Gostaríamos de agradecer ao Meningitis Trust e ao MRC por fornecerem financiamento para este trabalho.

1. Geração do amplificador mutante por SOE-PCR23 e amplificação do de espectinomicina
<ol><li>Comece realizando a PCR para a amplificação dos braços de homologia (ply 5' (488 pb) e ply3' (715 bp) respectivamente) das regiões de flanco do gene da camada da cepa 519/43. Use primers plyFw1_NOTI (TTT GCGGCCGCCAGTAAATGACTTTATACTAGCTATG), ply5'R1_BamHI (CGAAATATAGACCAAAGGACCC GGATCC AGAACCAAACTTGACCTTGA), ply3'F1_BamHI (TCAAGGTCAAGTTTGGTTCTCTGGATCC GCGTCCTTTGGTCTATATTTCG) e plyRv2_NotI (TTTGCGGCCCCATTTTCTCTATTCTATTCTATTCTATTCTATTCTCTCT).</li>
	<li>Utilizar as seguintes condições de PCR para a ply5': desnaturação a 94 °C durante 60 s, passo 2: desnaturação a 94 °C durante 30 s, passo 3: recozimento a 58 °C durante 30 s, passo 4: extensão a 72 °C durante 30 s, passo 5: voltar ao passo 2 e repetir durante 35 ciclos, passo 6: extensão final a 72°C durante 30 s.<ol><li>Use as mesmas condições de PCR para ply3', com exceção do tempo de extensão na etapa 4 e na etapa 6, onde deve ser de 60 s.</li>
	</ol></li>
	<li>Analise os produtos de PCR por eletroforese em gel e extirpe o amplificão do gel.</li>
	<li>Purificar os amplificadores de PCR seguindo o protocolo descrito nas instruções do fabricante (Tabela de Materiais).</li>
	<li>Use quantidades equimolares de ambos os braços de homologia como modelos no SOE-PCR. Fundir os dois amplificadores usando primers plyFw1_ NOTI (TTT GCGGCCGCCAGTAAATGACTTTATACTAGCTATG) e plyRv2_NotI (TTTGCGGCCCCATTTTCTACCTTATCCTCTACC).</li>
	<li>Utilize as seguintes condições SOE-PCR (passo 1: desnaturação a 94 °C durante 2 min, passo 2: desnaturação a 94 °C durante 30 s, passo 3: recozimento a 58 °C durante 30 s, Passo 4: extensão a 68 °C durante 60 s, passo 5: voltar ao passo 2 e repetir durante 25 ciclos, passo 6: extensão final a 68 °C durante 90 s).</li>
	<li>Analisar o produto SOE-PCR por eletroforese em gel. Retire-o do gel usando um kit de extração de gel e siga as instruções fornecidas.</li>
	<li>Amplificar o de espectinomicina do plasmídeo pR412 utilizando as seguintes condições de PCR: passo 1: desnaturação a 94 °C durante 60 s, passo 2: desnaturação a 94 °C durante 30 s, passo 3: recozimento a 55 °C durante 30 s, passo 4: extensão a 68 °C durante 60 s, passo 5: voltar ao passo 2 e repetir durante 25 ciclos, passo 6: extensão final a 68 °C durante 60 s.<ol><li>Use primers BamHI_SP2F2 (GGATCC CTA GAA CTA GTG GAT CCC CC) e BamHI_SP2R2 (GGATCC AAT TCT GCA GAT TTT AC ATG ATC). O Plasmid pR412 foi adquirido do Dr. Marc PrudHomme (CNRS-Universite Paul Sabatier Toulouse França).</li>
	</ol></li>
	<li>Analisar os amplificadores de PCR por eletroforese em gel. Aumentar e purificar o amplificador de PCR resultante, conforme descrito acima.</li>
</ol>2. Geração de plasmídeo pSD1 e Transformação química de E. coli Dh5α
<ol><li>Realizar uma ligadura seguindo as instruções do fabricante do sistema pGEMT I (Tabela de Materiais). Em um tubo de microcentrífuga, adicione 5 μL de tampão de ligadura 2x, 1 μL de pGEMTeasy, 2 μL do produto ply_SOE, 1 μL de ligase de DNA T4 e água a um volume total de 20 μL. Incubar durante a noite a 4 °C. Isso gera o plasmídeo pSD1.</li>
	<li>Transformar E. coli Dh5α quimicamente competente com pSD1. Comece incubando 50 μL de E. coli Dh5α quimicamente competente com 3 μL de reação de ligadura pSD1 por 15 min no gelo. Em seguida, continue expondo as células ao choque térmico (42 °C, 30 s). Coloque as células no gelo por 2 min.</li>
	<li>Remova as células do gelo e adicione 350 μL de meio S.O.C. Incubar a cultura por 2 h a 37 °C, 120 rpm.</li>
	<li>Placa de transformação em ágar Luria Bertani (LBA) suplementado com 0,4 mM IPTG, 0,24 mg/mL X-Gal para seleção azul/branca e 100 μg/mL de ampicilina para garantir que todas as colônias que crescem na placa tenham a espinha dorsal do plasmídeo. As colônias brancas contêm pSD1.</li>
	<li>Escolher três colónias brancas e estabelecer crescimentos durante a noite em 10 ml de LB, suplementados com 100 μg/ml de ampicilina. Incubar as culturas durante a noite a 37 °C com agitação.</li>
	<li>No dia seguinte, centrifugar as culturas a 3.082 x g e usar o pellet para extração de plasmídeos.</li>
</ol>3. Extração de DNA plasmídico, digestão de restrição de pSD1 e gene de espectinomicina e montagem de pSD2
<ol><li>Extraia o DNA plasmídico seguindo as instruções fornecidas com o kit comercial (Tabela de Materiais).</li>
	<li>Configure uma digestão de restrição de BamHI para o plasmídeo pSD1 e o de espectinomicina previamente amplificado e purificado. Utilizar as seguintes condições e quantidades descritas no quadro 1.</li>
	<li>Incubar as reações de digestão de restrição e os controles a 37 °C por 3 h.</li>
	<li>Analisar o digesto de restrição por eletroforese, extirpar a banda e purificar seguindo as instruções fornecidas com o kit comercial (Tabela de Materiais).</li>
	<li>Em seguida, prepare uma reação de ligadura seguindo as instruções do fabricante (Tabela de Materiais) usando o pSD1 digerido por BamHI e a espectinomicina (a partir da etapa 3.2). Num tubo de microcentrífuga, adicionar os seguintes componentes de reacção: 5 μL de tampão de ligadura 2x, 2 μL pSD1, 2 μL de de espectinomicina, 1 μL de DNA ligase T4 e incubar durante a noite a 4 °C. Isso gera o plasmídeo pSD2.</li>
	<li>Transformar o plasmídeo pSD2 em E. coli Dh5α quimicamente competente, conforme descrito no passo 2.2.</li>
	<li>Selecione os transformadores portadores de plasmídeo pSD2 com base em sua capacidade de crescer em LBA suplementado com 100 μg/mL de espectinomicina e ampicilina.</li>
	<li>Realizar uma extração de DNA plasmídico (pSD2) conforme descrito acima e seguindo as instruções do fabricante (μL).</li>
</ol>4. Transformação da estirpe 519/43 de S. pneumoniae
<ol><li>Preparar uma cultura noturna de S. pneumoniae 519/43 em BHI e permitir que ela cresça estaticamente a 37 °C, 5% de CO2.</li>
	<li>No dia seguinte, diluir as culturas 1:50 e 1:100 em 10 mL de caldo BHI fresco. Incubar as culturas estaticamente a 37 °C até que a OD595nm esteja entre 0,05 e 0,1 (aquisição ótima de DNA mais próxima de 0,1 OD).</li>
	<li>Uma vez que uma OD de 0,1 é atingida, pegue 860 μL e transfira para um tubo de microcentrífuga. Neste mesmo tubo de microcentrífuga adicionar: 100 μL de 100 mM de NaOH, 10 μL de 20% (p/v) BSA, 10 μL de 100 mM CaCl 2,2 μL de 50 ng/mL CSP124 e 500 ng de pSD2.</li>
	<li>Incubar a reacção estaticamente a 37 °C durante 3 h.</li>
	<li>Placa de 330 μL em placas de ágar sangue (BA) a 5% suplementadas com 100 μg/mL de espectinomicina, a cada hora durante as 3 horas de incubação.</li>
	<li>Incubar as placas durante a noite a 37 °C, 5% de CO2. Colomendo colônias resistentes à espectromicina em outra placa de BA suplementada com 100 μg/mL de espectinomicina, bem como em placas de BA suplementadas com 100 μg/mL de ampicilina. Incubar ambos os conjuntos de placas durante a noite sob as condições indicadas acima. As placas de ampicilina devem testar a presença da espinha dorsal do plasmídeo.</li>
	<li>Confirmar a presença do de espectinomicina por PCR utilizando primers plyFw1_ NOTI (TTT GCGGCCGCCAGTAAATGACTTTATACTAGCTATG) e SPEC_REV (TAATTCCTCTAAGTCATAATTTCCG). Confirme a mutação por PCR usando os primers plySCN1 (CCAATGGAAATCGCTAGGCAAGAGATAA) e plySCN2 (ATTACTTAGTCCAACCACGGCTGAT) que se ligam fora da região mutada.</li>
	<li>Confirmar a integração na localização correta do genoma por sequenciamento usando primers plySCN1 (CCAATGGAAATCGCTAGGCAAGAGATAA), plySCN2 (ATTACTTAGTCCAACCACGGCTGAT), bem como primers com seu local de ligação no de espectinomicina sqr1 (CCTGATCCAAACATGTAAGTACC) sqf2 (CGTAGTTATCTTGGAGAGAATA) spec_sqf1 (GGTACTTACATGTTTGGATCAGG ) e spec_sqr2 TATTCTCTCCAAGATAACTACG.</li>
</ol>

<ol>
	<li>Bentley, S. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+Analysis+of+the+Capsular+Biosynthetic+Locus+from+All+90+Pneumococcal+Serotypes.">Genetic Analysis of the Capsular Biosynthetic Locus from All 90 Pneumococcal Serotypes.</a> PLoS Genetics. 2 (3), 31 (2006).</li><li>Calix, J. J., Nahm, M. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+pneumococcal+serotype,+11E,+has+a+variably+inactivated+wcjE+gene.">A new pneumococcal serotype, 11E, has a variably inactivated wcjE gene.</a> The Journal of Infectious Diseases. 202 (1), 29-38 (2010).</li><li>Park, I. H., Pritchard, D. G., Cartee, R., Brandao, A., Brandileone, M. C. C., Nahm, M. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+a+New+Capsular+Serotype+(6C)+within+Serogroup+6+of+Streptococcus+pneumoniae.">Discovery of a New Capsular Serotype (6C) within Serogroup 6 of Streptococcus pneumoniae.</a> Journal of Clinical Microbiology. 45 (4), 1225-1233 (2007).</li><li>Jin, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=First+Report+of+Putative+Streptococcus+pneumoniae+Serotype+6D+among+Nasopharyngeal+Isolates+from+Fijian+Children.">First Report of Putative Streptococcus pneumoniae Serotype 6D among Nasopharyngeal Isolates from Fijian Children.</a> The Journal of Infectious Diseases. 200 (9), 1375-1380 (2009).</li><li>Oliver, M. B., vander Linden, M. P. G., K&#252;ntzel, S. A., Saad, J. S., Nahm, M. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+Streptococcus+pneumoniae+Serotype+6+Variants+with+Glycosyltransferases+Synthesizing+Two+Differing+Repeating+Units.">Discovery of Streptococcus pneumoniae Serotype 6 Variants with Glycosyltransferases Synthesizing Two Differing Repeating Units.</a> Journal of Biological Chemistry. 288 (36), 25976-25985 (2013).</li><li>Calix, J. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serological+Characterization+of+Two+Capsule+Subtypes+among+Streptococcus+pneumoniae+Serotype+20+Strains.">Serological Characterization of Two Capsule Subtypes among Streptococcus pneumoniae Serotype 20 Strains.</a> Journal of Biological Chemistry. 287 (33), 27885-27894 (2012).</li><li>Park, I. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=and+Serological+Characterization+of+a+New+Pneumococcal+Serotype,+6H,+and+Generation+of+a+Pneumococcal+Strain+Producing+Three+Different+Capsular+Repeat+Units.">and Serological Characterization of a New Pneumococcal Serotype, 6H, and Generation of a Pneumococcal Strain Producing Three Different Capsular Repeat Units.</a> Clinical and Vaccine Immunology. 22 (3), 313-318 (2015).</li><li>O'Brien, K. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Burden+of+disease+caused+by+Streptococcus+pneumoniae+in+children+younger+than+5+years:+global+estimates.">Burden of disease caused by Streptococcus pneumoniae in children younger than 5 years: global estimates.</a> The Lancet. 374 (9693), 893-902 (2009).</li><li>Henriques-Normark, B., Tuomanen, E. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Pneumococcus:+Epidemiology,+Microbiology,+and+Pathogenesis.">The Pneumococcus: Epidemiology, Microbiology, and Pathogenesis.</a> Cold Spring Harbor Perspectives in Medicine. 3 (7), 010215 (2013).</li><li>Leimkugel, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Outbreak+of+Serotype+1+Streptococcus+pneumoniae+Meningitis+in+Northern+Ghana+with+Features+That+Are+Characteristic+of+Neisseria+meningitidis+Meningitis+Epidemics.">An Outbreak of Serotype 1 Streptococcus pneumoniae Meningitis in Northern Ghana with Features That Are Characteristic of Neisseria meningitidis Meningitis Epidemics.</a> The Journal of Infectious Diseases. 192 (2), 192-199 (2005).</li><li>Yaro, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epidemiological+and+Molecular+Characteristics+of+a+Highly+Lethal+Pneumococcal+Meningitis+Epidemic+in+Burkina+Faso.">Epidemiological and Molecular Characteristics of a Highly Lethal Pneumococcal Meningitis Epidemic in Burkina Faso.</a> Clinical Infectious Diseases. 43 (6), 693-700 (2006).</li><li>Antonio, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+epidemiology+of+pneumococci+obtained+from+Gambian+children+aged+2-29+months+with+invasive+pneumococcal+disease+during+a+trial+of+a+9-valent+pneumococcal+conjugate+vaccine.">Molecular epidemiology of pneumococci obtained from Gambian children aged 2-29 months with invasive pneumococcal disease during a trial of a 9-valent pneumococcal conjugate vaccine.</a> BMC Infectious Diseases. 8 (1), 81 (2008).</li><li>Kwambana-Adams, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+outbreak+of+pneumococcal+meningitis+among+older+children+(&#8805;5+years)+and+adults+after+the+implementation+of+an+infant+vaccination+programme+with+the+13-valent+pneumococcal+conjugate+vaccine+in+Ghana.">An outbreak of pneumococcal meningitis among older children (&#8805;5 years) and adults after the implementation of an infant vaccination programme with the 13-valent pneumococcal conjugate vaccine in Ghana.</a> BMC Infectious Diseases. 16 (1), 575 (2016).</li><li>Antonio, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Seasonality+and+outbreak+of+a+predominant+Streptococcus+pneumoniae+serotype+1+clone+from+The+Gambia:+Expansion+of+ST217+hypervirulent+clonal+complex+in+West+Africa.">Seasonality and outbreak of a predominant Streptococcus pneumoniae serotype 1 clone from The Gambia: Expansion of ST217 hypervirulent clonal complex in West Africa.</a> BMC Microbiology. 8 (1), 198 (2008).</li><li>Staples, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+characterization+of+an+Australian+serotype+1+Streptococcus+pneumoniae+outbreak.">Molecular characterization of an Australian serotype 1 Streptococcus pneumoniae outbreak.</a> Epidemiology and Infection. 143 (2), 325-333 (2015).</li><li>Gessner, B. D., Mueller, J. E., Yaro, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=African+meningitis+belt+pneumococcal+disease+epidemiology+indicates+a+need+for+an+effective+serotype+1+containing+vaccine,+including+for+older+children+and+adults.">African meningitis belt pneumococcal disease epidemiology indicates a need for an effective serotype 1 containing vaccine, including for older children and adults.</a> BMC Infectious Diseases. 10 (1), 22 (2010).</li><li>Hill, P. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nasopharyngeal+carriage+of+Streptococcus+pneumoniae+in+Gambian+infants:+a+longitudinal+study.">Nasopharyngeal carriage of Streptococcus pneumoniae in Gambian infants: a longitudinal study.</a> Clinical Infectious Diseases. 46 (6), 807-814 (2008).</li><li>Ebruke, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Temporal+changes+in+nasopharyngeal+carriage+of+Streptococcus+pneumoniae+serotype+1+genotypes+in+healthy+Gambians+before+and+after+the+7-valent+pneumococcal+conjugate+vaccine.">Temporal changes in nasopharyngeal carriage of Streptococcus pneumoniae serotype 1 genotypes in healthy Gambians before and after the 7-valent pneumococcal conjugate vaccine.</a> PeerJ. 3, 90 (2015).</li><li>Adegbola, R. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serotype+and+antimicrobial+susceptibility+patterns+of+isolates+of+Streptococcus+pneumoniae+causing+invasive+disease+in+The+Gambia+1996-2003.">Serotype and antimicrobial susceptibility patterns of isolates of Streptococcus pneumoniae causing invasive disease in The Gambia 1996-2003.</a> Tropical Medicine and International Health. 11 (7), 1128-1135 (2006).</li><li>Marks, L. R., Reddinger, R. M., Hakansson, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+Levels+of+Genetic+Recombination+during+Nasopharyngeal+Carriage+and+Biofilm+Formation+in+Streptococcus+pneumoniae.">High Levels of Genetic Recombination during Nasopharyngeal Carriage and Biofilm Formation in Streptococcus pneumoniae.</a> mBio. 3 (5), (2012).</li><li>Ritchie, N. D., Mitchell, T. J., Evans, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=What+is+different+about+serotype+1+pneumococci.">What is different about serotype 1 pneumococci.</a> Future Microbiology. 7 (1), 33-46 (2012).</li><li>Harvey, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+variable+region+of+pneumococcal+pathogenicity+island+1+is+responsible+for+unusually+high+virulence+of+a+serotype+1+isolate.">The variable region of pneumococcal pathogenicity island 1 is responsible for unusually high virulence of a serotype 1 isolate.</a> Infection and Immunity. 84 (3), 822-832 (2016).</li><li>Horton, R. M., Cai, Z. L., Ho, S. N., Pease, L. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+splicing+by+overlap+extension:+tailor-made+genes+using+the+polymerase+chain+reaction.">Gene splicing by overlap extension: tailor-made genes using the polymerase chain reaction.</a> BioTechniques. 8 (5), 528-535 (1990).</li><li>Alioing, G., Granadel, C., Morrison, D. A., Claverys, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Competence+pheromone,+oligopeptide+permease,+and+induction+of+competence+in+Streptococcus+pneumoniae.">Competence pheromone, oligopeptide permease, and induction of competence in Streptococcus pneumoniae.</a> Molecular Microbiology. 21 (3), 471-478 (1996).</li><li>Lund, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Enumeration and description of the strains belonging to the State Serum Institute, Copenhagen Denmark. , (1951).</li><li>Barany, F., Tomasz, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+transformation+of+Streptococcus+pneumoniae+by+heterologous+plasmid+deoxyribonucleic+acid.">Genetic transformation of Streptococcus pneumoniae by heterologous plasmid deoxyribonucleic acid.</a> Journal of Bacteriology. 144 (2), 698-709 (1980).</li><li>Terra, V. S., Homer, K. A., Rao, S. G., Andrew, P. W., Yesilkaya, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+novel+&#946;-galactosidase+activity+that+contributes+to+glycoprotein+degradation+and+virulence+in+Streptococcus+pneumoniae.">Characterization of novel &#946;-galactosidase activity that contributes to glycoprotein degradation and virulence in Streptococcus pneumoniae.</a> Infection and Immunity. 78 (1), (2010).</li><li>Terra, V. S., Zhi, X., Kahya, H. F., Andrew, P. W., Yesilkaya, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pneumococcal+6-phospho-&#946;-glucosidase+(BglA3)+is+involved+in+virulence+and+nutrient+metabolism.">Pneumococcal 6-phospho-&#946;-glucosidase (BglA3) is involved in virulence and nutrient metabolism.</a> Infection and Immunity. 84 (1), (2015).</li><li>Harvey, R. M., Ogunniyi, A. D., Chen, A. Y., Paton, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pneumolysin+with+Low+Hemolytic+Activity+Confers+an+Early+Growth+Advantage+to+Streptococcus+pneumoniae+in+the+Blood.">Pneumolysin with Low Hemolytic Activity Confers an Early Growth Advantage to Streptococcus pneumoniae in the Blood.</a> Infection and Immunity. 79 (10), 4122 (2011).</li><li>Terra, V. S., Plumptre, C. D., Wall, E. C., Brown, J. S., Wren, B. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+a+pneumolysin+deficient+mutant+in+Streptococcus+pneumoniae+serotype+1+strain+519/43+and+phenotypic+characterisation.">Construction of a pneumolysin deficient mutant in Streptococcus pneumoniae serotype 1 strain 519/43 and phenotypic characterisation.</a> Microbial Pathogenesis. 141, 103999 (2020).</li></ol>

Os autores não têm nada a revelar.

O Streptococcus pneumoniae, em particular o sorotipo 1, continua a ser uma ameaça global que causa doença pneumocócica invasiva e meningite. Apesar da introdução de várias vacinas que deveriam ser protetoras contra o sorotipo 1, na África, esse sorotipo ainda é capaz de causar surtos que levam a alta morbidade e mortalidade13. A capacidade de manipular geneticamente este sorotipo é de importância crítica devido à sua relevância clínica. O método descrito neste estudo permit...

Streptococcus pneumoniae (S. pneumoniae, o pneumococo) é uma das principais causas de morbidade e mortalidade em todo o mundo. Até recentemente, cerca de 100 sorotipos de S. pneumoniae foram descobertos 1,2,3,4,5,6,7. Anualmente, a doença pneumocócica invasiva (DPI) reivindica cerca de 700.000 mortes, de crianças menores de 5 anos8. S. pneumoniae é a principal causa de pneumonia bacteriana, otite média, meningite e septicemia em todo o mundo9.
No cinturão africano de meningite, o sorotipo 1 é responsável por surtos de meningite, onde o tipo de sequência (ST) ST217, um tipo de sequência extremamente virulento, é dominante 10,11,12,13,14,15. Sua importância na patologia da meningite tem sido comparada à de Neisseria meningitidis no cinturão africano de meningite16. O sorotipo 1 é frequentemente a principal causa de DPI; no entanto, é muito raramente encontrado em carruagens. De fato, na Gâmbia, esse sorotipo é responsável por 20% de todas as doenças invasivas, mas só foi encontrado em 0,5% dos portadores saudáveis14,17,18,19. A troca genética e a recombinação em pneumococos competentes ocorrem geralmente no transporte e não na doença invasiva20. Além disso, o sorotipo 1 demonstrou ter uma das taxas de transporte mais curtas descritas entre os pneumococos (apenas 9 dias). Portanto, tem sido proposto que esse sorotipo pode ter uma taxa de recombinação muito menor do que outros21.
Estudos aprofundados são necessários para entender a razão por trás da baixa taxa de transporte das cepas do sorotipo 1 e sua importância na doença invasiva na África Subsaariana.
Aqui relatamos um protocolo que permite a mutagênese em todo o genoma de uma cepa específica do sorotipo 1, 519/43. Esta estirpe pode facilmente adquirir e recombinar novo ADN no seu genoma. Este método ainda não é inter-tensão, mas é muito eficiente quando feito em fundo 519/43 (outros alvos foram mutados, manuscritos em preparação). Simplesmente usando a cepa 519/43 e explorando sua competência natural, bem como substituindo a maneira como o DNA exógeno é fornecido, fomos capazes de mutar o gene da pneumolisina (ply) nesta cepa do sorotipo 1. Esse método representa uma melhoria em relação ao apresentado por Harvey et al.22 , pois é feito em uma única etapa, sem a necessidade de passar o DNA por um sorotipo diferente. No entanto, e devido à variabilidade entre as cepas, nenhum método foi padronizado para todas as cepas. A capacidade de mutar genes específicos e observar seus efeitos permitirá uma compreensão profunda das cepas de S. pneumoniae do sorotipo 1 e fornecerá respostas para o papel dessas cepas na meningite na África Subsaariana.

<table><tbody><tr><td>AccuPrime &lt;em&gt;Pfx&lt;/em&gt; DNA polymerase</td><td>Invitrogen</td><td>12344024</td><td>Used for amplification of the fragments</td></tr><tr><td>Ampicillin sodium salt</td><td>Sigma Aldrich</td><td>A9518</td><td>Used for bacterial selection on stage 1(pSD1)</td></tr><tr><td>Blood Agar Base</td><td>Oxoid</td><td>CM0055</td><td>Used to plate &lt;em&gt;S. pneumoniae&lt;/em&gt; transformants</td></tr><tr><td>Bovine Serum Albumine</td><td>sigma</td><td>55470</td><td>used for &lt;em&gt;S. pneumoniae&lt;/em&gt; Transformation</td></tr><tr><td>Brain Heart Infusion</td><td>Oxoid</td><td>CM1135</td><td>used to grow &lt;em&gt;S. pneumoniae&lt;/em&gt; cells</td></tr><tr><td>Calcium Chloride Cacl&lt;sub&gt;2&lt;/sub&gt;</td><td>Sigma</td><td>449709</td><td>used for &lt;em&gt;S. pneumoniae&lt;/em&gt; Transformation</td></tr><tr><td>Competence stimulating peptide 1</td><td>AnaSpec</td><td>AS-63779</td><td>used for &lt;em&gt;S. pneumoniae&lt;/em&gt; Transformation</td></tr><tr><td>Luria Broth Agar</td><td>Gibco</td><td>22700025</td><td>used for plating and selection of pSD1 and pSD2</td></tr><tr><td>Luria Broth Base (Miller&#039;s formulation)</td><td>Gibco</td><td>12795027</td><td>used for plating and selection of pSD1 and pSD2</td></tr><tr><td>Monarch Gel Extraction Kit</td><td>NEB</td><td>T1020S</td><td>Used to extract the bands from the DNA gel</td></tr><tr><td>Monarch Plasmid Miniprep Kit</td><td>NEB</td><td>T1010S</td><td>Used to extract plasmid from the cells</td></tr><tr><td>pGEM T-easy</td><td>Promega</td><td>A1360</td><td>used as suicide plasmid</td></tr><tr><td>S.O.C.</td><td>Invitrogen</td><td>15544034</td><td>used for recovery of cells after transformation</td></tr><tr><td>Sodium Hydroxide (NaOH)</td><td>Sigma</td><td>S0899</td><td>used for &lt;em&gt;S.pneumoniae&lt;/em&gt; Transformation</td></tr><tr><td>Spectinomycin Hydrochloride</td><td>SigmaAldrich</td><td>PHR1426</td><td>Used for bacterial selection</td></tr><tr><td>Subcloning Efficiency DH5&amp;alpha; Competent Cells</td><td>Invitrogen</td><td>18265017</td><td>used for the creation of pSD1 and pSD2</td></tr></tbody></table>

constructing mutants in serotype 1 streptococcus pneumoniae strain 519/43

O sorotipo 1 do Streptococcus pneumoniae continua sendo um enorme problema em países de baixa e média renda, particularmente na África Subsaariana. Apesar de sua importância, os estudos nesse sorotipo têm sido dificultados pela falta de ferramentas genéticas para modificá-lo. Neste estudo, descrevemos um método para modificar geneticamente um isolado clínico do sorotipo 1 (cepa 519/43). Curiosamente, isso foi conseguido explorando a capacidade do pneumococo de adquirir DNA naturalmente. No entanto, ao contrário da maioria dos pneumococos, o uso de DNA linear não foi bem sucedido; para mutar essa importante cepa, um plasmídeo suicida teve que ser usado. Essa metodologia forneceu os meios para uma compreensão mais profunda desse sorotipo indescritível, tanto em termos de biologia quanto de patogenicidade. Para validar o método, a principal toxina pneumocócica conhecida, a pneumolisina, sofreu mutação por ter um fenótipo bem conhecido e fácil de seguir. Mostramos que o mutante, como esperado, perdeu sua capacidade de lisar glóbulos vermelhos. Ao sermos capazes de mutar um gene importante no sorotipo de interesse, pudemos observar fenótipos diferentes para a perda de função mutantes em infecções intraperitoneais e intranasais daqueles observados para outros sorotipos. Em resumo, este estudo prova que a estirpe 519/43 (serotipo 1) pode ser geneticamente modificada.

O protocolo descrito aqui começa usando a PCR para amplificar os braços de homologia esquerdo e direito, enquanto simultaneamente exclui 191 pb da região média do gene da dobra . Durante a realização da PCR, um sítio BamHI é introduzido no 3' do braço de homologia esquerdo e no final de 5' do braço de homologia direito (Figura 1A). Segue-se a PCR-SOE, onde os braços de homologia esquerdo e direito são fundidos em um amplicon (Figura 1B). Est...

Watch this Scientific Journal Video about Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43 at JoVE.com

Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43

Aqui, descrevemos uma cepa 519/43 do sorotipo 1 de S. pneumoniae que pode ser geneticamente modificada usando sua capacidade de adquirir naturalmente DNA e um plasmídeo suicida. Como prova de princípio, um mutante isogênico no gene da pneumolisina (plys) foi feito.

Construindo Mutantes na Cepa 519/43 do Streptococcus pneumoniae do Serotipo 1

Streptococcus pneumoniae serotype 1 remains a huge problem in low-and-middle income countries, particularly in sub-Saharan Africa. Despite its importance, ...

constructing-mutants-serotype-1-streptococcus-pneumoniae-strain

Universidad de Cartagena UDEC

Research

JoVE Journal

Immunology and Infection

Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43

1.6K visualizações.  London School of Hygiene and Tropical Medicine. Aqui, descrevemos uma cepa 519/43 do sorotipo 1 de S. pneumoniae que pode ser geneticamente modificada usando sua capacidade de adquirir naturalmente DNA e um plasmídeo suicida. Como prova de princípio, um mutante isogênico no gene da pneumolisina (plys) foi feito.

Vídeo: Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43

Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

Typical methods for the elucidation of the function of a particular gene involve comparative phenotypic analyses of the wild-type strain and a strain in which the gene of interest has been disrupted. A gene-disruption DNA construct containing a suitable antibiotic resistance marker gene is useful for the generation of gene-disrupted strains in bacteria. However, conventional construction methods, which require gene cloning steps, involve complex and time-consuming protocols. Here, a relatively facile, rapid, and cost-effective method for targeted gene disruption in Streptococcus mutans is described. The method utilizes a 2-step fusion polymerase chain reaction (PCR) to generate the disruption construct and electroporation for genetic transformation. This method does not require an enzymatic reaction, other than PCR, and additionally offers greater flexibility in terms of the design of the disruption construct. Employment of electroporation facilitates the preparation of competent cells and improves the transformation efficiency. The present method may be adapted for the generation of gene-disrupted strains of various species.

Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

We describe a facile, rapid, and relatively inexpensive method for the generation of gene-disrupted Streptococcus mutans strains; this technique may be adapted for the generation of gene-disrupted strains of various species.

Geração de um Gene-interrompeu Streptococcus mutans estirpe sem Gene clonagem

Typical methods for the elucidation of the function of a particular gene involve comparative phenotypic analyses of the wild-type strain and a strain in ...

Genética

Characterization of Inflammatory Responses During Intranasal Colonization with Streptococcus pneumoniae

Nasopharyngeal colonization by Streptococcus pneumoniae is a prerequisite to invasion to the lungs or bloodstream1. This organism is capable of colonizing the mucosal surface of the nasopharynx, where it can reside, multiply and eventually overcome host defences to invade to other tissues of the host. Establishment of an infection in the normally lower respiratory tract results in pneumonia. Alternatively, the bacteria can disseminate into the bloodstream causing bacteraemia, which is associated with high mortality rates2, or else lead directly to the development of pneumococcal meningitis. Understanding the kinetics of, and immune responses to, nasopharyngeal colonization is an important aspect of S. pneumoniae infection models.
Our mouse model of intranasal colonization is adapted from human models3 and has been used by multiple research groups in the study of host-pathogen responses in the nasopharynx4-7. In the first part of the model, we use a clinical isolate of S. pneumoniae to establish a self-limiting bacterial colonization that is similar to carriage events in human adults. The procedure detailed herein involves preparation of a bacterial inoculum, followed by the establishment of a colonization event through delivery of the inoculum via an intranasal route of administration. Resident macrophages are the predominant cell type in the nasopharynx during the steady state. Typically, there are few lymphocytes present in uninfected mice8, however mucosal colonization will lead to low- to high-grade inflammation (depending on the virulence of the bacterial species and strain) that will result in an immune response and the subsequent recruitment of host immune cells. These cells can be isolated by a lavage of the tracheal contents through the nares, and correlated to the density of colonization bacteria to better understand the kinetics of the infection.

Characterization of Inflammatory Responses During Intranasal Colonization with Streptococcus pneumoniae

Colonization of the murine nasopharynx with Streptococcus pneumoniae and the subsequent extraction of adherent or recruited cells is described. This technique involves flushing the nasopharynx and collection of the fluid through the nares and is adaptable for various readouts, including differential cell quantification and analysis of mRNA expression in situ.

Caracterização de Respostas Inflamatórias Durante Colonização Intranasal com Streptococcus pneumoniae

Nasopharyngeal colonization by Streptococcus pneumoniae is a prerequisite to invasion to the lungs or bloodstream1. This organism is capable of colonizing ...

Imunologia e Infecção

Following in Real Time the Impact of Pneumococcal Virulence Factors in an Acute Mouse Pneumonia Model Using Bioluminescent Bacteria

Pneumonia is one of the major health care problems in developing and industrialized countries and is associated with considerable morbidity and mortality. Despite advances in knowledge of this illness, the availability of intensive care units (ICU), and the use of potent antimicrobial agents and effective vaccines, the mortality rates remain high1. Streptococcus pneumoniae is the leading pathogen of community-acquired pneumonia (CAP) and one of the most common causes of bacteremia in humans. This pathogen is equipped with an armamentarium of surface-exposed adhesins and virulence factors contributing to pneumonia and invasive pneumococcal disease (IPD). The assessment of the in vivo role of bacterial fitness or virulence factors is of utmost importance to unravel S. pneumoniae pathogenicity mechanisms. Murine models of pneumonia, bacteremia, and meningitis are being used to determine the impact of pneumococcal factors at different stages of the infection. Here we describe a protocol to monitor in real-time pneumococcal dissemination in mice after intranasal or intraperitoneal infections with bioluminescent bacteria. The results show the multiplication and dissemination of pneumococci in the lower respiratory tract and blood, which can be visualized and evaluated using an imaging system and the accompanying analysis software.

Streptococcus pneumoniae is the leading pathogen causing severe community-acquired pneumonia and responsible for over 2&#160;million deaths worldwide. The impact of bacterial factors implicated in fitness or virulence can be monitored in real-time in an acute mouse pneumonia or bacteremia model using bioluminescent bacteria.

A seguir em tempo real o impacto de fatores de virulência do pneumococo em um mouse Pneumonia aguda Modelo Usando bactérias bioluminescentes

Pneumonia is one of the major health care problems in developing and industrialized countries and is associated with considerable morbidity and mortality. ...

Capsular Serotyping of Streptococcus pneumoniae Using the Quellung Reaction

There are over 90 different capsular serotypes of Streptococcus pneumoniae (the pneumococcus). As well as being a tool for understanding pneumococcal epidemiology, capsular serotyping can provide useful information for vaccine efficacy and impact studies.&#160;The Quellung reaction is the gold standard method for pneumococcal capsular serotyping. The method involves testing a pneumococcal cell suspension with pooled and specific antisera directed against the capsular polysaccharide. The antigen-antibody reactions are observed microscopically. The protocol has three main steps: 1) preparation of a bacterial cell suspension, 2) mixing of cells and antisera on a glass slide, and 3) reading the Quellung reaction using a microscope. The Quellung reaction is reasonably simple to perform and can be applied wherever a suitable microscope and antisera are available.

Capsular Serotyping of Streptococcus pneumoniae Using the Quellung Reaction

The Quellung reaction is the gold standard technique for serotyping Streptococcus pneumoniae. This technique utilizes a microscope and specific pneumococcal antisera and is commonly used in reference and research laboratories worldwide.

A sorotipagem capsular de<em&gt; Streptococcus pneumoniae</em&gt; Usando o Reaction Quellung

There are over 90 different capsular serotypes of Streptococcus pneumoniae (the pneumococcus). As well as being a tool for understanding pneumococcal ...

Visualization of Streptococcus pneumoniae within Cardiac Microlesions and Subsequent Cardiac Remodeling

During bacteremia Streptococcus pneumoniae can translocate across the vascular endothelium into the myocardium and form discrete bacteria-filled microscopic lesions (microlesions) that are remarkable due to the absence of infiltrating immune cells. Due to their release of cardiotoxic products, S. pneumoniae within microlesions are thought to contribute to the heart failure that is frequently observed during fulminate invasive pneumococcal disease in adults. Herein is demonstrated a protocol for experimental mouse infection that leads to reproducible cardiac microlesion formation within 30 hr. Instruction is provided on microlesion identification in hematoxylin &#38; eosin stained heart sections and the morphological distinctions between early and late microlesions are highlighted. Instruction is provided on a protocol for verification of S. pneumoniae within microlesions using antibodies against pneumococcal capsular polysaccharide and immunofluorescent microscopy. Last, a protocol for antibiotic intervention that rescues infected mice and for the detection and assessment of scar formation in the hearts of convalescent mice is provided. Together, these protocols will facilitate the investigation of the molecular mechanisms underlying pneumococcal cardiac invasion, cardiomyocyte death, cardiac remodeling as a result of exposure to S. pneumoniae, and the immune response to the pneumococci in the heart.

Visualization of Streptococcus pneumoniae within Cardiac Microlesions and Subsequent Cardiac Remodeling

Streptococcus pneumoniae forms discrete non-purulent microscopic lesions in the heart. Outlined is the protocol for a murine model of cardiac microlesion formation. Instruction is provided on microlesion visualization using microscopy, discrimination between early and late microlesions, and methods to detect cardiac remodeling in hearts of convalescent animals.

Visualização de<em&gt; Streptococcus pneumoniae</em&gt; Dentro Microle- cardíacas e remodelação cardíaca Subsequente

During bacteremia Streptococcus pneumoniae can translocate across the vascular endothelium into the myocardium and form discrete bacteria-filled ...

Medicina

Replication of the Ordered, Nonredundant Library of Pseudomonas aeruginosa strain PA14 Transposon Insertion Mutants

Pseudomonas aeruginosa is a phenotypically and genotypically diverse and adaptable Gram-negative bacterium ubiquitous in human environments. P. aeruginosa is able to form biofilms, develop antibiotic resistance, produce virulence factors, and rapidly evolve in the course of a chronic infection. Thus P. aeruginosa can cause both acute and chronic, difficult to treat infections, resulting in significant morbidity in certain patient populations. P. aeruginosa strain PA14 is a human clinical isolate with a conserved genome structure that infects a variety of mammalian and nonvertebrate hosts making PA14 an attractive strain for studying this pathogen. In 2006, a nonredundant transposon insertion mutant library containing 5,459 mutants corresponding to 4,596 predicted PA14 genes was generated. Since then, distribution of the PA14 library has allowed the research community to better understand the function of individual genes and complex pathways of P. aeruginosa. Maintenance of library integrity through the replication process requires proper handling and precise techniques. To that end, this manuscript presents protocols that describe in detail the steps involved in library replication, library quality control and proper storage of individual mutants.

Replication of the Ordered, Nonredundant Library of Pseudomonas aeruginosa strain PA14 Transposon Insertion Mutants

Pseudomonas aeruginosa infection causes significant morbidity in vulnerable hosts. The nonredundant transposon insertion mutant library of P. aeruginosa strain PA14, designated as PA14NR Set, facilitates analysis of gene functionality in numerous processes. Presented here is a protocol to generate high-quality copies of the PA14NR Set mutant library.

Replicação do requisitado, biblioteca não redundante de estirpe Pseudomonas aeruginosa PA14 Transposon mutantes de inserção

Pseudomonas aeruginosa is a phenotypically and genotypically diverse and adaptable Gram-negative bacterium ubiquitous in human environments. P. aeruginosa ...

Homogeneous Glycoconjugate Produced by Combined Unnatural Amino Acid Incorporation and Click-Chemistry for Vaccine Purposes

Genetic code expansion is a powerful tool to introduce unnatural amino acids (UAAs) into proteins to modify their characteristics, to study or create new protein functions or to have access to protein conjugates. Stop codon suppression, in particular amber codon suppression, has emerged as the most popular method to genetically introduce UAAs at defined positions. This methodology is herein applied to the preparation of a carrier protein containing an UAA harboring a bioorthogonal functional group. This reactive handle can next be used to specifically and efficiently graft a synthetic oligosaccharide hapten to provide a homogeneous glycoconjugate vaccine. The protocol is limited to the synthesis of glycoconjugates in a 1:1 carbohydrate hapten/carrier protein ratio but amenable to numerous pairs of biorthogonal functional groups. Glycococonjugate vaccine homogeneity is an important criterion to ensure complete physico-chemical characterization, thereby, satisfying more and more demanding drug regulatory agency recommendations, a criterion which is unmet by classical conjugation strategies. Moreover, this protocol makes it possible to finely tune the structure of the actual conjugate vaccine, giving rise to tools to address structure-immunogenicity relationships.

Genetic code expansion is applied for the introduction of an unnatural amino acid bearing a biorthogonal functional group on a carrier protein at a defined site. The biorthogonal function is further used for the site-selective coupling of a carbohydrate antigen to provide a homogeneous glycoconjugate vaccine.

Glicoconjugate homogêneo produzido por incorporação combinada de aminoácidos não naturais e click-química para fins de vacina

Genetic code expansion is a powerful tool to introduce unnatural amino acids (UAAs) into proteins to modify their characteristics, to study or create new ...

Bioengenharia

Purification of a High Molecular Mass Protein in Streptococcus mutans

Elucidation of a gene&#39;s function typically involves comparison of phenotypic traits of wild-type strains and strains in which the gene of interest has been disrupted. Loss of function following gene disruption is subsequently restored by exogenous addition of the product of the disrupted gene. This helps to determine the function of the gene. A method previously described involves generating a gtfC gene-disrupted Streptococcus mutans strain. Here, an undemanding method is described for purifying the gtfC gene product from the newly generated S. mutans strain following the gene disruption. It involves the addition of a polyhistidine-coding sequence at the 3&#8242; end of the gene of interest, which allows simple purification of the gene product using immobilized metal affinity chromatography. No enzymatic reactions other than PCR are required for the genetic modification in this method. The restoration of the gene product by exogenous addition after gene disruption is an efficient method for determining gene function, which may also be adapted to different species.

Purification of a High Molecular Mass Protein in Streptococcus mutans

Described here is a simple method for the purification of a gene product in Streptococcus mutans. This technique may be advantageous in the purification of proteins, especially membrane proteins and high molecular mass proteins, and can be used with various other bacterial species.

Purificação de uma proteína de massa molecular elevada em Streptococcus mutans

Elucidation of a gene&#39;s function typically involves comparison of phenotypic traits of wild-type strains and strains in which the gene of interest has ...

Inducing Meningococcal Meningitis Serogroup C in Mice via Intracisternal Delivery

Neisseria meningitidis (meningococcus) is a narrow-host-range microorganism, globally recognized as the leading cause of bacterial meningitis. Meningococcus is a transient colonizer of human nasopharynx of approximately 10% of healthy subject. In particular circumstances, it acquires an invasive ability to penetrate the mucosal barrier and invades the bloodstream causing septicaemia. In the latest case, fulminating sepsis could arise even without the consequent development of meningitis. Conversely, bacteria could poorly multiply in the bloodstream, cross the blood brain barrier, reach the central nervous system, leading to fulminant meningitis. The murine models of bacterial meningitis represent a useful tool to investigate the host-pathogen interactions and to analyze the pathogenetic mechanisms responsible for this lethal disease. Although, several experimental model systems have been evaluated over the last decades, none of these were able to reproduce the characteristic pathological events of meningococcal disease. In this experimental protocol, we describe a detailed procedure for the induction of meningococcal meningitis in a mouse model based on the intracisternal inoculation of bacteria. The peculiar signs of human meningitis were recorded in the murine host through the assessment of clinical parameters (e.g., temperature, body weight), evaluation of survival rate, microbiological analysis and histological examination of brain injury. When using intracisternal (i.cist.) inoculum, meningococci complete delivery directly into cisterna magna, leading to a very efficient meningococcal replication in the brain tissue. A 1,000-fold increase of viable count of bacteria is observed in about 18 h. Moreover, meningococci are also found in the spleen, and liver of infected mice, suggesting that the liver may represent a target organ for meningococcal replication.

Here, we describe a method to induce meningococcal meningitis through an intracisternal route of infection in adult mice. We present a step by step protocol of meningococcal infection from the preparation of inoculum to the intracisternal infection; then record the animal survival and evaluate the bacterial loads in murine tissues.

Indução meningocócica meningite sorogrupo C em camundongos via parto intracisternal

Neisseria meningitidis (meningococcus) is a narrow-host-range microorganism, globally recognized as the leading cause of bacterial meningitis. ...

Generation of In-Frame Gene Deletion Mutants in Pseudomonas aeruginosa and Testing for Virulence Attenuation in a Simple Mouse Model of Infection

Microorganisms are genetically versatile and diverse and have become a major source of many commercial products and biopharmaceuticals. Though some of these products are naturally produced by the organisms, other products require genetic engineering of the organism to increase the yields of production. Avirulent strains of Escherichia coli have traditionally been the preferred bacterial species for producing biopharmaceuticals; however, some products are difficult for E. coli to produce. Thus, avirulent strains of other bacterial species could provide useful alternatives for production of some commercial products. Pseudomonas aeruginosa is a common and well-studied Gram-negative bacterium that could provide a suitable alternative to E. coli. However, P. aeruginosa is an opportunistic human pathogen. Here, we detail a procedure that can be used to generate nonpathogenic strains of P. aeruginosa through sequential genomic deletions using the pEX100T-NotI plasmid. The main advantage of this method is to produce a marker-free strain. This method may be used to generate highly attenuated P. aeruginosa strains for the production of commercial products, or to design strains for other specific uses. We also describe a simple and reproducible mouse model of bacterial systemic infection via intraperitoneal injection of validated test strains to test the attenuation of the genetically engineered strain in comparison to the FDA-approved BL21 strain of E. coli.

Generation of In-Frame Gene Deletion Mutants in Pseudomonas aeruginosa and Testing for Virulence Attenuation in a Simple Mouse Model of Infection

Here, we describe a simple and reproducible protocol of mouse model of infection to evaluate the attenuation of the genetically modified strains of Pseudomonas aeruginosa in comparison to the United States Food and Drug Administration (FDA)-approved Escherichia coli for commercial applications.

Geração de mutantes de deleção de genes no quadro em Pseudomonas aeruginosa e testes para atenuação de virulência em um modelo simples de infecção por camundongos

Microorganisms are genetically versatile and diverse and have become a major source of many commercial products and biopharmaceuticals. Though some of ...

Construindo Mutantes na Cepa 519/43 do Streptococcus pneumoniae do Serotipo 1

Resumo

Explore mais vídeos

Capítulos neste vídeo