powerful tool for eukaryotic genome editing. Here, we present the use of this technique to delete an intronic silencer in the human RUNX1 gene and investigate the impacts on gene expression in OCI-AML3 leukemic cells. Our approach relies on electroporation-mediated delivery of two preassembled Cas9/guide RNA (gRNA) ribonucleoprotein (RNP) complexes to create two double-strand breaks (DSBs) that flank the silencer. Deletions can be readily screened by fragment analysis. Expression analyses of different mRNAs transcribed from alternative promoters help evaluate promoter-dependent effects. This strategy can be used to study other CREs and is particularly suitable for hematopoietic cells, which are often difficult to transfect with plasmid-based methods. The use of a plasmid- and virus-free strategy allows simple and fast assessments of gene regulatory functions.

Investigation of the Transcriptional Role of a RUNX1 Intronic Silencer by CRISPR/Cas9 Ribonucleoprotein in Acute Myeloid Leukemia Cells

Direct delivery of preassembled Cas9/guide RNA ribonucleoprotein complexes is a fast and efficient means for genome editing in hematopoietic cells. Here, we utilize this approach to delete a RUNX1 intronic silencer and examine the transcriptional responses in OCI-AML3 leukemic cells.

Akut Miyeloid Lösemi Hücrelerinde CRISPR/Cas9 Ribonükleoprotein ile RUNX1 Intronic Susturucunun Transkripsiyonel Rolünün İncelendirin

The bulk of the human genome (~98%) is comprised of non-coding sequences. Cis-regulatory elements (CREs) are non-coding DNA sequences that contain binding ...

Lentiviral CRISPR/Cas9-Mediated Genome Editing for the Study of Hematopoietic Cells in Disease Models

Manipulating genes in hematopoietic stem cells using conventional transgenesis approaches can be time-consuming, expensive, and challenging. Benefiting from advances in genome editing technology and lentivirus-mediated transgene delivery systems, an efficient and economical method is described here that establishes mice in which genes are manipulated specifically in hematopoietic stem cells. Lentiviruses are used to transduce Cas9-expressing lineage-negative bone marrow cells with a guide RNA (gRNA) targeting specific genes and a red fluorescence reporter gene (RFP), then these cells are transplanted into lethally-irradiated C57BL/6 mice. Mice transplanted with lentivirus expressing non-targeting gRNA are used as controls. Engraftment of transduced hematopoietic stem cells are evaluated by flow cytometric analysis of RFP-positive leukocytes of peripheral blood. Using this method, ~90% transduction of myeloid cells and ~70% of lymphoid cells at 4 weeks after transplantation can be achieved. Genomic DNA is isolated from RFP-positive blood cells, and portions of the targeted site DNA are amplified by PCR to validate the genome editing. This protocol provides a high-throughput evaluation of hematopoiesis-regulatory genes and can be extended to a variety of mouse disease models with hematopoietic cell involvement.

Described are protocols for the highly efficient genome editing of murine hematopoietic stem and progenitor cells (HSPC) by the CRISPR/Cas9 system to rapidly develop mouse model systems with hematopoietic system-specific gene modifications.

Hastalık Modellerinde Hematopoetik Hücrelerin İncelemi için Lentiviral CRISPR/Cas9-Aracılı Genom Düzenleme

Manipulating genes in hematopoietic stem cells using conventional transgenesis approaches can be time-consuming, expensive, and challenging. Benefiting ...

İmmünoloji ve Enfeksiyon

In Vitro Selection of Engineered Transcriptional Repressors for Targeted Epigenetic Silencing

Gene inactivation is instrumental to study gene function and represents a promising strategy for the treatment of a broad range of diseases. Among traditional technologies, RNA interference suffers from partial target abrogation and the requirement for life-long treatments. In contrast, artificial nucleases can impose stable gene inactivation through induction of a DNA double strand break (DSB), but recent studies are questioning the safety of this approach. Targeted epigenetic editing via engineered transcriptional repressors (ETRs) may represent a solution, as a single administration of specific ETR combinations can lead to durable silencing without inducing DNA breaks.
ETRs are proteins containing a programmable DNA-binding domain (DBD) and effectors from naturally occurring transcriptional repressors. Specifically, a combination of three ETRs equipped with the KRAB domain of human ZNF10, the catalytic domain of human DNMT3A and human DNMT3L, was shown to induce heritable repressive epigenetic states on the ETR-target gene. The hit-and-run nature of this platform, the lack of impact on the DNA sequence of the target, and the possibility to revert to the repressive state by DNA demethylation on demand, make epigenetic silencing a game-changing tool. A critical step is the identification of the proper ETRs&#39; position on the target gene to maximize on-target and minimize off-target silencing. Performing this step in the final ex vivo or in vivo preclinical setting can be cumbersome.
Taking the CRISPR/catalytically dead Cas9 system as a paradigmatic DBD for ETRs, this paper describes a protocol consisting of the in vitro screen of guide RNAs (gRNAs) coupled to the triple-ETR combination for efficient on-target silencing, followed by evaluation of the genome-wide specificity profile of top hits. This allows for reduction of the initial repertoire of candidate gRNAs to a short list of promising ones, whose complexity is suitable for their final&#160;evaluation in the therapeutically relevant setting of interest.

In Vitro Selection of Engineered Transcriptional Repressors for Targeted Epigenetic Silencing

Here, we present a protocol for the in vitro selection of engineered transcriptional repressors (ETRs) with high, long-term, stable, on-target silencing efficiency and low genome-wide, off-target activity. This workflow allows for reducing an initial, complex repertoire of candidate ETRs to a short list, suitable for further evaluation in therapeutically relevant settings.

In Vitro Hedeflenen Epigenetik Susturma için Tasarlanmış Transkripsiyonel Baskılayıcıların Seçimi

Gene inactivation is instrumental to study gene function and represents a promising strategy for the treatment of a broad range of diseases. Among ...

Biyomühendislik

Generation of Genomic Deletions in Mammalian Cell Lines via CRISPR/Cas9

The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 system may be re-purposed for site-specific eukaryotic genome engineering. CRISPR/Cas9 is an inexpensive, facile, and efficient genome editing tool that allows genetic perturbation of genes and genetic elements. Here we present a simple methodology for CRISPR design, cloning, and delivery for the production of genomic deletions. In addition, we describe techniques for deletion, identification, and characterization. This strategy relies on cellular delivery of a pair of chimeric single guide RNAs (sgRNAs) to create two double strand breaks (DSBs) at a locus in order to delete the intervening DNA segment by non-homologous end joining (NHEJ) repair. Deletions have potential advantages as compared to single-site small indels given the efficiency of biallelic modification, ease of rapid identification by PCR, predictability of loss-of-function, and utility for the study of non-coding elements. This approach can be used for efficient loss-of-function studies of genes and genetic elements in mammalian cell lines.

CRISPR/Cas9 is a robust system to produce disruption of genes and genetic elements. Here we describe a protocol for the efficient creation of genomic deletions in mammalian cell lines using CRISPR/Cas9.

CRISPR / Cas9 üzerinden Memeli Hücre Hatlarında Genomik Delesyonlar Üretimi

The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 system may be re-purposed for site-specific ...

Biyoloji

Electroporation-Based CRISPR-Cas9-Mediated Gene Knockout in THP-1 Cells and Single-Cell Clone Isolation

The human acute monocytic leukemia (AML) THP-1 cell line is widely used as a model to study the functions of human monocyte-derived macrophages, including their interplay with significant human pathogens such as the human immunodeficiency virus (HIV). Compared to other immortalized cell lines of myeloid origin, THP-1 cells retain many intact inflammatory signaling pathways and display phenotypic characteristics that more closely resemble those of primary monocytes, including the ability to differentiate into macrophages when treated with phorbol-12-myristate 13-acetate (PMA). The use of CRISPR-Cas9 technology to engineer THP-1 cells through targeted gene knockout (KO) provides a powerful approach to better characterize immune-related mechanisms, including virus-host interactions. This article describes a protocol for efficient CRISPR-Cas9-based engineering using electroporation to deliver pre-assembled Cas9:sgRNA ribonucleoproteins into the cell nucleus. Using multiple sgRNAs targeting the same locus at slightly different positions results in the deletion of large DNA fragments, thereby increasing editing efficiency, as assessed by the T7 endonuclease I assay. CRISPR-Cas9-mediated editing at the genetic level was validated by Sanger sequencing followed by Inference of CRISPR Edits (ICE) analysis. Protein depletion was confirmed by immunoblotting coupled with a functional assay. Using this protocol, up to 100% indels in the targeted locus and a decrease of over 95% in protein expression were achieved. The high editing efficiency makes it convenient to isolate single-cell clones by limiting dilution.

The THP-1 cell line is widely used as a model to investigate the functions of human monocytes/macrophages across various biology-related research areas. This article describes a protocol for efficient CRISPR-Cas9-based engineering and single-cell clone isolation, enabling the production of robust and reproducible phenotypic data.

THP-1 Hücrelerinde Elektroporasyon Tabanlı CRISPR-Cas9 Aracılı Gen Nakavt ve Tek Hücreli Klon İzolasyonu

The human acute monocytic leukemia (AML) THP-1 cell line is widely used as a model to study the functions of human monocyte-derived macrophages, including ...

CRISPR Gene Editing Tool for MicroRNA Cluster Network Analysis

MicroRNAs (miRNAs) have emerged as important cellular regulators (tumor suppressors, pro-oncogenic factors) of cancer and metastasis. Most published studies focus on a single miRNA when characterizing the role of small RNAs in cancer. However, ~30%&#160;of human miRNA genes are organized in clustered units that are often co-expressed, indicating a complex and coordinated system of noncoding RNA regulation. A clearer understating of how clustered miRNA networks function cooperatively to regulate tumor growth, cancer aggressiveness, and drug resistance is required before translating noncoding small RNAs to the clinic.
The use of a high-throughput clustered regularly interspaced short palindromic repeats (CRISPR)-mediated gene editing procedure has been employed to study the oncogenic role of a genomic cluster of seven miRNA genes located within a locus spanning ~35,000 bp in length in the context of prostate cancer. For this approach, human cancer cell lines were infected with a lentivirus vector for doxycycline (DOX)-inducible Cas9 nuclease grown in DOX-containing medium for 48 h. The cells were subsequently co-transfected with synthetic trans-activating CRISPR RNA (tracrRNA) complexed with genomic site-specific CRISPR RNA (crRNA) oligonucleotides to allow the rapid generation of cancer cell lines carrying the entire miRNA cluster deletion and individual or combination miRNA gene cluster deletions within a single experiment.
The advantages of this high-throughput gene editing system are the ability to avoid time-consuming DNA vector subcloning, the flexibility in transfecting cells with unique guide RNA combinations in a 24-well format, and the lower-cost PCR genotyping using crude cell lysates. Studies using this streamlined approach promise to uncover functional redundancies and synergistic/antagonistic interactions between miRNA cluster members, which will aid in characterizing the complex small noncoding RNA networks involved in human disease and better inform future therapeutic design.

This protocol describes a high-throughput clustered regularly interspaced short palindromic repeats (CRISPR) gene editing workflow for microRNA cluster network analysis that allows the rapid generation of a panel of genetically modified cell lines carrying unique miRNA cluster member deletion combinations as large as 35 kb within a single experiment.

MicroRNA Küme Ağ Analizi için CRISPR Gen Düzenleme Aracı

MicroRNAs (miRNAs) have emerged as important cellular regulators (tumor suppressors, pro-oncogenic factors) of cancer and metastasis. Most published ...